Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Koko: px
Aloita esitys sivulta:

Download "Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti"


1 Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti

2 Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa

3 Molekyyligenetiikka: pikaperusteet

4 DNAn rakennevirheet




8 Kromosomialueen deleetio Geeniannos pienenee Entsyymiaktiivisuus laskee Geeni1 Geeni2 Geeni3 Geeni4 Geeni5 Geeni6 Geeni1 Geeni2 Geeni3 Geeni4 Geeni5 Geeni6

9 Kromosomialueen monistuminen Geeniannos kasvaa Entsyymiaktiivisuus kasvaa Geeni1 Geeni2 Geeni3 Geeni4 Geeni5 Geeni6 Geeni1 Geeni2 Geeni3 Geeni4 Geeni5 Geeni6 Geeni2 Geeni3 Geeni2 Geeni3

10 Kromosomialueen translokaatio Balansoitu translokaatio Geeniannos ei muutu Vaikutukset vasta seuraavassa sukupolvessa Geeni1 Geeni2 Geeni3 Geeni4 Geeni5 Geeni6 Geeni1 Geeni2 Geeni3 Geeni4 Geeni5 Geeni6 Geeni11 Geeni12 Geeni13 Geeni14 Geeni15 Geeni16 Geeni11 Geeni12 Geeni13 Geeni14 Geeni15 Geeni16

11 Kromosomialueen translokaatio Ei-balansoitu translokaatio seuraavassa sukupolvessa Geeniannos muuttuu Geeni1 Geeni2 Geeni3 Geeni4 Geeni14 Geeni5 Geeni15 Geeni6 Geen Geeni1 Geeni2 Geeni3 Geeni4 Geeni5 Geeni6 Geeni11 Geeni12 Geeni13 Geeni5 Geeni6 Geeni11 Geeni12 Geeni13 Geeni14 Geeni15 Geeni16

12 Molekyyligenetiikka: miten meillä

13 Perinnöllisyyslääketieteen vastuualueen laboratoriot Perinnöllisten geenivirheiden analytiikka Somaattisten muutosten analytiikka Kromosomianalytiikka Sytogenetiikanlaboratorio Molekyyligenetiikanlaboratorio Molekyylipatologianlaboratorio

14 Sytogenetiikan laboratorio Kromosomitutkimukset Karyotyyppaus G-raidat, FISH Kehitysvammaisuus Perinnöllinen? Balansoitu kromosomimuutokset Kromosomianalytiikka Sytogenetiikanlaboratorio

15 Molekyylipatologian laboratorio Kasvainkudoksen kromosomimuutokset Leukemiat, Lymfoomat Klonaliteetti Jäännöstautidiagnostiikka Hoitovaste, syöpälääkkeen valinta (Companion testing) BCR-ABL fuusio : Glivec Her2 / rintasyöpä: Herceptin Geeniexpressioprofiilit Somaattisten DNA-muutosten analytiikka Molekyylipatologianlaboratorio

16 Geeniexpressioprofiili Syöpäkudoksen luokittelu Tutkitaan muutoksia tuhansien geenien mrna tasoissa Kuvaa muuttuneita säätelyjärjestelmiä ja metaboliareittejä

17 Molekyyligenetiikan laboratorio Vakavat perinnölliset sairaudet Perinnölliset hyytymishäiriöt Perinnöllisten Perinnöllinen syöpäalttius geenivirheiden Farmakogenetiikka analytiikka Sairastumisalttiudet Molekyyligenetiikanlaboratorio

18 Genetiikan valtaprosessit Nukleiinihappotutkimukset Automatisoitu esikäsittely Automatisoitu DNA-analytiikka

19 Genetiikan valtaprosessit Automatisoitu esikäsittely Manuaalinen esikäsittely Sekvensointi qpcr Automatisoitu DNA-analytiikka Fragmenttianalyysi Molekyylikaryotyyppaus Nukleiinihappotutkimukset

20 Genetiikan valtaprosessit Automatisoitu esikäsittely Manuaalinen esikäsittely Sekvensointi qpcr Fragmenttianalyysi Molekyylikaryotyyppaus Automatisoitu DNA-analytiikka Soluviljely Kromosomitutkimukset FISH -tutkimukset Nukleiinihappotutkimukset Kromosomitutkimukset

21 Molekyyligenetiikka: Automaation aika

22 Perinteiset menetelmät Vakavien perinnöllisten sairauksien diagnostiikka on ollut kallista Korkeat varmuusvaatimukset koska erittäin suuria ja kauaskantoisia (hoidollisia) päätöksiä tehdään yksittäisten tulosten perusteella Yksikköhinta korkea mutta hyväksyttävä korkean laadun ja kattavan harvinaisten sairauksien valikoiman takaamiseksi Vain laskemalla tuotantokuluja voidaan nukleiinihappodiagnostiikka saada osaksi muiden lääketieteen erikoisalojen toimintaa

23 Automaation tulo geenilaboratorioon Automatisoituja prosessilinjoja tarvitaan Yksikköhinta pienemmäksi Palvelunopeus suuremmaksi Esikäsittelyn automaatio Geenimonistuksen automaatio Analytiikan automaatio Tulosten lausunnan automaatio

24 Automaatiolinja DNA laboratoriossa Nykykehitys kuin automaation alku 20v. sitten kliinisellä kemialla Erilliset pipetointirobotit ja mittalaitteeet Automatisoitu toiminnanohjaus Tiedonsiirto verkossa tai muistitikulla ML työjonosta pipetointikartat, reagenssiohjeet Automatisoidut pipetointirobotit Automaattilausunnot suoraan potilaan asiakirjoihin (ML)

25 Automaattinen PCR pipetointi Edullinen esikäsittely, pipetoinnit robotilla PCR reaktioiden pipetointirobotti puhdastiloissa suodatin-irtokärjet 2 kpl 2-paikkaisia Peltier kylmäblokkeja 384 kuoppalevyformaatti reagenssikulutus laskee ¼:aan 4x enemmän näytteitä sarjassa

26 Automaattinen Pistemutaatioanalytiikka Pistemutaatioiden detektio robotiella 2 kpl Tecan Freedom EVO 150 Lämpöinkubaattorit Pesurit 384 levyille Uusi Infrapunamerkkiaineisiin perustuva detektiojärjestelmä LI-COR Aerius IR-detektori 8 kpl 96-mittalevyjä > 1 kpl 384 mittalevy

27 B-Lakt-D: 192 näytettä rinnakkaisineen NO HE HO 700 nm Norm 800 nm Mut Aqua

28 Automaattinen monimutaatioanalytiikka Useiden tutkimusten samanaikainen suoritus Ajetaan kerralla tulleet perinteiset mutaatiotutkimukset Farmakogenetiikka Lääkeainemetaboliaan liittyvien geenien variantit Vaikuttavat poistumis-/ aktivoitumisnopeuteen Lääkeaineinteraktiot Yksilölle optimaalisten annoksen / molekyylien valinta Valtamutaatiopaketit Rajallinen määrä mutaatiota Yhdessä riittävä selitysarvo populaatiossa Alttiusgeenitutkimukset

29 Pikatutkimusten automaatiopaketti TPMT-D HFE-D Varfa-D SLCO1B1

30 Suomalainen tautiperintö B-FiMut-D 24 Mutaatiota Kertymäsairaudet agu_m1 cln3_m1 cln5_m1 incl_m1 mul_m1 salla_m1 Metaboliset sairaudet ccd_m1 graci_m1 iosca_m1 lchad_m1 mcad_m1 meb_m1 Munuaistoimintasairaudet arpkd_m1 arpkd_m2 arpkd_m3 asaur_m1 nphs1_m1 nphs1_m2 Vakavat perinnölliset sairaudet 12srrna_m1 cohen_m1 hyls1_m1 meckl_m1 ush3_m1 ush3_m2

31 Molekyyligenetiikka: Geenitestien käyttö

32 Diagnostinen geenitutkimus Selvittävät lääkärin pyynnöstä potilaan tietyn geenirakenteen Tuloksella oltava yksilötason vaikutusta Diagnoosin varmistus / poissulku Hoitopäätökset Ennusteen arviointi Onko sairauden perinnöllinen muoto Perinnöllisyysneuvonta Perhesuunnittelu Sukulaiset riskissä Lääkeaineen tai annoksen arviointi

33 Mihin DNA testejä käytettiin ennen Pääosin vakavien perinnöllisten sairauksien mutaatioiden tutkimuksissa

34 Tyypillinen tapaus: Peittyvästi periytyvä Suomalaisen tautiperinnön sairaus Sairas lapsi perheelle usein täysi yllätys Suomalainen valtamutaatio kattaa > 90% sairastuvista

35 Mihin DNA testejä käytetään nyt Edelleen pääosin perinnöllisten sairauksien tutkimuksissa Tunnettujen mutaatioiden analytiikan lisäksi uusien mutaatioiden etsintä lisääntyy nopeasti. Sukujen omat mutaatiot Laajenemassa kaikille erikoisaloille Lakt-D on jo osa perusterveydenhoitoa HLA tutkimukset Varfa-D saa jalansijaa, mutta hitaasti


37 Lääkkeet & geenitestit Lääkkeiden tai niiden annoksen valinta potilaan genotyypin mukaan Farmakogenetiikka Lääkeaineen valinta (syövän) geenilöydösten / -muutosten perusteella Muutos tuumirisolun genomissa altistaa lääkkeelle tai estää lääkkeen toiminnan

38 Molekyyligenetiikka: Mihin menossa

39 Miten DNA testejä käytetään tulevaisuudessa Geenitestit arkipäiväistyvät Vakavien perinnöllisten sairauksien vapaaehtoiset kantajuustutkimukset Käyttö laajenee (vähitellen) kaikille lääketieteen erikoisaloille Kliinikoiden / asiakkaiden osaaminen?? (Syöpä)lääkeaineiden valinta Personalized medicine

40 Tulevaisuuden valinta Karyotyyppaus vs. Molekyylikaryotyyppaus

41 Tulevaisuuden valinta Monimutaatioanalytiikka mikrosiruilla vs. Sekvensointi 2:n (3:n) polven sekvenaattoreilla

42 Tyypillinen DNA sekvensaattori ABI 3130xl Kohdealueiden PCR-monistus 16 reaktiota / ajo

43 Uudet toisen polven DNA sekvensaattorit Ei geenimonistusta, satunnaistietoa Monia teknologioita kehitteillä ja käytössä miljoonia reaktiota / ajo 10 pvä, 5000 / näyte Koska tulokset tarpeeksi varmoja diagnostisiin tarkoituksiin?? Koska tarvetta??

44 Geenimuutoksen tunnistus tuumori DNAsta koko genomin sekvensoinnilla T N Chr N bp Deletion

45 qpcr Standardit Tuumori-DNA:ta lisätty normaali DNA:han

46 Tuumori-DNA:n mittaus plasmasta Liikutaan herkkyyden alarajoilla variaatiota

47 Perinnöllisyyslääketieteen vastuualueen laboratoriot Perinnöllisten geenivirheiden analytiikka Somaattisten DNA-muutosten analytiikka Genetiikan laboratorio Kromosomianalytiikka Sytogenetiikanlaboratorio Molekyyligenetiikanlaboratorio Molekyylipatologianlaboratorio

48 Geneeriset prosessit Nukleiinihappotutkimukset Esikäsittely PCR monistus Monistustuotteen analytiikka Lausunto Hyvin samanlaisia prosesseja käyttävät: Genetiikka Patologia Transplantaatio (HLA) Mikrobiologia Bakteriologia Automatisoituja linjatoimintoja joita voi soveltaa monissa prosesseissa

49 Geneeriset prosessit Nukleiinihappotutkimuksia harmonisoitaessa muistettava erot mm: Näytemateriaalissa Näytemäärissä Herkkyysvaatimuksissa Toimilupavaatimuksissa Akkreditointivaatimuksissa Korjattavissa olevia Kuvitelmat miten on pakko toimia Olemassa olevat laitteistoerot Tahtotila ratkaisee Tulosta alkaa tulla kun menestyksen halu voittaa mukavuuden halun

50 Labs are vital Molekyyligenetiikka Vakavat perinnölliset sairaudet Lääkeaineinteraktiot Mikrobiologia Lajitunnistus H1N1 Lääkeresistenssi MRSA HIV

51 Erikoistuminen kliinisissä erikoistumisohjelmissa DNA-laboratorio: Kliinisen kemian laboratorio: sairaalageneetikko sairaala kemisti

52 Erikoistuminen kliinisissä erikoistumisohjelmissa DNA-laboratoriot työllistävät tulevaisuudessa: -Sairaalageneetikkoja -Sairaalakemistejä -Insinöörejä -(Bio)informaatikkoja, ATK-asiantuntijat


NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS-tutkimukset lääkärin työkaluna 17.11.2016 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Mihin genetiikkaa tarvitaan? taudin patogeneesin ymmärtäminen diagnoosin varmentaminen/vahvistaminen


Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän


Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi

Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Annika Rökman sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Oma taustani FM genetiikka 1998 sairaalageneetikko 2004 FT Perinnöllisestä eturauhassyövästä 2004 Finaksen teknisenä arvioijana vuodesta


GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma

GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma Miika Linna, dos. TkT. Aalto-yliopisto HEMA / Terveyden ja hyvinvoinnin laitos Taustaa Uudet genomitietoon perustuvat hoidon


Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten


Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


Uuden sukupolven sekvensointimenetelmät ja diagnostiikka

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Juha-Pekka Pursiheimo Turun Yliopisto Turku Clinical Sequencing Laboratory (TCSL) Labquality Days 2016 11.02. 2016 n. 3,3 miljardia emäsparia kliinisesti


NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS:n haasteet diagnostiikassa 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet?

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Harvinaiset-seminaari TYKS 29.9.2011 Jaakko Ignatius TYKS, Perinnöllisyyspoliklinikka Miksi Harvinaiset-seminaarissa puhutaan


In Situ Hybridisaatio - menetelmä patologian laboratorion työvälineenä

In Situ Hybridisaatio - menetelmä patologian laboratorion työvälineenä In Situ Hybridisaatio - menetelmä patologian laboratorion työvälineenä Mervi Jumppanen sairaalasolubiologi Seinäjoen keskussairaala, patologian yksikkö Sisält ltö Menetelmän n periaate FISH ja CISH Käyttöalueet


Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin


Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien molekyylidiagnostiikkaa 30.8.2013 Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien WHO-luokitus on morfologinen Gradusten I-IV ryhmittelyn perustana on toiminut ennusteen huononeminen


Farmakogeneettiset testit apuna lääkehoidon arvioinnissa

Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit Farmakogenetiikalla tarkoitetaan geneettisiä variaatioita, jotka vaikuttavat lääkeainevasteeseen. Geneettisen tiedon hyödyntäminen


Uudet tekniikat infektio- diagnostiikassa

Uudet tekniikat infektio- diagnostiikassa Uudet tekniikat infektio- diagnostiikassa Labquality Days 5.2.2015 Kaisu Rantakokko-Jalava Tyks mikrobiologia ja genetiikka VSSHP Tyks-Sapa-liikelaitos Uusia tuulia kl. mikrobiologiassa MALDI-TOF bakteerien


Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Molekyylidiagnostiikka keuhkosyövän hoidossa Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Sidonnaisuudet Taloudelliset riippuvuudet: Konsultointi: - Tutkimusrahoitus: - Honorariat:


Genomitieto kliinikon apuna nyt ja tulevaisuudessa

Genomitieto kliinikon apuna nyt ja tulevaisuudessa Genomitieto kliinikon apuna nyt ja tulevaisuudessa Helena Kääriäinen Tutkimusprofessori 19.3.2014 Genomitieto / Helena Kääriäinen 1 Mistä kliinikosta puhumme? Kliinisistä geeneetikoista eli perinnöllisyyslääkäreistä?


Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa


Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä



HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA B-DNAmut-tutkimusnimikkeellä tehdyt lähetteet Fimlab Laboratoriot Oy:n genetiikan laboratoriossa vuosina 2013 ja 2014 Olli Kemppainen Emilia


Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent Huhtikuussa 2008

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent Huhtikuussa 2008 16 Kromosomimuutokset Huhtikuussa 2008 Tätä työtä tuki EuroGentest, joka on Euroopan yhteisön tutkimuksen kuudennen puiteohjelman rahoittama verkosto. Kääntänyt Tiina Lund-Aho yhteistyössä Väestöliiton


Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori


Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent

Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent 12 Geenitutkimuksista Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; Huhtikuussa 2008 Tätä työtä


Rintasyövän perinnöllisyys

Rintasyövän perinnöllisyys Lääketieteellisen genetiikan kurssi 17.9.2012 Rintasyövän perinnöllisyys Perinnöllinen syöpäalttius - esimerkkinä rintasyöpä Kristiina Aittomäki, dos. ylilääkäri Genetiikan vastuuyksikköryhmä/huslab/hus



GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus GENOMINEN VALINTA HEVOSJALOSTUKSESSA Markku Saastamoinen MTT Hevostutkimus Genominen valinta genomisessa valinnassa eläimen jalostusarvo selvitetään DNA:n sisältämän perintöaineksen tiedon avulla Genomi


Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =



RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA Johanna Mattson dosentti ylilääkäri, vs. toimialajohtaja HYKS Syöpäkeskus 28.11.2016 1 RINTASYÖPÄ SUOMESSA 5008 uutta tapausta vuonna 2014 Paikallinen rintasyöpä


Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:


Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016





Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve


Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5. Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.2016 Genetiikan tutkimukset sarkoomien diagnostiikassa


Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki


Luonnontieteilijät työnhakijoina

Luonnontieteilijät työnhakijoina Luonnontieteilijät työnhakijoina TEM-info 25.11.2015 Suvi Liikkanen Luonnontieteiden Akateemisten Liitto LAL ry. Webinaarin sisältö Taustaa luonnontieteilijöistä ja Luonnontieteiden Akateemisten Liiton


HPV-epidemiologiasta ja diagnostiikasta

HPV-epidemiologiasta ja diagnostiikasta HPV-epidemiologiasta ja diagnostiikasta Eeva Auvinen dosentti, vs. laboraattori HUSLAB Kliininen mikrobiologia, virologia Labquality 15.10.2004 1 Papilloomavirukset Ihmisillä ja useilla muilla eläinlajeilla,



METABOLISTEN SAIRAUKSIEN ANALYTIIKAN JÄRJESTÄMINEN NORDLAB OULUSSA. Marja-Kaisa Koivula Sairaalakemisti, FT, dosentti METABOLISTEN SAIRAUKSIEN ANALYTIIKAN JÄRJESTÄMINEN NORDLAB OULUSSA Marja-Kaisa Koivula Sairaalakemisti, FT, dosentti Esityksen sisältö Johdanto Kromatografiset menetelmät Entsymaattinen määritysmenetelmä


Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic





Farmakogeneettinen paneeli Geenitestillä tehokas ja turvallinen lääkehoito

Farmakogeneettinen paneeli Geenitestillä tehokas ja turvallinen lääkehoito Farmakogeneettinen paneeli Geenitestillä tehokas ja turvallinen lääkehoito VAIKUTTAVAA TERVEYSPALVELUA Farmakogenetiikka mitä ja miksi? Lääkehoitoihin tiedetään liittyvän huomattavaa yksilöllistä vaihtelua,



KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi


PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere

Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere Perinnöllisyys harvinaisten lihastautien aiheuttajana Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere 17.11.2011 Mistä lihastauti aiheutuu? Suurin osa on perinnöllisiä Osassa perimä altistaa


Laboratorion merkitys infektioiden diagnostiikassa. Risto Vuento Laboratoriokeskus PSHP

Laboratorion merkitys infektioiden diagnostiikassa. Risto Vuento Laboratoriokeskus PSHP Laboratorion merkitys infektioiden diagnostiikassa Risto Vuento Laboratoriokeskus PSHP Mikrobin ja ihmisen suhde Hyödylliset mikrobit, henkilön oma mikrobisto (ns. normaalifloora) Käsitteellä infektiotauti


NIPT. Non-invasiivinen prenataalitutkimus

NIPT. Non-invasiivinen prenataalitutkimus NIPT Non-invasiivinen prenataalitutkimus Non-invasiivinen prenataalitutkimus, NIPT B -NIPT-D ATK 8598 Non-invasiivinen prenataalitutkimus B -NIPTlaa ATK 8599 Non-invasiivinen prenataalitutkimus, laaja


9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun


Syto- ja molekyyligeneettisten

Syto- ja molekyyligeneettisten 1831 Katsausartikkeli Sytogenetiikka ja molekyylipatologia syöpätautien diagnostiikassa esimerkkeinä lymfoomat ja sarkoomat SAKARI KNUUTILA Syto- ja molekyyligenetiikka perinteisen patologian tukena täsmentää


Diagnostisen laboratoriotoiminnan kustannukset ja vaikuttavuus. Laboratoriopalvelut SOTE-uudistuksen säästötavoitteita toteuttamassa Kari Punnonen

Diagnostisen laboratoriotoiminnan kustannukset ja vaikuttavuus. Laboratoriopalvelut SOTE-uudistuksen säästötavoitteita toteuttamassa Kari Punnonen Diagnostisen laboratoriotoiminnan kustannukset ja vaikuttavuus Laboratoriopalvelut SOTE-uudistuksen säästötavoitteita toteuttamassa Kari Punnonen LABORATORIOPALVELUT 2000-LUVULLA Noin 15 vuoden kuluessa


Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012

Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012 Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012 Anna-Elina Lehesjoki, LKT Professori, tutkimusjohtaja Neurotieteen tutkimuskeskus, Helsingin yliopisto Lääketieteellisen genetiikan


Miten järjestäisin harvinaisepilepsian hyvän diagnostiikan ja hoidon; esimerkkinä Dravet n oireyhtymän haasteet

Miten järjestäisin harvinaisepilepsian hyvän diagnostiikan ja hoidon; esimerkkinä Dravet n oireyhtymän haasteet 20.3.2015 Miten järjestäisin harvinaisepilepsian hyvän diagnostiikan ja hoidon; esimerkkinä Dravet n oireyhtymän haasteet Eija Gaily oyl, lastenneurologian dos. HYKS, Lasten ja nuorten sairaala Sisältö


Ajankohtaista HIVlääkeresistenssistä. Inka Aho 11.02.2015

Ajankohtaista HIVlääkeresistenssistä. Inka Aho 11.02.2015 Ajankohtaista HIVlääkeresistenssistä Inka Aho 11.02.2015 HIV:n resistenssin tutkiminen Genotyyppinen resistenssi Lääkkeiden kohteena olevan proteiinin sekvenssin selvittäminen M184V Mutaatioiden merkitys


Virtaussytometrian perusteet

Virtaussytometrian perusteet Virtaussytometrian perusteet 11.2.2016 Sorella Ilveskero LT, erikoislääkäri Virtaussytometrian perusteet ja käyttö kliinisessä laboratoriossa virtaussytometrian periaate virtaussytometrinen immunofenotyypitys



KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS Koirilla esiintyy useita erilaisia perinnöllisiä sairauksia samalla tavalla kuin ihmisilläkin. Rotuhistoriasta johtuen perinnöllisten sairauksien yleisyys


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti


Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja


Kosteus- ja homeongelmat Suomessa

Kosteus- ja homeongelmat Suomessa Kosteus- ja homeongelmat Suomessa Eduskunnan Tarkastusvaliokunnan tutkimus 2012 Kari Reijula, LKT, professori Helsingin yliopisto ja Työterveyslaitos 19.6.2017 Kari Reijula Kosteus- ja homeongelmat Suomessa


Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö

Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ituepidemia ja VTEC -tutkimukset elintarvikkeista Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ajankohtaista laboratoriorintamalla / 12.10.2011 EHEC-ITUEPIDEMIAN VAIHEITA: Vahva signaali epidemiasta


Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa

Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Maria Valkonen, Kaisa Jalkanen, Martin Täubel, Anne Hyvärinen 31.3.2014 Sisäilmastoseminaari 2014 1 Tausta Asumisterveysoppaan mukaiset sisäympäristön



UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA LIITU-päivä 4.5.2006 FT Helena Rintala Kansanterveyslaitos, Ympäristöterveyden osasto Mihin sisäympäristön mikrobien mittauksia tarvitaan? Rakennusten



SELKÄYDINNESTEEN PERUSTUTKIMUKSET Käyttöönottopäivä: 21.11.2011 1 (5) SELKÄYDINNESTEEN PERUSTUTKIMUKSET Atk-numero ja -lyhenne 1154 Li-BaktVi 1470 Li-Gluk 2186 Li-Laktaat 2514 Li-Prot 2655 Li-Solut 4059 Li-Syto Likvorin irtosolututkimus


ikiön seulonta- ja kromosomitutkimukset

ikiön seulonta- ja kromosomitutkimukset POTILASOHJE 1 (8) S ikiön seulonta- ja kromosomitutkimukset POTILASOHJE 2 (8) SISÄLLYSLUETTELO Mitä kehityshäiriöiden seulonta tarkoittaa? 3 Ultraääniseulontatutkimukset 4 Varhainen ultraääniseulonta Toisen



KATSAUS KÄÄPIÖSNAUTSEREIDEN GEENITESTAUKSEEN Inka Vaskimo/SKSK ry jalostustoimikunta KATSAUS KÄÄPIÖSNAUTSEREIDEN GEENITESTAUKSEEN Inka Vaskimo/SKSK ry jalostustoimikunta Erilaisten sairauksien tutkiminen koirien DNA:sta on viime vuosina kasvanut räjähdysmäisesti. Tutkimuksia on runsaasti


Keuhkoahtaumataudin varhaisdiagnostiikka ja spirometria. Esko Kurttila Keuhkosairauksien ja työterveyshuollon erikoislääkäri

Keuhkoahtaumataudin varhaisdiagnostiikka ja spirometria. Esko Kurttila Keuhkosairauksien ja työterveyshuollon erikoislääkäri Keuhkoahtaumataudin varhaisdiagnostiikka ja spirometria Esko Kurttila Keuhkosairauksien ja työterveyshuollon erikoislääkäri Epidemiologia N. 10%:lla suomalaisista on keuhkoahtaumatauti Keuhkoahtaumatauti


Preanalytiikka tärkeä osa analytiikan laatua

Preanalytiikka tärkeä osa analytiikan laatua Preanalytiikka tärkeä osa analytiikan laatua Preanalytiikka Preanalyyttinen vaihe SFS-EN ISO 15189: 3.10 Tutkimusta edeltävät toimenpiteet Preanalyyttinen vaihe Kliinikon pyynnöstä käynnistetyt toimenpiteet/vaiheet


DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit



Kreatransporttihäiriö Tietolehtiset on tarkoitettu yleiskatsauksiksi johonkin tiettyyn oireyhtymään tai sairauteen, ne eivät korvaa perinnöllisyysneuvontaa tai erikoislääkärin konsultaatiota. Kreatransporttihäiriö Erikoislääkäri


Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa

Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa Kati Rajanen & Mira Tyni Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa Metropolia Ammattikorkeakoulu Bioanalyytikko Bioanalytiikan koulutusohjelma Opinnäytetyö 6.4.03 Tiivistelmä Tekijä(t) Otsikko


Käyttökokemuksia vedenlaatumittareista ja aineistojen käsittelystä

Käyttökokemuksia vedenlaatumittareista ja aineistojen käsittelystä Käyttökokemuksia vedenlaatumittareista ja aineistojen käsittelystä Marjo Tarvainen Asiantuntija, FT MITTARI hankkeen workshop 14.5.2013 Pyhäjärvi-instituutti 1 Mittarit Vedenlaatumittareita käytössä vuodesta



BIOLÄÄKETIETEEN LÄPIMURROT BIOLÄÄKETIETEEN LÄPIMURROT Jussi Huttunen Tampere 20.4.2016 LÄÄKETIETEEN MEGATRENDIT Väestö vanhenee ja sairauskirjo muuttuu Teknologia kehittyy - HOITOTEKNOLOGIA - tietoteknologia Hoito yksilöllistyy


Muuttuva diagnostiikka avain yksilöityyn hoitoon

Muuttuva diagnostiikka avain yksilöityyn hoitoon Muuttuva diagnostiikka avain yksilöityyn hoitoon Olli Carpén, Patologian professori, Turun yliopisto ja Patologian palvelualue, TYKS-SAPA liikelaitos ChemBio Finland 2013 EGENTLIGA HOSPITAL FINLANDS DISTRICT


Traumaperäisten stressihäiriöiden Käypä hoito suositus - sen hyödyistä ja rajoituksista

Traumaperäisten stressihäiriöiden Käypä hoito suositus - sen hyödyistä ja rajoituksista Traumaperäisten stressihäiriöiden Käypä hoito suositus - sen hyödyistä ja rajoituksista Markus Henriksson Ryhmäpäällikkö, lääkintöneuvos Psykiatrian dosentti, psykoterapeutti Valvira, terveydenhuollon


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset EU:ssa ei ole yleisesti hyväksyttyä elintarvikepetosten määritelmää. Yleinen ohjeistus löytyy elintarvikelainsäädäntöä


Luutuumorit IAP Turku Tom Böhling HUSLAB/Peijas-Hyvinkää ja HY

Luutuumorit IAP Turku Tom Böhling HUSLAB/Peijas-Hyvinkää ja HY Luutuumorit IAP Turku 7.5.2010 Tom Böhling HUSLAB/Peijas-Hyvinkää ja HY Luutuumori tiimi älä tee diagnoosia yksin Ortopedi Radiologi Onkologi Geneetikko ja Patologi -kliiniset tiedot/löydökset -natiivi-rtg,





Miten terveydenhuolto selviytyy tietotekniikan haasteista? -genetiikan näkökulmasta. Arto Orpana, FT, dos. Ylikemisti HUSLAB Genetiikan laboratorio

Miten terveydenhuolto selviytyy tietotekniikan haasteista? -genetiikan näkökulmasta. Arto Orpana, FT, dos. Ylikemisti HUSLAB Genetiikan laboratorio Miten terveydenhuolto selviytyy tietotekniikan haasteista? -genetiikan näkökulmasta Arto Orpana, FT, dos. Ylikemisti HUSLAB Genetiikan laboratorio Miten tietotekniikka selviytyy terveydenhuollon haasteista?


Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta

Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Genetiikan tutkijat Englannin Kennel Clubin ja AHT:n kanssa yhteistyössä ovat laatineet seuraavanlaisen artikkelin Episodic Fallingista


Erikoislääkäriennuste vuoteen 2030. Diagnostiset alat

Erikoislääkäriennuste vuoteen 2030. Diagnostiset alat Erikoislääkäriennuste vuoteen 2030 Diagnostiset alat Erikoislääkärien määrän ennuste vuoteen 2030 Diagnostiset erikoisalat Vuoden lopussa 2014 Vuoden lopussa 2030 Perusura: Muutos, lkm Perusura: Muutos,


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


Immuunipuutokset. Olli Vainio OY Diagnostiikan laitos OYS Kliinisen mikrobiologian laboratorio 17.10.2008

Immuunipuutokset. Olli Vainio OY Diagnostiikan laitos OYS Kliinisen mikrobiologian laboratorio 17.10.2008 Immuunipuutokset Olli Vainio OY Diagnostiikan laitos OYS Kliinisen mikrobiologian laboratorio 17.10.2008 Immuunijärjestelm rjestelmän n toiminta Synnynnäinen immuniteetti (innate) Välitön n vaste (tunneissa)


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


Selkäydinneste vai geenitutkimus?

Selkäydinneste vai geenitutkimus? Selkäydinneste vai geenitutkimus? 19.5.2016 Anne Remes, professori, ylilääkäri, Itä-Suomen yliopisto, KYS, Neurokeskus Nuorehko muistipotilas, positiivinen sukuhistoria Päästäänkö diagnostiikassa tarkastelemaan


Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se


Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyvaikutuksen synty Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyn ja biologisen materian vuorovaikutus Koska ihmisestä 70% on vettä, todennäköisin (ja tärkein) säteilyn ja biologisen


Yhtenäisen laatujärjestelmän rakentaminen muutostilanteessa. Sari Väisänen Itä-Suomen laboratoriokeskuksen liikelaitoskuntayhtymä (ISLAB)

Yhtenäisen laatujärjestelmän rakentaminen muutostilanteessa. Sari Väisänen Itä-Suomen laboratoriokeskuksen liikelaitoskuntayhtymä (ISLAB) Yhtenäisen laatujärjestelmän rakentaminen muutostilanteessa Sari Väisänen Itä-Suomen laboratoriokeskuksen liikelaitoskuntayhtymä (ISLAB) Mikä on ISLAB? Kunnallinen organisaatio: liikelaitoskuntayhtymä


PCR syöpädiagnostiikassa ja seurannassa -tekniikka ja sovellutuksia. Veli Kairisto Kl. kemian ja lab.hematologian el. oyl., dos. Tyks-Sapa, Tykslab

PCR syöpädiagnostiikassa ja seurannassa -tekniikka ja sovellutuksia. Veli Kairisto Kl. kemian ja lab.hematologian el. oyl., dos. Tyks-Sapa, Tykslab PCR syöpädiagnostiikassa ja seurannassa -tekniikka ja sovellutuksia Veli Kairisto Kl. kemian ja lab.hematologian el. oyl., dos. Tyks-Sapa, Tykslab Polymeraasiketjureaktio (PCR) Reaaliaikainen kvantitatiivinen


Itämeren sedimentin ja rautamangaanisaostumien. hajottaa raakaöljyä ja naftaleenia. Suomen ympäristökeskus

Itämeren sedimentin ja rautamangaanisaostumien. hajottaa raakaöljyä ja naftaleenia. Suomen ympäristökeskus Itämeren sedimentin ja rautamangaanisaostumien bakteerien kyky hajottaa raakaöljyä ja naftaleenia Mikrokosmoskokeet 23.7.-18.12.2012 Anna Reunamo, Pirjo Yli-Hemminki, Jari Nuutinen, Jouni Lehtoranta, Kirsten






Versio 8/31.03.2000 SUOMEN KLIINISEN KEMIAN YHDISTYS STRATEGIASUUNNITELMA 1(5) Versio 8/31.03.2000 SUOMEN KLIINISEN KEMIAN YHDISTYS STRATEGIASUUNNITELMA Suomen Kliinisen Kemian Yhdistys (SKKY) on laatinut tämän strategiasuunnitelman, jossa kartoitetaan tämänhetkiset alan kehitysnäkymät


Laajakirjoisia beetalaktamaaseja tuottavat bakteerit ja MRSA - Uudet ilmoitettavat eläintaudit

Laajakirjoisia beetalaktamaaseja tuottavat bakteerit ja MRSA - Uudet ilmoitettavat eläintaudit Laajakirjoisia beetalaktamaaseja tuottavat bakteerit ja MRSA - Uudet ilmoitettavat eläintaudit Erikoistutkija Suvi Nykäsenoja Jaostopäällikkö Antibioottijaosto Elintarvike- ja rehumikrobiologian tutkimusyksikkö


Kuvanlaatu eri tutkimuksissa SPECT-TT ja PET-TT. Kirsi Timonen ylilääkäri, ksshp Kiitos Eila Lantolle!

Kuvanlaatu eri tutkimuksissa SPECT-TT ja PET-TT. Kirsi Timonen ylilääkäri, ksshp Kiitos Eila Lantolle! Kuvanlaatu eri tutkimuksissa SPECT-TT ja PET-TT Kirsi Timonen ylilääkäri, ksshp Kiitos Eila Lantolle! Miksi kuvanlaatuun kiinnitetään huomiota? Oikeutusarviointi. Onko TT-tutkimus yleensä oikeutettu? Tarvittavan


Hyvä tasalaatuisuus laboratoriossa. ISLAB, Joensuun aluelaboratorio Marja Liehu 11.2.2016

Hyvä tasalaatuisuus laboratoriossa. ISLAB, Joensuun aluelaboratorio Marja Liehu 11.2.2016 Hyvä tasalaatuisuus laboratoriossa ISLAB, Joensuun aluelaboratorio Marja Liehu 11.2.2016 KUOPIO KYS Iisalmen aluesairaala Pieksämäen aluesairaala Varkauden aluesairaala Harjulan sairaala JOENSUU Pohjois-Karjalan


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto

