VIIKKI BIOCENTER University of Helsinki

Koko: px
Aloita esitys sivulta:

Download "VIIKKI BIOCENTER University of Helsinki"


1 VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology

2 Kuinka solut kehittyivät? Kolmenlaisia soluja

3 Innovaatiojärjestelmät

4 Solujen kohtalot

5 Genomien koko Petri Auvinen, DNA Sequencing and Genomics Laboratory, Institute of Biotechnology, University of Helsinki

6 Kuinka monta geeniä tarvitaan?

7 Ihmisen kromosomit Kolibakteerin kromosomi

8 -2-3 % of the human genome is coding for proteins and rest is non coding -non coding consists of is introns, intergenic regions Genome -but 5% of the human genome is under purifying selection by analysis of the sequence -what is this 2-3% which is not coding for proteins? -small RNAs (mirna, sirna, long noncoding RNAs, regulatory sequences -long RNA might not be conserved by sequence still having function?

9 Eukaryoottien geenien ilmentyminen DNA pre-mrna mrna Transcription Processing Export protein Translation

10 THE CODE Petri Auvinen, DNA Sequencing and Genomics Laboratory, Institute of Biotechnology, University of Helsinki

11 Amino acid side groups

12 Genomitutkimuksen historian lyhyt oppimäärä 1865 Mendel genetiikan perusteet 1953 Watson and Crick kaksoiskierre 1966 Nirenberg, Khorana, Holley geneettinen koodi 1977 Maxam ja Gilbert sekä Sanger sekvensointi 1982 Genebank perustettiin 1990 Ihmisen genomiprojekti aloitettiin 1996 Hiivan genomisekvenssi valmistui 1998 C. elegans sekvenssi valmistui 1997 E. coli sekvenssi valmistui 2000 D. melanogaster 2001 Ihmisen genomin draft versio

13 2002 Hiiren genomi 2003 Ihmisen genomiprojekti loppui 2004 Ihmisen genomin valmisversio, rotta, kana 2005 Koira, simpanssi, ensimmäinen GWAS, HapMap ensimmäinen koko genomiin perustuva testi, merisiili, mehiläinen, NCBI genotyyppi ja fenotyyppi tietokanta 2007 Han kiinalainen genomi, ensimmäinen henkilökohtainen genomi (Venter), ENCODE pilotti, Wellcome trust case. vs control tutkimus, ihmisen geneettinen variaatio, reesusapina 2008 Glioblastooman geneettinen tutkimus, syöpägenomi AML), nokkaeläin, Yoruba (Afrikka) genomi, NGS genomi (Watson),

14 2009 Korealaisen genomi, ihmisen metylaatiokartta, naudan genomi, MGC mammalian gene collection, 2010 Nuffield council Bioetiikka julkaisu henkilökohtaisesta terveydenhuollosta, Miller syndrome geeni paikannettu eksonisekvensointia käyttäen, 1000 genomia projektin pilottiosuus valmis, Neanderthal genomi, modencode julkaisu, yli 1000 hiiren KO kantaa, UK Biobank osallistujaa, 5000 GWAS tutkimusta julkaistu, Etelä-Afrikkalaisia ihmisen genomeita Nature, 2011:470; genome project, Denisovan, Encode, jne..


16 Genome Sequencer (, (Margulies, et al. Nature 2005,437, 376) Genome Sequencer GS20;FLX; Titanium 454 Life Science, Roche Parallel Sequencing Shotgun sequencing No plasmid libraries Linkers ligated to fragments Emulsion PCR Picotiter plate, wells Pyrosequencing Detection with sensitive CCD camera Read length 800+ bp Run time ca. 23h Raw sequence ca Mb/run



19 454 Petri Auvinen, DNA Sequencing and Genomics Laboratory, Institute of Biotechnology, University of Helsinki

20 Illumina/Solexa Genome Analyzer ( ; Bentley,DR Curr Opinion Genet Dev 2006, 16, ) Clonal Single Molecule Array technology Sequencing-by-synthesis technology Reversible terminator-based sequencing removable fluorescence Flow cell with > 300 million clusters 1 8 samples / run 3 laser system (660, 635, and 532 nm) Read length bp, up to 1000 Gb / run Run time 3 10 days, Cluter Station Flow cell

21 Illumina/Solexa Sample preparation 100ng 1µg Attaching to Flow cell Bridging PCR Elongation Denaturation Clonal amplification

22 Illumina/Solexa sequencing Sequencing - First bases - Fluorescent reversible terminators - Detection with laser and CCD camera Sequencing - Second bases detected after removal of label and blocking


24 Metagenomiikka


26 Metagenomics using 16S ITS hypervariableregions.html

27 Background Allergy study is part of the Karelia project started 1972 Atopy, allergy and asthma component was added to the project 1997 We got into this project in 2010 because of the growing interest in the human microbiome/ microbial diversity in connection with allergy and disease in general

28 Objectives 1) Does the environmental biodiversity influence the composition of the skin microbial community? 2) Is allergy related to environmental biodiversity in the surroundings of homes? 3) Is allergy related to the composition of the skin microbial community? 4) Is there a connection between IL-10 expression and skin microbiota?






34 Petri Auvinen, DNA Sequencing and Genomics Laboratory, Institute of Biotechnology, University of Helsinki

35 Petri Auvinen, DNA Sequencing and Genomics Laboratory, Institute of Biotechnology, University of Helsinki


37 Mitä voidaan analysoida genominlaajuisesti? Genomi- ja metagenomi-sekvensointi RNA sekvensointi (mrna, mirna, lncrna etc) RNA rakenneanalyysit Epigeneettiset muutokset (metylaatio, histonit, ei-histoni proteiinit Rakenteellisetmuutokset (SNP) Genomien variaatiot (pan genomi) Tuman proteiinien ja DNA:n suuremmat organisaatiot Evoluutio Systeemibiologia

38 Kiitokset mielenkiinnosta

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen


Genomi- ilmentymisen säätely

Genomi- ilmentymisen säätely Genomi- ilmentymisen säätely Samuel Myllykangas, FT Biolääke


Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi


DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit


Luonto köyhtyy, me sairastumme mitä pitää tehdä?

Luonto köyhtyy, me sairastumme mitä pitää tehdä? Argumenta, Majvik 19.11.203 Luonto köyhtyy, me sairastumme mitä pitää tehdä? Tari Haahtela The striking contrast between Finnish and Russian Karelia von Hertzen L, and the Karelia Group. JACI 2006; Laakkonen


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve


Efficiency change over time

Efficiency change over time Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?


Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede.

Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros Dan Lindholm Genominen lääketiede Genomiprojektit Ihmisgenomi - geenien ja niiden erojen Taudinaiheuttajien genomit - diagnostiikka


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi


Allergia ja astma. Erkki Vartiainen, professori, ylijohtaja. 5.9.2012 Esityksen nimi / Tekijä 1

Allergia ja astma. Erkki Vartiainen, professori, ylijohtaja. 5.9.2012 Esityksen nimi / Tekijä 1 Allergia ja astma Erkki Vartiainen, professori, ylijohtaja 5.9.2012 Esityksen nimi / Tekijä 1 Aikuisväestön sekä lasten ja nuorten astma- ja allergiatutkimukset Pohjois- Karjalassa ja Pitkärannassa 5.9.2012


Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset


Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi)

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) CHEM-A1310 Biotieteen perusteet Heli Viskari 2017 DNA-harjoitustöiden aikataulu, valitse yksi näistä


Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012


FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL

FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...



NON-CODING RNA (ncrna) NON-CODING RNA (ncrna) 1. Yleistä NcRNA eli non-coding RNA tarkoittaa kaikkia proteiinia koodaamattomia rnamolekyylejä. Näistä yleisimmin tunnetut ovat ribosomaalinen RNA (rrna) sekä siirtäjä-rna (trna),


Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122

Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122 Bioinformatiikan maisteriohjelman infotilaisuus 15.11.2007 Exactum D122 Bio- ja lääketieteiden opiskelu MBImaisteriohjelmassa Outi Monni, Dos, FT Biolääketieteen laitos 15.11.2007 Bioinformatiikan maisteriohjelma


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne






LYTH-CONS CONSISTENCY TRANSMITTER LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are


DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä

Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Arkkitehtuuritietoisku eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Esikysymys Kuinka moni aikoo suunnitella projektityönsä arkkitehtuurin? Onko tämä arkkitehtuuria?


Genomi- ilmentymisen säätely

Genomi- ilmentymisen säätely Genomi- ilmentymisen säätely Samuel Myllykangas, FT Biolääke=eteen laitos Helsingin yliopisto 21.1.2014 Geeni- ilmentyminen Johdanto Säätely Tutkimusmenetelmät Luennon runko 1 Johdanto Monisoluisen organismin


Collaborative & Co-Creative Design in the Semogen -projects

Collaborative & Co-Creative Design in the Semogen -projects 1 Collaborative & Co-Creative Design in the Semogen -projects Pekka Ranta Project Manager -research group, Intelligent Information Systems Laboratory 2 Semogen -project Supporting design of a machine system


Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto.

Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto. Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto Nukleiinihapot! kertausta matkan varrella, vähemmän kuitenkin


Other approaches to restrict multipliers

Other approaches to restrict multipliers Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of


Automaatiojärjestelmän hankinnassa huomioitavat tietoturva-asiat

Automaatiojärjestelmän hankinnassa huomioitavat tietoturva-asiat Automaatiojärjestelmän hankinnassa huomioitavat tietoturva-asiat Teollisuusautomaation tietoturvaseminaari Purchasing Manager, Hydro Lead Buyer, Industrial Control Systems 1 Agenda / esityksen tavoite


Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project


Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet


Genetiikan perusteiden harjoitustyöt

Genetiikan perusteiden harjoitustyöt Genetiikan perusteiden harjoitustyöt Molekyylien kloonaus ja siihen liittyvät taidot ja temput, osa 1 Restriktioentsyymit, elektroforeesi Moniste sivulta 24-: Geenien kloonaus CELL 491- Isolating, cloning,


Ihmisten erilaisuuden geneettinen perusta

Ihmisten erilaisuuden geneettinen perusta hmisten erilaisuuden geneettinen perusta etter ortin hmisen genomin tutkimus on astunut uuteen vaiheeseen kun on alettu tutkia ihmisen geneettisen monimuotoisuuden määrää ja laatua. seita tätä tutkimushanketta


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat


T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...


Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland

Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research


Capacity Utilization

Capacity Utilization Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run


Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.

Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1. Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.2017 Life Science Technologies Where Life Sciences meet with Technology


Hankkeen toiminnot työsuunnitelman laatiminen

Hankkeen toiminnot työsuunnitelman laatiminen Hankkeen toiminnot työsuunnitelman laatiminen Hanketyöpaja LLP-ohjelman keskitettyjä hankkeita (Leonardo & Poikittaisohjelma) valmisteleville11.11.2011 Työsuunnitelma Vastaa kysymykseen mitä projektissa


National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007

National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its



PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING Veijalainen O, Kares S, Kujala P, Vuento R, TirKkonen M, Kholová I, Osuala V, Mäenpää J University and University Hospital of Tampere, Finland,


Syövät pirstaloituvat: haaste hoidon kehitykselle

Syövät pirstaloituvat: haaste hoidon kehitykselle Syövät pirstaloituvat: haaste hoidon kehitykselle Kimmo Porkka Professor, head of division hematology Helsinki University Central Hospital Helsinki, Finland Syövän heterogeenisyys: esimerkkinä akuutti


In situ hybridization

In situ hybridization In situ hybridization ISH Detection of DNA or RNA Single or double stranded Chromosomal or cellular nucleic acids ISH Type of a hybrid? DNA-DNA In situ renaturation of target DNA in ISH cannot be prevented


anna minun kertoa let me tell you

anna minun kertoa let me tell you anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta



MEETING PEOPLE COMMUNICATIVE QUESTIONS Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.


Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL

Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL Ville Liljeström, Micha Matusewicz, Kari Pirkkalainen, Jussi-Petteri Suuronen and Ritva Serimaa 13.3.2012


Käytännön kokemuksia osallistumisesta EU projekteihin. 7. puiteohjelman uusien hakujen infopäivät 2011

Käytännön kokemuksia osallistumisesta EU projekteihin. 7. puiteohjelman uusien hakujen infopäivät 2011 Käytännön kokemuksia osallistumisesta EU projekteihin 7. puiteohjelman uusien hakujen infopäivät 2011 15.3.2010 07.09.2011 Markku Timo Ture Nikkilä T&K yritys, 8 henkilöä Elastopoli Oy PK-yritys, omistajina


Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se


Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä

Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Reportterigeenit ja reportterikonstruktiot? Monissa tilanteissa tarvitaan ilmaisinta (proobi, luotain, reportteri) kertomaan, mitä/missä/milloin


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa

Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa Petter Portin Kysymys siitä, ovatko nykyihminen (Homo sapiens) ja neandertalinihminen (Homo neanderthalensis) kaksi eri lajia vai saman


Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus


Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä Matti Pirinen Suomen molekyylilääketieteen instituutti (FIMM) Helsingin Yliopisto 17.2.2015 Tilastollisen päättelyn kurssi Kumpula Sisältö


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


FIMM Technology Services FIMM:n teknologiapalvelut 1

FIMM Technology Services FIMM:n teknologiapalvelut 1 FIMM Technology Services FIMM:n teknologiapalvelut 1 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based


Genomin evoluutio. Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan?

Genomin evoluutio. Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan? Genomin evoluutio Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan? -duplikaatiot: geenien, geenin osien duplikaatiot, segmentaaliset, koko genomin duplikaatiot -duplikoituneiden geenien



HITSAUKSEN TUOTTAVUUSRATKAISUT Kemppi ARC YOU GET WHAT YOU MEASURE OR BE CAREFUL WHAT YOU WISH FOR HITSAUKSEN TUOTTAVUUSRATKAISUT Puolitetaan hitsauskustannukset seminaari 9.4.2008 Mikko Veikkolainen, Ratkaisuliiketoimintapäällikkö


DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =


Geeniekspressio: Mikrosirut. Geneettinen bioinformatiikka

Geeniekspressio: Mikrosirut. Geneettinen bioinformatiikka Geeniekspressio: Mikrosirut Geneettinen bioinformatiikka Microarray Microarray is a compact device containing a very large number of capture molecules (synthetic oligos, PCR products, proteins, antibodies


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti


Siirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools

Siirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools Siirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools Akateemisten asioiden komitea Academic Affairs Committee 11 October 2016 Eija Zitting


x _ Miksi elinikä ei ole rajaton? Mediterranean fruitfly (Ceratitis capitata) Eliniän jakautuma

x _ Miksi elinikä ei ole rajaton? Mediterranean fruitfly (Ceratitis capitata) Eliniän jakautuma Vanhenemisen fysiologia 1 Elinikä ja vanheneminen Käsitteet Elinikä - yksilön elinikä Eliniän odotusarvo, aktuaarinen (kirjanpidollinen) elinikä - keskimääräinen odotettavissa oleva elinikä tietylle lajille,


Results on the new polydrug use questions in the Finnish TDI data

Results on the new polydrug use questions in the Finnish TDI data Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen


Mitä suoli edellä, sitä aivot perässä. Erkki Eerola Turun yliopisto

Mitä suoli edellä, sitä aivot perässä. Erkki Eerola Turun yliopisto Mitä suoli edellä, sitä aivot perässä Erkki Eerola Turun yliopisto N Engl J Med, Vol. 347, No. 12 September 19, 2002 Päämenetelmät bakteerien osoittamiseen näytteistä Bakteeriviljely Bakteereiden komponenttien


Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi

Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi 19.05.2014 DNA:n sekvensointi DNA:n pilkotaan lyhyiksi mallipalasiksi, templaateiksi, joiden emäsjärjestys selvitetään.


Ribosomit 1. Ribosomit 2. Ribosomit 3

Ribosomit 1. Ribosomit 2. Ribosomit 3 Ribosomit 1 Palade & Siekevitz eristivät jaottelusentrifugaatiolla ns. mikrosomeja radioakt. aminohapot kertyivät mikrosomeihin, jotka peräisin rer:ää sisältävistä soluista proteiinisynteesi soluliman


Salasanan vaihto uuteen / How to change password

Salasanan vaihto uuteen / How to change password Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change


Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä


Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan?

Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Antipodidiversiteetin generointi Robert Koch (TB) 1905 Niels K. Jerne


Suopeuden ainekset. Dos. Ilpo Helén Biomedicine in Society (BitS) Department of Social Reseach

Suopeuden ainekset. Dos. Ilpo Helén Biomedicine in Society (BitS) Department of Social Reseach Biomedicine in Society (BitS) Department of Social Reseach Suopeuden ainekset 17.10.2013 1 Suomalaiset ovat suopeita biopankeille Pohjoismainen erityispiirre Mitä suopeus sisältää? Moninaiset yleisöt Laaja



TUTKIJOIDEN KÄYTTÄMÄT DATAREPOSITORIOT TUTKIJOIDEN KÄYTTÄMÄT DATAREPOSITORIOT MILDRED projektin kyselytutkimus Helsingin yliopiston tutkijoille kesällä 2016 Alkuperäinen taustakuva: Roche DG, Lanfear R, Binning SA, Haff TM, Schwanz LE, et al.


Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän


? LUCA (Last universal common ancestor) 3.5 miljardia v.

? LUCA (Last universal common ancestor) 3.5 miljardia v. Mitä elämä on? - Geneettinen ohjelma, joka kykenee muuttamaan ainehiukkaset ja molekyylit järjestyneeksi itseään replikoivaksi kokonaisuudeksi. (= geneettistä antientropiaa) ? LUCA (Last universal common


Biojätteen keruu QuattroSelect - monilokerojärjestelmällä. 21.10.2015 Tiila Korhonen SUEZ

Biojätteen keruu QuattroSelect - monilokerojärjestelmällä. 21.10.2015 Tiila Korhonen SUEZ Biojätteen keruu QuattroSelect - monilokerojärjestelmällä 21.10.2015 Tiila Korhonen SUEZ Agenda 1 SITA Suomi on SUEZ 2 QS, mikä se on? 3 QS maailmalla 4 QS Suomessa 5 QS Vaasassa SITA Suomi Oy ja kaikki


Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen

Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen Who we are FIN-CLARIN University of Helsinki The Language Bank of Finland CSC - The Center for


Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow Genomi Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta Hannu Sariola, Irma Thesleff ja Marja Makarow Malliorganismeiksi kutsutaan lajeja, joita tutkijat käyttävät


Rekisteröiminen - FAQ

Rekisteröiminen - FAQ Rekisteröiminen - FAQ Miten Akun/laturin rekisteröiminen tehdään Akun/laturin rekisteröiminen tapahtuu samalla tavalla kuin nykyinen takuurekisteröityminen koneille. Nykyistä tietokantaa on muokattu niin,


On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs



LUONNOS RT 80260 EN AGREEMENT ON BUILDING WORKS 1 THE PARTIES. May 1998 1 (10) RT 80260 EN May 1998 1 (10) AGREEMENT ON BUILDING WORKS This agreement template is based on the General Terms and Conditions of Building Contracts YSE 1998 RT 16-10660, LVI 03-10277, Ratu 417-7, KH X4-00241.


Bioinformatics in Laboratory of Computer and Information Science

Bioinformatics in Laboratory of Computer and Information Science HELSINKI UNIVERSITY OF TECHNOLOGY LABORATORY OF COMPUTER AND INFORMATION SCIENCE Bioinformatics in Laboratory of Computer and Information Science Samuel Kaski Research Two centers of excellence of the


Helsinki Metropolitan Area Council

Helsinki Metropolitan Area Council Helsinki Metropolitan Area Council Current events at YTV The future of YTV and HKL On the initiative of 4 city mayors the Helsinki region negotiation consortiums coordinating group have presented that:



TESTBED FOR NEXT GENERATION REASEARCH & INNOVATION PUBLIC-PRIVATE PARTNERSHIPS FOR NEW INNOVATIONS ACADEMIC RESEARCH INDUSTRY + PHARMA R&D SPEND Important decisions in drug discovery The Problem: It difficult to develop novel therapies that differentiate


NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS-tutkimukset lääkärin työkaluna 17.11.2016 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Mihin genetiikkaa tarvitaan? taudin patogeneesin ymmärtäminen diagnoosin varmentaminen/vahvistaminen


ELEC-C2210 Molekyylibiologia Proteiinisynteesi, muokkaus ja kohdentuminen

ELEC-C2210 Molekyylibiologia Proteiinisynteesi, muokkaus ja kohdentuminen ELEC-C2210 Molekyylibiologia Proteiinisynteesi, muokkaus ja kohdentuminen Vuento & Heino ss. 44-49; 187-201 Alberts et al., ECB, 4. p., luku 7 Dos. Tuomas Haltia DNA RNA Proteiini Geeni mrna Proteiini


Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä


epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio:

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio: -mesenkyymi-vuorovaikutukset, esimerkkinä hammas ja ihokarva elimiä muodostuu kaikista alkiokerroksista, usein epiteelin ja mesenkyymin vuorovaikutuksesta epiteeli ektodermi kumpi aloittaa elimen kehityksen:


Gap-filling methods for CH 4 data

Gap-filling methods for CH 4 data Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling


Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira

Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa Annikki Welling Kemian laboratoriopalvelut Evira Sisältö Elintarvikepetokset Menetelmiä elintarvikepetosten tunnistamiseksi DNA menetelmät DNA viivakoodaus


Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut Hemopoiesis Tuma Mitochondrion Tuma 2 Flagellum Peroxisome Centrioles Microfilaments Microtubules Nuclear envelope Rough endoplasmic reticulum Ribosomes NUCLEUS muoto: pallomainen liuskoittunut (esim.


FIMM Technology Services FIMM:n teknologiapalvelut 1

FIMM Technology Services FIMM:n teknologiapalvelut 1 FIMM Technology Services FIMM:n teknologiapalvelut 1 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based


Keskeisiä näkökulmia RCE-verkoston rakentamisessa Central viewpoints to consider when constructing RCE

Keskeisiä näkökulmia RCE-verkoston rakentamisessa Central viewpoints to consider when constructing RCE Keskeisiä näkökulmia RCE-verkoston rakentamisessa Central viewpoints to consider when constructing RCE Koordinaattorin valinta ja rooli Selection and role of the coordinator Painopiste: tiede hallinto
