Biopankit miksi ja millä ehdoilla?

Koko: px
Aloita esitys sivulta:

Download "Biopankit miksi ja millä ehdoilla?"

Transkriptio

1 Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine Solu Kudos Elin Yksilö Väestö 1

2 Genetiikan tutkimusote Geeni/ valkuaisaine Solu Kudos Elin Yksilö Väestö Kuinka tautigeenit löytyvät? Ehdokasgeenitutkimukset: geenin tehtävä tunnettu Geenikytkentätutkimus: sopii hyvin varsinaisten periytyvien tautien tutkimukseen, huonosti tavallisten tautien Geenin tunnistus paikkaan perustuen: geenikytkennästä geenin tunnistukseen (vaikeaa, mutta Suomessakin onnistuttu monen geenin löytämisessä) Koko perimän laajuinen merkkiseulonta: uusi vallankumouksellinen menetelmä tavallisten tautien alttiusgeenien etsintään 2

3 Mitä sairausgeenien tutkimiseen tarvitaan? Osaavia tutkijoita eri aloilta: kliinikkoja, epidemiologeja, molekyyligeneetikkoja ja - biologeja, bioinformaatikoita, tilastotieteilijöitä Näytteitä sairaista ja terveistä: nykyään biopankkeja Ajanmukaisia tutkimusmenetelmiä: laitteita ja teknologiaa Astman molekyylimekanismeja Vercelli, Nat Rev Immunol 8:169,

4 Astman alttiusgeenejä Vercelli, Nat Rev Immunol 8:169, 2008 Astman molekyylimekanismeja Vercelli, Nat Rev Immunol 8:169,

5 Koko perimän merkkiseulonta Koko perimän merkkiseulonta 250,000-1,000,000 SNPmerkkiä kynnen kokoisen mikrosirun alalla SNP = Single Nucleotide Polymorphism AATCGATG AATTGATG 5

6 500,000 SNP:tä 2000 potilasta tautia kohti 3000 verrokkia WTCCC, Nature 447:661, 2007 Sydäninfarktin alttiusgeeni Samani et al. New Engl J Med 357:443, 2007 German sample: 875 cases 1644 controls 500,000 SNPs 6

7 Sydäninfarktin alttiusgeeni Geenilöydös ei kelpaa yksilölliseen diagnostiikkaan tai ennusteiden laatimiseen syynä matala riskisuhde (1.2) Samat geenit liitetty aiemmin syövän säätelyyn rooli sydämen toiminnassa aivan tuntematon On tehtävä paljon lisätutkimusta, ennen kuin geenilöydöksen merkitys infarktin synnyssä opitaan ymmärtämään 7

8 GABRIEL-tutkimus: astman alttiusgeenihaun tulokset ORMDL3 Moffatt ym. Nature 448:470, 2007 Astman alttiusgeenejä Vercelli, Nat Rev Immunol 8:169,

9 GABRIEL-tutkimus: astman alttiusgeenihaun tulokset IL cluster, CD14, toist. HLA-DRB1, 30 toist. FCER1B, 20 toist. IL4R, 30 toist. Moffatt ym. Nature 448:470, 2007 Miksi tulokset ovat erilaiset? Tutkimme yhä liian harvassa olevia SNP-merkkejä Tutkimmeko sittenkään samaa sairautta? Useamman geenin yhteisvaikutukset ja geenien ja ympäristön yhteisvaikutukset on yhä huomioimatta tärkeä lähitulevaisuuden tutkimusalue Onko tutkimuksissa vieläkin liian vähän osanottajia? Tarvitsemmeko yhä suurempia aineistoja? 9

10 Mitä seuraavaksi tutkitaan? Yhä parempia mikrosiruja: nykyisissä jo yli 1,000,000 kohdetta Geenien yhteisvaikutusten ja geenien ja ympäristön yhteisvaikutusten tutkimus Myös suurten ja harvinaisten perimän muutosten merkitys paremmin tunnetuksi yksilöllisen perimän luvun avulla Monet uudet tutkimusotteet vaativat yhä suurempia osallistujalukumääriä Perimän yksilöllinen läpiluku Genomiprojektin sekvensointivaihe kesti muutaman vuoden 2000-luvun alussa ihmisen perimän pituus noin 3,000,000,000 emästä Nyt perimän yksilölliseen sekvensointiin pystyviä laitteita Pohjoismaissa jo useita tällä hetkellä muutaman kuukauden rupeama Ensimmäisten yksilöiden perimät paljastivat uusia yllätyksiä 10

11 Malli tautigeenien vaikutuksille Suurella osalla ihmisistä on ainakin joku tavallisen taudin alttiusgeeni. Sen aiheuttama riskin kasvu on kuitenkin pieni. Pienempi joukko ihmisiä omistaa sattumalta useampia alttiugeenejä. Niiden yhteisvaikutuksesta riski on jo suurempi, mutta ei vieläkään läheskään varma. 11

12 Miksi biopankkeja? Yksittäinen näyte on jokseenkin arvoton tavallisten tautien tutkimukselle, mutta tuhannet näytteet yhdessä sisältävät paljon tietoa Yksittäisten geenien vaikutukset tavallisten tautien syntyyn ovat heikkoja, mutta useiden geenien tietyt yhdistelmät voivat olla tärkeitä Geeniyhdistelmien ja geenien ja ympäristön yhteisvaikutuksista voidaan saada tietoa vain suurten tutkimusaineistojen avulla mitä erityisempää yhdistelmää etsitään, sitä vähemmän yksilöitä väestössä on Ymmärrys tärkeistä riskiyhdistelmistä on edellytys uusien, kohdennettujen (ja toivottavasti vähäsivuvaikutuksellisten) hoitomuotojen kehitykselle Millä ehdoilla biopankkeja? DNA-näytteestä tehtävä SNP-profiili on täysin yksilöllinen ja sisältää paljon tietoa sukulaisuudesta ja yksilön alkuperästä Profiilin avulla on mahdollista paikantaa yksilön maantieteellinen alkuperä vertaamalla sitä suuriin määriin muita näytteitä eri puolilta maailmaa SNP-profiili on nykytiedon valossa aika huono sairauksien ennakoimisessa, mutta tiedon lisääntyminen geenien yhteisvaikutuksista voi muuttaa tiedon tarkkuutta nopeasti Nämä seikat edellyttävät suurta huolellisuutta tiedon säilytyksessä ja yksilön omaa kontrollia tiedon saatavuuden suhteen 12

13 Geenitutkimuksen vaiheita 1990-luvulla: harvinaisten, Mendelin sääntöjen mukaan periytyvien tautien geenien paikannus ja tunnistaminen Tavallisten tautien tutkimus ennen vuotta 2007: ehdokasgeenitutkimuksia, liian pieniin aineistoihin perustuneet yritykset geenien löytämiseksi, joitakin menestystarinoita Tavallisten tautien tutkimus vuoden 2007 jälkeen: perimän SNPmerkkiseulonta mikrosirumenetelmin useiden tuhansien osanottajien aineistoissa, satojen uusien alttiusgeenien tunnistus, useat geenit huonosti tunnettuja toiminnalliselta kannalta ja paljon uutta tutkittavaa Yksilöllinen perimän läpiluenta: ensimmäiset yksilölliset DNAsekvenssit julkaistu v. 2007, teknologian yleistyminen, tuhannen yksilön läpiluentahanke, myös harvinaisten rakennemuutosten merkitystä aletaan ymmärtää 13

Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere

Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere Perinnöllisyys harvinaisten lihastautien aiheuttajana Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere 17.11.2011 Mistä lihastauti aiheutuu? Suurin osa on perinnöllisiä Osassa perimä altistaa

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten

Lisätiedot

KEESHONDIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,

Lisätiedot

Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä. Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS

Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä. Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS Taustaa Miksi uudet tutkimustulokset lihastautien perimmäisistä

Lisätiedot

Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Tietoaineistot ja tutkimus. Kommenttipuheenvuoro: Arpo Aromaa

Tietoaineistot ja tutkimus. Kommenttipuheenvuoro: Arpo Aromaa Tietoaineistot ja tutkimus Kommenttipuheenvuoro: Arpo Aromaa Välittömiä kommentteja.. Arpo Aromaa Lääketieteellisen tutkimusetiikan seminaari 2 Tietojen keruu ja käyttö Kannattaako tietoja ihmisten terveydestä

Lisätiedot

Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta

Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Genetiikan tutkijat Englannin Kennel Clubin ja AHT:n kanssa yhteistyössä ovat laatineet seuraavanlaisen artikkelin Episodic Fallingista

Lisätiedot

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä

Lisätiedot

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä Matti Pirinen Suomen molekyylilääketieteen instituutti (FIMM) Helsingin Yliopisto 17.2.2015 Tilastollisen päättelyn kurssi Kumpula Sisältö

Lisätiedot

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

Biopankkilain valmistelun lyhyt historia

Biopankkilain valmistelun lyhyt historia Biopankkilain valmistelun lyhyt historia Puheenjohtaja Kimmo Pitkänen Biotekniikan neuvottelukunta Tutkijoiden ja kansanedustajien seura - TUTKAS Biotekniikan neuvottelukunta BIOPANKKIEN MERKITYS KANSALAISILLE

Lisätiedot

Kliiniset lääketutkimukset yliopistosairaalan näkökulma. Lasse Viinikka 18.3.2014 Etiikan päivä 2014

Kliiniset lääketutkimukset yliopistosairaalan näkökulma. Lasse Viinikka 18.3.2014 Etiikan päivä 2014 Kliiniset lääketutkimukset yliopistosairaalan näkökulma Lasse Viinikka 18.3.2014 Etiikan päivä 2014 Tutkimustyön merkitys potilashoidon kannalta parantaa asiantuntijuutta korkeatasoinen tutkija on alansa

Lisätiedot

BI4 IHMISEN BIOLOGIA

BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava

Lisätiedot

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Diagnostisen laboratoriotoiminnan kustannukset ja vaikuttavuus. Laboratoriopalvelut SOTE-uudistuksen säästötavoitteita toteuttamassa Kari Punnonen

Diagnostisen laboratoriotoiminnan kustannukset ja vaikuttavuus. Laboratoriopalvelut SOTE-uudistuksen säästötavoitteita toteuttamassa Kari Punnonen Diagnostisen laboratoriotoiminnan kustannukset ja vaikuttavuus Laboratoriopalvelut SOTE-uudistuksen säästötavoitteita toteuttamassa Kari Punnonen LABORATORIOPALVELUT 2000-LUVULLA Noin 15 vuoden kuluessa

Lisätiedot

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä

Lisätiedot

Tampereen BIOPANKKI. Selvitys näytteenantajalle suostumuksen antamista varten

Tampereen BIOPANKKI. Selvitys näytteenantajalle suostumuksen antamista varten Tampereen BIOPANKKI Selvitys näytteenantajalle suostumuksen antamista varten Pyydämme sinulta suostumusta näytteiden ja sinua koskevien tietojen keräämiseksi Tampereen Biopankkiin ja käytettäväksi biopankkitutkimukseen.

Lisätiedot

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki

Lisätiedot

Kyky ja halu selviytyä erilaisista elämäntilanteista

Kyky ja halu selviytyä erilaisista elämäntilanteista Terveys Antakaa esimerkkejä a. terveyden eri ulottuvuuksista b. siitä, kuinka eri ulottuvuudet vaikuttavat toisiinsa. c. Minkälaisia kykyjä ja/tai taitoja yksilö tarvitsee terveyden ylläpitoon 1 Terveys

Lisätiedot

Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi

Lisätiedot

Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta

Lisätiedot

Harvinaisten sairauksien tutkimisen eettiset pulmat

Harvinaisten sairauksien tutkimisen eettiset pulmat Harvinaisten sairauksien tutkimisen eettiset pulmat Helena Kääriäinen Tutkimusprofessori, THL Varapj, TUKIJA Harvinaiset sairaudet Ovat nimensä mukaan harvinaisia EU:ssa tauti lasketaan harvinaiseksi,

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Geenitutkimuksista Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; Huhtikuussa 2008 Tätä työtä

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

Selkäydinneste vai geenitutkimus?

Selkäydinneste vai geenitutkimus? Selkäydinneste vai geenitutkimus? 19.5.2016 Anne Remes, professori, ylilääkäri, Itä-Suomen yliopisto, KYS, Neurokeskus Nuorehko muistipotilas, positiivinen sukuhistoria Päästäänkö diagnostiikassa tarkastelemaan

Lisätiedot

Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

SELVITYS SIITÄ MITEN ERÄÄT PERINNÖLLISET SAIRAUDET (KUTEN GPRA JA FUCOSIDOSIS) PERIYTYVÄT ENGLANNINSPRINGERSPANIELEISSA

SELVITYS SIITÄ MITEN ERÄÄT PERINNÖLLISET SAIRAUDET (KUTEN GPRA JA FUCOSIDOSIS) PERIYTYVÄT ENGLANNINSPRINGERSPANIELEISSA SELVITYS SIITÄ MITEN ERÄÄT PERINNÖLLISET SAIRAUDET (KUTEN GPRA JA FUCOSIDOSIS) PERIYTYVÄT ENGLANNINSPRINGERSPANIELEISSA Kaikki koiran perimät geenit sisältyvät 39 erilliseen kromosomipariin. Geenejä arvellaan

Lisätiedot

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012

Lisätiedot

Luonnontieteilijät työnhakijoina

Luonnontieteilijät työnhakijoina Luonnontieteilijät työnhakijoina TEM-info 25.11.2015 Suvi Liikkanen Luonnontieteiden Akateemisten Liitto LAL ry. Webinaarin sisältö Taustaa luonnontieteilijöistä ja Luonnontieteiden Akateemisten Liiton

Lisätiedot

Move! laadun varmistus arvioinnissa. Marjo Rinne, TtT, erikoistutkija UKK instituutti, Tampere

Move! laadun varmistus arvioinnissa. Marjo Rinne, TtT, erikoistutkija UKK instituutti, Tampere Move! laadun varmistus arvioinnissa Marjo Rinne, TtT, erikoistutkija UKK instituutti, Tampere Fyysisen toimintakyvyn mittaaminen Tarkoituksena tuottaa luotettavaa tietoa mm. fyysisestä suorituskyvystä

Lisätiedot

Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede.

Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros Dan Lindholm Genominen lääketiede Genomiprojektit Ihmisgenomi - geenien ja niiden erojen Taudinaiheuttajien genomit - diagnostiikka

Lisätiedot

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS-tutkimukset lääkärin työkaluna 17.11.2016 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Mihin genetiikkaa tarvitaan? taudin patogeneesin ymmärtäminen diagnoosin varmentaminen/vahvistaminen

Lisätiedot

Muistisairauksien varhainen tunnistaminen. Terveydenhoitajapäivät 2012 17.2.2012 Pirkko Telaranta, suunnittelija-kouluttaja

Muistisairauksien varhainen tunnistaminen. Terveydenhoitajapäivät 2012 17.2.2012 Pirkko Telaranta, suunnittelija-kouluttaja Muistisairauksien varhainen tunnistaminen Terveydenhoitajapäivät 2012 17.2.2012 Pirkko Telaranta, suunnittelija-kouluttaja Muistiliiton perustehtävänä on toimia valtakunnallisena muistisairaiden ihmisten

Lisätiedot

Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:

Lisätiedot

VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen

Lisätiedot

Fysiologiset signaalit ylikuormituksen varhaisessa tunnistamisessa. Harri Lindholm erikoislääkäri Työterveyslaitos

Fysiologiset signaalit ylikuormituksen varhaisessa tunnistamisessa. Harri Lindholm erikoislääkäri Työterveyslaitos Fysiologiset signaalit ylikuormituksen varhaisessa tunnistamisessa Harri Lindholm erikoislääkäri Työterveyslaitos Stressin merkitys terveydelle Työelämän fysiologiset stressitekijät Aikapaine Työn vaatimukset

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015 Katekoli-O-metyylitransferaasi ja kipu Oleg Kambur Kipu Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 1 Katekoli-O-metyylitransferaasi (COMT) proteiini tuotetaan

Lisätiedot

KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS Koirilla esiintyy useita erilaisia perinnöllisiä sairauksia samalla tavalla kuin ihmisilläkin. Rotuhistoriasta johtuen perinnöllisten sairauksien yleisyys

Lisätiedot

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 12 X-kromosominen periytyminen TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 FOLKHÄLSANS GENETISKA KLINIK PB 211, (Topeliusgatan 20) 00251 Helsingfors tel (09)

Lisätiedot

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia

Lisätiedot

Psoriaasi (psoriasis vulgaris) on monella tavalla

Psoriaasi (psoriasis vulgaris) on monella tavalla Katsaus Miten psoriaasi syntyy monitekijäisen taudin geenien jäljillä Kati Asumalahti, Ulpu Saarialho-Kere ja Juha Kere Psoriaasin genetiikka ja patogeneesi askarruttavat edelleen tutkijoita, vaikka ensimmäinen

Lisätiedot

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset

Lisätiedot

MaitoManagement 2020. Risteytysopas

MaitoManagement 2020. Risteytysopas Risteytysopas Lypsyrotujen risteytys on lisääntynyt maailmalla. Suomessa perimältään heikkotasoisia lypsylehmiä siemennetään yleisesti liharotuisten sonnien siemenellä, mutta eri lypsyrotujen risteyttäminen

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =

Lisätiedot

TAKAVARIKKO TULLISSA

TAKAVARIKKO TULLISSA TAKAVARIKKO TULLISSA KOHDERYHMÄ: Työ on suunniteltu lukiolaisille. Erityisesti työ soveltuu kurssille KE2. KESTO: n. 30 min. Riippuen näytteiden määrästä ja ryhmän koosta. MOTIVAATIO: Tullin haaviin on

Lisätiedot

LAADULLISEN TUTKIMUKSEN OMINAISLAATU

LAADULLISEN TUTKIMUKSEN OMINAISLAATU LAADULLINEN TUTKIMUS Hanna Vilkka 1 LAADULLISEN TUTKIMUKSEN OMINAISLAATU Hermeneuttinen tieteenihanne: intentionaaliset selitykset, subjektiivisuus, sanallinen/käsitteellinen tarkastelutapa, metodien moneus.

Lisätiedot

KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN

KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN Suomen Ympäristösairauskeskus perustettiin viime vuonna ajantasaisen ympäristösairaustiedon asiantuntijakeskukseksi. Tavoitteena on ajantasaisen,

Lisätiedot

BIOMETRINEN TUNNISTUS MIKA RÖNKKÖ

BIOMETRINEN TUNNISTUS MIKA RÖNKKÖ BIOMETRINEN TUNNISTUS MIKA RÖNKKÖ MITÄ ON BIOMETRINEN TUNNISTUS Tapa ja sen taustalla oleva teknologia, jolla henkilö voidaan tunnistaa käyttämällä yhtä tai useampaa biologista piirrettä. Nykyään osataan

Lisätiedot

Positiivisten asioiden korostaminen. Hilla Levo, dosentti, KNK-erikoislääkäri

Positiivisten asioiden korostaminen. Hilla Levo, dosentti, KNK-erikoislääkäri Positiivisten asioiden korostaminen Hilla Levo, dosentti, KNK-erikoislääkäri Krooninen sairaus - Pitkäaikainen sairaus = muuttunut terveydentila, mikä ei korjaannu yksinkertaisella kirurgisella toimenpiteellä

Lisätiedot

TAPAUS-VERROKKITUTKIMUS

TAPAUS-VERROKKITUTKIMUS TAPAUS-VERROKKI TUTKIMUKSEN TYYPIT JA TULOSTEN ANALYYSI Simo Näyhä Jari Jokelainen Kansanterveystieteen ja yleislääketieteen laitoksen jatkokoulutusmeeting.3.4.2007 TAPAUS-VERROKKITUTKIMUS Idea Tutkimusryhmät

Lisätiedot

Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen

Lisätiedot

Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori

Lisätiedot

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Markus Perola, LT, geneettisen epidemiologian tutkimusprofessori THL, KATO, GETY markus.perola@thl.fi Määritelmiä L3/13.9.2012

Lisätiedot

Genomitieto kliinikon apuna nyt ja tulevaisuudessa

Genomitieto kliinikon apuna nyt ja tulevaisuudessa Genomitieto kliinikon apuna nyt ja tulevaisuudessa Helena Kääriäinen Tutkimusprofessori 19.3.2014 Genomitieto / Helena Kääriäinen 1 Mistä kliinikosta puhumme? Kliinisistä geeneetikoista eli perinnöllisyyslääkäreistä?

Lisätiedot

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan?

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? 2012-2013 Lasse Lensu 2 Ihmisen, eläinten ja kasvien hyvinvoinnin kannalta nykyaikaiset mittaus-,

Lisätiedot

Kreatransporttihäiriö

Kreatransporttihäiriö Tietolehtiset on tarkoitettu yleiskatsauksiksi johonkin tiettyyn oireyhtymään tai sairauteen, ne eivät korvaa perinnöllisyysneuvontaa tai erikoislääkärin konsultaatiota. Kreatransporttihäiriö Erikoislääkäri

Lisätiedot

ikiön seulonta- ja kromosomitutkimukset

ikiön seulonta- ja kromosomitutkimukset POTILASOHJE 1 (8) S ikiön seulonta- ja kromosomitutkimukset POTILASOHJE 2 (8) SISÄLLYSLUETTELO Mitä kehityshäiriöiden seulonta tarkoittaa? 3 Ultraääniseulontatutkimukset 4 Varhainen ultraääniseulonta Toisen

Lisätiedot

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa.

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa. 1 1/2011 Parkinsonin taudin perinnöllisyys Geenien ja ympäristötekijöiden vuorovaikutus sairastumisen taustalla Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

NCL australiankarjakoirilla

NCL australiankarjakoirilla NCL australiankarjakoirilla Yleistä NCL-ryhmään kuuluvat sairaudet ovat kuolemaan johtavia, yleensä resessiivisesti periytyviä sairauksia. Niissä mutaatiosta johtuva geenivirhe aiheuttaa sen, että hermosoluihin

Lisätiedot

PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa. Jyrki Lötjönen, johtava tutkija VTT

PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa. Jyrki Lötjönen, johtava tutkija VTT PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa Jyrki Lötjönen, johtava tutkija VTT 2 Alzheimerin taudin diagnostiikka Alzheimerin tauti on etenevä muistisairaus. Alzheimerin tauti

Lisätiedot

Diabetesepidemia aikamme tsunami. Markku Laakso, akatemiaprofessori Itä-Suomen yliopisto ja Kuopion yliopistollinen sairaala

Diabetesepidemia aikamme tsunami. Markku Laakso, akatemiaprofessori Itä-Suomen yliopisto ja Kuopion yliopistollinen sairaala Diabetesepidemia aikamme tsunami Markku Laakso, akatemiaprofessori Itä-Suomen yliopisto ja Kuopion yliopistollinen sairaala Diabetes on valtava terveysongelma maailmassa 2014 2035 Suomessa on n. 500,000

Lisätiedot

Autoimmuunitaudit: osa 1

Autoimmuunitaudit: osa 1 Autoimmuunitaudit: osa 1 Autoimmuunitaute tunnetaan yli 80. Ne ovat kroonisia sairauksia, joiden syntymekanismia eli patogeneesiä ei useimmissa tapauksissa ymmärretä. Tautien esiintyvyys vaihtelee maanosien,

Lisätiedot

vauriotyypit Figure 5-17.mhc.restriktio 9/24/14 Autoimmuniteetti Kudosvaurion mekanismit Petteri Arstila Haartman-instituutti Patogeeniset mekanismit

vauriotyypit Figure 5-17.mhc.restriktio 9/24/14 Autoimmuniteetti Kudosvaurion mekanismit Petteri Arstila Haartman-instituutti Patogeeniset mekanismit vauriotyypit Kudosvaurion mekanismit Autoimmuniteetti Petteri Arstila Haartman-instituutti Antigeenin tunnistus HLA:ssa pitää sisällään autoimmuniteetin riskin: jokaisella on autoreaktiivisia lymfosyyttejä

Lisätiedot

terveysvalmennus Erja Oksman Päijät-Hämeen sosiaali- ja terveysyhtymä Finnwell -loppuseminaari 29.4.2009

terveysvalmennus Erja Oksman Päijät-Hämeen sosiaali- ja terveysyhtymä Finnwell -loppuseminaari 29.4.2009 TERVA Päijät-Hämeen terveysvalmennus Erja Oksman projektipäällikkö Päijät-Hämeen sosiaali- ja terveysyhtymä Finnwell -loppuseminaari 29.4.2009 Yhteistyöhankeen osapuolet Toteutus ja rahoitus: SITRA, TEKES,

Lisätiedot

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet?

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Harvinaiset-seminaari TYKS 29.9.2011 Jaakko Ignatius TYKS, Perinnöllisyyspoliklinikka Miksi Harvinaiset-seminaarissa puhutaan

Lisätiedot

Mikä progeria on? Progeria tappaa lapsia ympäri maailmaa

Mikä progeria on? Progeria tappaa lapsia ympäri maailmaa COVER Keskitymme parannuskeinoon INSIDE LEFT PANEL Mikä progeria on? Progeria, joka tunnetaan myös Hutchinsonin-Gilfordin syndroomana (HGPS), on harvinainen, kuolemaan johtava "nopean vanhenemisen" sairaus.

Lisätiedot

Psyykkisten rakenteiden kehitys

Psyykkisten rakenteiden kehitys Psyykkisten rakenteiden kehitys Bio-psykososiaalinen näkemys: Ihmisen psyykkinen kasvu ja kehitys riippuu bioloogisista, psykoloogisista ja sosiaalisista tekijöistä Lapsen psyykkisen kehityksen kannalta

Lisätiedot

Ennen verensiirtoa tehtävät tutkimukset miksi veret viipyvät?

Ennen verensiirtoa tehtävät tutkimukset miksi veret viipyvät? Ennen verensiirtoa tehtävät tutkimukset miksi veret viipyvät? 16.3.2016 Anu Korhonen www.veripalvelu.fi Veriryhmät punasolun pintarakenne periytyvä löydetty siihen tarttuvan vasta-aineen perusteella veriryhmäjärjestelmät

Lisätiedot

III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 15. Populaatiogenetiikka ja evoluutio 1. Avainsanat 2. Evoluutio muuttaa geenipoolia 3. Mihin valinta kohdistuu? 4. Yksilön muuntelua

Lisätiedot

Meretojan taudin myöhäisvaiheet

Meretojan taudin myöhäisvaiheet Meretojan taudin myöhäisvaiheet SAMY 22.10.2016 Eeva-Kaisa Schmidt, LK, DI KIITOS MERETOJAN TAUDIN MYÖHÄISVAIHEET Tutkimusryhmämme Dosentti, neurologian el Sari Kiuru-Enari LT, neurologian el Sari Atula

Lisätiedot

Nanoteknologian mahdollisuudet lääkesovelluksissa

Nanoteknologian mahdollisuudet lääkesovelluksissa Nanoteknologian mahdollisuudet lääkesovelluksissa Marjo Yliperttula 1,3 ja Arto Urtti 1,2 1 Farmaseuttisten biotieteiden osasto, Lääketutkimuksen keskus, Farmasian tiedekunta, Helsingin Yliopisto, Helsinki;

Lisätiedot

Vaikutamme terveysalan kasvuun 12.2.2015, Mikko Alkio

Vaikutamme terveysalan kasvuun 12.2.2015, Mikko Alkio Vaikutamme terveysalan kasvuun 12.2.2015, Mikko Alkio Introvertti Seminaarivaiheessa oleva Ongelmakeskeinen Suomi 1 Avautuminen 2 Ikääntyminen on Suomelle ongelma 3 Vaikuttavuus? Lääketutkimus Terveysteknologia

Lisätiedot

Normaalimikrobiston uusi tuleminen

Normaalimikrobiston uusi tuleminen PEOPLE ARE NOT JUST PEOPLE. THEY ARE AN AWFUL LOT MICROBES, TOO (The Economist 2012) Normaalimikrobiston uusi tuleminen FM Eveliina Munukka Projektitutkija 3.10.2014 Lee & Mazmanian, Science 2010 NORMAALIMIKROBISTON

Lisätiedot

Harvinaiset sairaudet Euroopassa

Harvinaiset sairaudet Euroopassa Harvinaiset sairaudet Euroopassa Helena Kääriäinen 5.10.2012 Esityksen nimi / Tekijä 1 Euroopan unionin suositus toimista harvinaisten sairauksien alalla (suositus 2009/C 151/02) kansallinen ohjelma osaamiskeskukset

Lisätiedot

Liikkuva koululainen investointi kansalliseen hyvinvointiin?

Liikkuva koululainen investointi kansalliseen hyvinvointiin? Pekka Puska Pääjohtaja THL Liikkuva koululainen investointi kansalliseen hyvinvointiin? FTS - Tiedotustilaisuus 17.3.2011 THL suojelee ja edistää suomalaisten terveyttä ja hyvinvointia Kansanterveys suomessa

Lisätiedot

Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.

Lisätiedot

Vastasyntyneiden aineenvaihduntaseula. 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka

Vastasyntyneiden aineenvaihduntaseula. 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka Vastasyntyneiden aineenvaihduntaseula 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka Esityksen tavoitteet Ymmärrät mistä tässä on kyse Seulontoja on erilaisia Näyte otetaan vauvasta Ketään ei

Lisätiedot

Kuolioinen suolistotulehdus kalkkunoilla -projektin kuulumisia. Päivikki Perko-Mäkelä Erikoistutkija, ELT Evira, Seinäjoki

Kuolioinen suolistotulehdus kalkkunoilla -projektin kuulumisia. Päivikki Perko-Mäkelä Erikoistutkija, ELT Evira, Seinäjoki Kuolioinen suolistotulehdus kalkkunoilla -projektin kuulumisia Päivikki Perko-Mäkelä Erikoistutkija, ELT Evira, Seinäjoki Tutkimuksen tarkoitus on ymmärtää paremmin kuolioisen suolistotulehduksen syntyä

Lisätiedot

5. Henkilökohtainen diagnostiikka ja hoito

5. Henkilökohtainen diagnostiikka ja hoito 5.2.2013 5. Henkilökohtainen diagnostiikka ja hoito Ohjelman tutkimusaiheet ovat infektiot ja tulehdussairaudet sekä syöpäsairaudet. Näiden tutkimusaiheiden osalta ohjelman tavoite on siirtää terveydenhuollon

Lisätiedot

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen käyttöön liittyviä haasteita Juhani Eskola 310505 7.6.2005 1 Valitut painopistealueet Kansantautien ja terveyden geenitausta Mikrobit ja

Lisätiedot

Multippeliskleroosi geenitutkimus apuna taudin biologisen palapelin kokoamisessa

Multippeliskleroosi geenitutkimus apuna taudin biologisen palapelin kokoamisessa Katsaus Suvi P. Kallio, JannA Saarela ja Leena Peltonen-Palotie Multippeliskleroosi geenitutkimus apuna taudin biologisen palapelin kokoamisessa Multippeliskleroosin tiedetään olevan synnyltään monitekijäinen,

Lisätiedot

Voi hyvin ja elä pidempään 10 vinkkiä

Voi hyvin ja elä pidempään 10 vinkkiä Voi hyvin ja elä pidempään 10 vinkkiä Voi hyvin ja elä pidempään 10 vinkkiä Bertil Marklund Suomennos Pia Salo Helsingissä Kustannusosakeyhtiö Otava Ruotsinkielinen alkuteos 10 Tips Må bättre och lev

Lisätiedot

Pääotsikko tähän. Alaotsikko. Etunimi Sukunimi XX.XX.XXXX

Pääotsikko tähän. Alaotsikko. Etunimi Sukunimi XX.XX.XXXX Pääotsikko tähän Alaotsikko Etunimi Sukunimi XX.XX.XXXX Tietopalvelualan trendit mihin ala on menossa? Janne Järvinen Toimitusjohtaja LM Tietopalvelut LM toimipisteet 2011: Helsinki, Suomi Tukholma, Ruotsi

Lisätiedot

Terveydenhuollon maailma muuttuu - olemmeko valmiit

Terveydenhuollon maailma muuttuu - olemmeko valmiit Terveydenhuollon maailma muuttuu - olemmeko valmiit Päivi Koivuranta-Vaara LKT, hallintoylilääkäri 1 Elinkeinorakenteen muutos Teollinen tuotanto vähenee ja siirtyy muualle Suomessa ei enää valmisteta

Lisätiedot

Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa

Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa 1 Sisältö - Sisäympäristön laatu kouluissa - Tutkimuksen taustaa - Siivouksen arviointiin liittyvien

Lisätiedot

Kenelle täsmähoitoja ja millä hinnalla?

Kenelle täsmähoitoja ja millä hinnalla? Kenelle täsmähoitoja ja millä hinnalla? Heikki Joensuu ylilääkäri, Syöpätautien klinikka, HYKS, ja professori, Lääketieteellinen tiedekunta, Helsingin yliopisto EUROCARE-4 tutkimus Syöpäpotilaiden eloonjääminen

Lisätiedot

Astman ja atopian genetiikka miten ehdokasgeenitutkimuksien tuloksia tulkitaan? Tarja Laitinen, Lauri A. Laitinen ja Juha Kere

Astman ja atopian genetiikka miten ehdokasgeenitutkimuksien tuloksia tulkitaan? Tarja Laitinen, Lauri A. Laitinen ja Juha Kere Genomi Astman ja atopian genetiikka miten ehdokasgeenitutkimuksien tuloksia tulkitaan? Tarja Laitinen, Lauri A. Laitinen ja Juha Kere Astman ja atopian genetiikaa käsittelevien julkaisujen määrä on viimeisten

Lisätiedot

Sylvant (siltuksimabi) RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO

Sylvant (siltuksimabi) RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO EMA/198014/2014 Sylvant (siltuksimabi) RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO Tämä on Sylvant-valmistetta koskevan riskienhallintasuunnitelman yhteenveto, jossa esitetään toimenpiteet, joiden

Lisätiedot