Biopankit miksi ja millä ehdoilla?

Koko: px
Aloita esitys sivulta:

Download "Biopankit miksi ja millä ehdoilla?"


1 Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine Solu Kudos Elin Yksilö Väestö 1

2 Genetiikan tutkimusote Geeni/ valkuaisaine Solu Kudos Elin Yksilö Väestö Kuinka tautigeenit löytyvät? Ehdokasgeenitutkimukset: geenin tehtävä tunnettu Geenikytkentätutkimus: sopii hyvin varsinaisten periytyvien tautien tutkimukseen, huonosti tavallisten tautien Geenin tunnistus paikkaan perustuen: geenikytkennästä geenin tunnistukseen (vaikeaa, mutta Suomessakin onnistuttu monen geenin löytämisessä) Koko perimän laajuinen merkkiseulonta: uusi vallankumouksellinen menetelmä tavallisten tautien alttiusgeenien etsintään 2

3 Mitä sairausgeenien tutkimiseen tarvitaan? Osaavia tutkijoita eri aloilta: kliinikkoja, epidemiologeja, molekyyligeneetikkoja ja - biologeja, bioinformaatikoita, tilastotieteilijöitä Näytteitä sairaista ja terveistä: nykyään biopankkeja Ajanmukaisia tutkimusmenetelmiä: laitteita ja teknologiaa Astman molekyylimekanismeja Vercelli, Nat Rev Immunol 8:169,

4 Astman alttiusgeenejä Vercelli, Nat Rev Immunol 8:169, 2008 Astman molekyylimekanismeja Vercelli, Nat Rev Immunol 8:169,

5 Koko perimän merkkiseulonta Koko perimän merkkiseulonta 250,000-1,000,000 SNPmerkkiä kynnen kokoisen mikrosirun alalla SNP = Single Nucleotide Polymorphism AATCGATG AATTGATG 5

6 500,000 SNP:tä 2000 potilasta tautia kohti 3000 verrokkia WTCCC, Nature 447:661, 2007 Sydäninfarktin alttiusgeeni Samani et al. New Engl J Med 357:443, 2007 German sample: 875 cases 1644 controls 500,000 SNPs 6

7 Sydäninfarktin alttiusgeeni Geenilöydös ei kelpaa yksilölliseen diagnostiikkaan tai ennusteiden laatimiseen syynä matala riskisuhde (1.2) Samat geenit liitetty aiemmin syövän säätelyyn rooli sydämen toiminnassa aivan tuntematon On tehtävä paljon lisätutkimusta, ennen kuin geenilöydöksen merkitys infarktin synnyssä opitaan ymmärtämään 7

8 GABRIEL-tutkimus: astman alttiusgeenihaun tulokset ORMDL3 Moffatt ym. Nature 448:470, 2007 Astman alttiusgeenejä Vercelli, Nat Rev Immunol 8:169,

9 GABRIEL-tutkimus: astman alttiusgeenihaun tulokset IL cluster, CD14, toist. HLA-DRB1, 30 toist. FCER1B, 20 toist. IL4R, 30 toist. Moffatt ym. Nature 448:470, 2007 Miksi tulokset ovat erilaiset? Tutkimme yhä liian harvassa olevia SNP-merkkejä Tutkimmeko sittenkään samaa sairautta? Useamman geenin yhteisvaikutukset ja geenien ja ympäristön yhteisvaikutukset on yhä huomioimatta tärkeä lähitulevaisuuden tutkimusalue Onko tutkimuksissa vieläkin liian vähän osanottajia? Tarvitsemmeko yhä suurempia aineistoja? 9

10 Mitä seuraavaksi tutkitaan? Yhä parempia mikrosiruja: nykyisissä jo yli 1,000,000 kohdetta Geenien yhteisvaikutusten ja geenien ja ympäristön yhteisvaikutusten tutkimus Myös suurten ja harvinaisten perimän muutosten merkitys paremmin tunnetuksi yksilöllisen perimän luvun avulla Monet uudet tutkimusotteet vaativat yhä suurempia osallistujalukumääriä Perimän yksilöllinen läpiluku Genomiprojektin sekvensointivaihe kesti muutaman vuoden 2000-luvun alussa ihmisen perimän pituus noin 3,000,000,000 emästä Nyt perimän yksilölliseen sekvensointiin pystyviä laitteita Pohjoismaissa jo useita tällä hetkellä muutaman kuukauden rupeama Ensimmäisten yksilöiden perimät paljastivat uusia yllätyksiä 10

11 Malli tautigeenien vaikutuksille Suurella osalla ihmisistä on ainakin joku tavallisen taudin alttiusgeeni. Sen aiheuttama riskin kasvu on kuitenkin pieni. Pienempi joukko ihmisiä omistaa sattumalta useampia alttiugeenejä. Niiden yhteisvaikutuksesta riski on jo suurempi, mutta ei vieläkään läheskään varma. 11

12 Miksi biopankkeja? Yksittäinen näyte on jokseenkin arvoton tavallisten tautien tutkimukselle, mutta tuhannet näytteet yhdessä sisältävät paljon tietoa Yksittäisten geenien vaikutukset tavallisten tautien syntyyn ovat heikkoja, mutta useiden geenien tietyt yhdistelmät voivat olla tärkeitä Geeniyhdistelmien ja geenien ja ympäristön yhteisvaikutuksista voidaan saada tietoa vain suurten tutkimusaineistojen avulla mitä erityisempää yhdistelmää etsitään, sitä vähemmän yksilöitä väestössä on Ymmärrys tärkeistä riskiyhdistelmistä on edellytys uusien, kohdennettujen (ja toivottavasti vähäsivuvaikutuksellisten) hoitomuotojen kehitykselle Millä ehdoilla biopankkeja? DNA-näytteestä tehtävä SNP-profiili on täysin yksilöllinen ja sisältää paljon tietoa sukulaisuudesta ja yksilön alkuperästä Profiilin avulla on mahdollista paikantaa yksilön maantieteellinen alkuperä vertaamalla sitä suuriin määriin muita näytteitä eri puolilta maailmaa SNP-profiili on nykytiedon valossa aika huono sairauksien ennakoimisessa, mutta tiedon lisääntyminen geenien yhteisvaikutuksista voi muuttaa tiedon tarkkuutta nopeasti Nämä seikat edellyttävät suurta huolellisuutta tiedon säilytyksessä ja yksilön omaa kontrollia tiedon saatavuuden suhteen 12

13 Geenitutkimuksen vaiheita 1990-luvulla: harvinaisten, Mendelin sääntöjen mukaan periytyvien tautien geenien paikannus ja tunnistaminen Tavallisten tautien tutkimus ennen vuotta 2007: ehdokasgeenitutkimuksia, liian pieniin aineistoihin perustuneet yritykset geenien löytämiseksi, joitakin menestystarinoita Tavallisten tautien tutkimus vuoden 2007 jälkeen: perimän SNPmerkkiseulonta mikrosirumenetelmin useiden tuhansien osanottajien aineistoissa, satojen uusien alttiusgeenien tunnistus, useat geenit huonosti tunnettuja toiminnalliselta kannalta ja paljon uutta tutkittavaa Yksilöllinen perimän läpiluenta: ensimmäiset yksilölliset DNAsekvenssit julkaistu v. 2007, teknologian yleistyminen, tuhannen yksilön läpiluentahanke, myös harvinaisten rakennemuutosten merkitystä aletaan ymmärtää 13

Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere

Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere Perinnöllisyys harvinaisten lihastautien aiheuttajana Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere 17.11.2011 Mistä lihastauti aiheutuu? Suurin osa on perinnöllisiä Osassa perimä altistaa


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se


Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve


Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten


Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet



KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,


Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä. Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS

Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä. Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS Taustaa Miksi uudet tutkimustulokset lihastautien perimmäisistä


Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä


Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti


Tietoaineistot ja tutkimus. Kommenttipuheenvuoro: Arpo Aromaa

Tietoaineistot ja tutkimus. Kommenttipuheenvuoro: Arpo Aromaa Tietoaineistot ja tutkimus Kommenttipuheenvuoro: Arpo Aromaa Välittömiä kommentteja.. Arpo Aromaa Lääketieteellisen tutkimusetiikan seminaari 2 Tietojen keruu ja käyttö Kannattaako tietoja ihmisten terveydestä


Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta

Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Genetiikan tutkijat Englannin Kennel Clubin ja AHT:n kanssa yhteistyössä ovat laatineet seuraavanlaisen artikkelin Episodic Fallingista


Uusia mahdollisuuksia FoundationOne

Uusia mahdollisuuksia FoundationOne Uusia mahdollisuuksia FoundationOne FI/FMI/1703/0019 Maaliskuu 2017 FoundationOne -palvelu FoundationOne on kattava genomianalysointipalvelu, jossa tutkitaan 315 geenistä koko koodaava alue sekä 28 geenistä


Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä Matti Pirinen Suomen molekyylilääketieteen instituutti (FIMM) Helsingin Yliopisto 17.2.2015 Tilastollisen päättelyn kurssi Kumpula Sisältö


Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän


Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta

Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta Ryhmäopetus 22.11.2012 Irma Järvelä Ihmisen kromosomisto: 46 kromosomiparia, joista kaksi sukupuolen määräävää: Naiset 46,


Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin


Biopankkilain valmistelun lyhyt historia

Biopankkilain valmistelun lyhyt historia Biopankkilain valmistelun lyhyt historia Puheenjohtaja Kimmo Pitkänen Biotekniikan neuvottelukunta Tutkijoiden ja kansanedustajien seura - TUTKAS Biotekniikan neuvottelukunta BIOPANKKIEN MERKITYS KANSALAISILLE



BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava


Kliiniset lääketutkimukset yliopistosairaalan näkökulma. Lasse Viinikka 18.3.2014 Etiikan päivä 2014

Kliiniset lääketutkimukset yliopistosairaalan näkökulma. Lasse Viinikka 18.3.2014 Etiikan päivä 2014 Kliiniset lääketutkimukset yliopistosairaalan näkökulma Lasse Viinikka 18.3.2014 Etiikan päivä 2014 Tutkimustyön merkitys potilashoidon kannalta parantaa asiantuntijuutta korkeatasoinen tutkija on alansa


Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016


Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä


Diagnostisen laboratoriotoiminnan kustannukset ja vaikuttavuus. Laboratoriopalvelut SOTE-uudistuksen säästötavoitteita toteuttamassa Kari Punnonen

Diagnostisen laboratoriotoiminnan kustannukset ja vaikuttavuus. Laboratoriopalvelut SOTE-uudistuksen säästötavoitteita toteuttamassa Kari Punnonen Diagnostisen laboratoriotoiminnan kustannukset ja vaikuttavuus Laboratoriopalvelut SOTE-uudistuksen säästötavoitteita toteuttamassa Kari Punnonen LABORATORIOPALVELUT 2000-LUVULLA Noin 15 vuoden kuluessa


Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki


Kyky ja halu selviytyä erilaisista elämäntilanteista

Kyky ja halu selviytyä erilaisista elämäntilanteista Terveys Antakaa esimerkkejä a. terveyden eri ulottuvuuksista b. siitä, kuinka eri ulottuvuudet vaikuttavat toisiinsa. c. Minkälaisia kykyjä ja/tai taitoja yksilö tarvitsee terveyden ylläpitoon 1 Terveys


Tampereen BIOPANKKI. Selvitys näytteenantajalle suostumuksen antamista varten

Tampereen BIOPANKKI. Selvitys näytteenantajalle suostumuksen antamista varten Tampereen BIOPANKKI Selvitys näytteenantajalle suostumuksen antamista varten Pyydämme sinulta suostumusta näytteiden ja sinua koskevien tietojen keräämiseksi Tampereen Biopankkiin ja käytettäväksi biopankkitutkimukseen.


Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi


Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta


Harvinaisten sairauksien tutkimisen eettiset pulmat

Harvinaisten sairauksien tutkimisen eettiset pulmat Harvinaisten sairauksien tutkimisen eettiset pulmat Helena Kääriäinen Tutkimusprofessori, THL Varapj, TUKIJA Harvinaiset sairaudet Ovat nimensä mukaan harvinaisia EU:ssa tauti lasketaan harvinaiseksi,


Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent

Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent 12 Geenitutkimuksista Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; Huhtikuussa 2008 Tätä työtä


Perimän lukemisesta luetun ymmärtämiseen

Perimän lukemisesta luetun ymmärtämiseen Juha Kere ÄYRÄPÄÄN LUENTO 2011 Perimän lukemisesta luetun ymmärtämiseen Lääketieteen tutkimusmenetelmät ovat kehittyneet nopeasti viime vuosikymmeninä, ja yhä kiihtyvä kehitys näyttää jatkuvan vailla merkkiä



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


Selkäydinneste vai geenitutkimus?

Selkäydinneste vai geenitutkimus? Selkäydinneste vai geenitutkimus? 19.5.2016 Anne Remes, professori, ylilääkäri, Itä-Suomen yliopisto, KYS, Neurokeskus Nuorehko muistipotilas, positiivinen sukuhistoria Päästäänkö diagnostiikassa tarkastelemaan


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä





Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012


Luonnontieteilijät työnhakijoina

Luonnontieteilijät työnhakijoina Luonnontieteilijät työnhakijoina TEM-info 25.11.2015 Suvi Liikkanen Luonnontieteiden Akateemisten Liitto LAL ry. Webinaarin sisältö Taustaa luonnontieteilijöistä ja Luonnontieteiden Akateemisten Liiton


Move! laadun varmistus arvioinnissa. Marjo Rinne, TtT, erikoistutkija UKK instituutti, Tampere

Move! laadun varmistus arvioinnissa. Marjo Rinne, TtT, erikoistutkija UKK instituutti, Tampere Move! laadun varmistus arvioinnissa Marjo Rinne, TtT, erikoistutkija UKK instituutti, Tampere Fyysisen toimintakyvyn mittaaminen Tarkoituksena tuottaa luotettavaa tietoa mm. fyysisestä suorituskyvystä


NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS-tutkimukset lääkärin työkaluna 17.11.2016 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Mihin genetiikkaa tarvitaan? taudin patogeneesin ymmärtäminen diagnoosin varmentaminen/vahvistaminen


Dira Eli Interleukiini-1-Reseptorin Salpaajan Puute

Dira Eli Interleukiini-1-Reseptorin Salpaajan Puute Dira Eli Interleukiini-1-Reseptorin Salpaajan Puute Versio 2016 1. MIKÄ ON DIRA? 1.1 Mikä se on? DIRA on lyhenne sanoista "Deficiency of IL-1-Receptor Antagonist"


Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede.

Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros Dan Lindholm Genominen lääketiede Genomiprojektit Ihmisgenomi - geenien ja niiden erojen Taudinaiheuttajien genomit - diagnostiikka



LAADULLISEN TUTKIMUKSEN OMINAISLAATU LAADULLINEN TUTKIMUS Hanna Vilkka 1 LAADULLISEN TUTKIMUKSEN OMINAISLAATU Hermeneuttinen tieteenihanne: intentionaaliset selitykset, subjektiivisuus, sanallinen/käsitteellinen tarkastelutapa, metodien moneus.


Muistisairauksien varhainen tunnistaminen. Terveydenhoitajapäivät 2012 17.2.2012 Pirkko Telaranta, suunnittelija-kouluttaja

Muistisairauksien varhainen tunnistaminen. Terveydenhoitajapäivät 2012 17.2.2012 Pirkko Telaranta, suunnittelija-kouluttaja Muistisairauksien varhainen tunnistaminen Terveydenhoitajapäivät 2012 17.2.2012 Pirkko Telaranta, suunnittelija-kouluttaja Muistiliiton perustehtävänä on toimia valtakunnallisena muistisairaiden ihmisten


Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


Fysiologiset signaalit ylikuormituksen varhaisessa tunnistamisessa. Harri Lindholm erikoislääkäri Työterveyslaitos

Fysiologiset signaalit ylikuormituksen varhaisessa tunnistamisessa. Harri Lindholm erikoislääkäri Työterveyslaitos Fysiologiset signaalit ylikuormituksen varhaisessa tunnistamisessa Harri Lindholm erikoislääkäri Työterveyslaitos Stressin merkitys terveydelle Työelämän fysiologiset stressitekijät Aikapaine Työn vaatimukset


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja


Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015 Katekoli-O-metyylitransferaasi ja kipu Oleg Kambur Kipu Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 1 Katekoli-O-metyylitransferaasi (COMT) proteiini tuotetaan



KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS Koirilla esiintyy useita erilaisia perinnöllisiä sairauksia samalla tavalla kuin ihmisilläkin. Rotuhistoriasta johtuen perinnöllisten sairauksien yleisyys


Miten kivun genetiikka hyödyttää yksilöllistä kivun hoitoa?

Miten kivun genetiikka hyödyttää yksilöllistä kivun hoitoa? Miten kivun genetiikka hyödyttää yksilöllistä kivun hoitoa? Suomen Kivuntutkimusyhdistys ry YKSILÖLLINEN KIVUNHOITO 30.3.2017 Kuopio Vesa Kontinen, dosentti, ylilääkäri Helsingin yliopisto ja Helsingin


Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia


X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 12 X-kromosominen periytyminen TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 FOLKHÄLSANS GENETISKA KLINIK PB 211, (Topeliusgatan 20) 00251 Helsingfors tel (09)


Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Psoriaasi (psoriasis vulgaris) on monella tavalla

Psoriaasi (psoriasis vulgaris) on monella tavalla Katsaus Miten psoriaasi syntyy monitekijäisen taudin geenien jäljillä Kati Asumalahti, Ulpu Saarialho-Kere ja Juha Kere Psoriaasin genetiikka ja patogeneesi askarruttavat edelleen tutkijoita, vaikka ensimmäinen


DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =



KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN Suomen Ympäristösairauskeskus perustettiin viime vuonna ajantasaisen ympäristösairaustiedon asiantuntijakeskukseksi. Tavoitteena on ajantasaisen,


Positiivisten asioiden korostaminen. Hilla Levo, dosentti, KNK-erikoislääkäri

Positiivisten asioiden korostaminen. Hilla Levo, dosentti, KNK-erikoislääkäri Positiivisten asioiden korostaminen Hilla Levo, dosentti, KNK-erikoislääkäri Krooninen sairaus - Pitkäaikainen sairaus = muuttunut terveydentila, mikä ei korjaannu yksinkertaisella kirurgisella toimenpiteellä



TAKAVARIKKO TULLISSA TAKAVARIKKO TULLISSA KOHDERYHMÄ: Työ on suunniteltu lukiolaisille. Erityisesti työ soveltuu kurssille KE2. KESTO: n. 30 min. Riippuen näytteiden määrästä ja ryhmän koosta. MOTIVAATIO: Tullin haaviin on



BIOMETRINEN TUNNISTUS MIKA RÖNKKÖ BIOMETRINEN TUNNISTUS MIKA RÖNKKÖ MITÄ ON BIOMETRINEN TUNNISTUS Tapa ja sen taustalla oleva teknologia, jolla henkilö voidaan tunnistaa käyttämällä yhtä tai useampaa biologista piirrettä. Nykyään osataan


Vastasyntyneiden aineenvaihduntaseula. 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka

Vastasyntyneiden aineenvaihduntaseula. 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka Vastasyntyneiden aineenvaihduntaseula 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka Esityksen tavoitteet Ymmärrät mistä tässä on kyse Seulontoja on erilaisia Näyte otetaan vauvasta Ketään ei



TAPAUS-VERROKKITUTKIMUS TAPAUS-VERROKKI TUTKIMUKSEN TYYPIT JA TULOSTEN ANALYYSI Simo Näyhä Jari Jokelainen Kansanterveystieteen ja yleislääketieteen laitoksen jatkokoulutusmeeting.3.4.2007 TAPAUS-VERROKKITUTKIMUS Idea Tutkimusryhmät


Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Markus Perola, LT, geneettisen epidemiologian tutkimusprofessori THL, KATO, GETY Määritelmiä L3/13.9.2012


Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen


Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Markus Perola, LT, geneettisen epidemiologian tutkimusprofessori THL, KATO, GETY Määritelmiä L3/28.8.2013


Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen käyttöön liittyviä haasteita Juhani Eskola 310505 7.6.2005 1 Valitut painopistealueet Kansantautien ja terveyden geenitausta Mikrobit ja


Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori


Geenitutkimuksen voittokulku on herättänyt

Geenitutkimuksen voittokulku on herättänyt Seulonnat Juha Kere Geenitestauksesta puhutaan paljon, mutta sitä käytetään vähän. Minkälaisia näköaloja geenitestien seulontakäyttöön liittyy? Tämän kirjoituksen näkökulma perustuu laskelmiin ja arvioihin


Genomitieto kliinikon apuna nyt ja tulevaisuudessa

Genomitieto kliinikon apuna nyt ja tulevaisuudessa Genomitieto kliinikon apuna nyt ja tulevaisuudessa Helena Kääriäinen Tutkimusprofessori 19.3.2014 Genomitieto / Helena Kääriäinen 1 Mistä kliinikosta puhumme? Kliinisistä geeneetikoista eli perinnöllisyyslääkäreistä?


Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan?

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? 2012-2013 Lasse Lensu 2 Ihmisen, eläinten ja kasvien hyvinvoinnin kannalta nykyaikaiset mittaus-,



Kreatransporttihäiriö Tietolehtiset on tarkoitettu yleiskatsauksiksi johonkin tiettyyn oireyhtymään tai sairauteen, ne eivät korvaa perinnöllisyysneuvontaa tai erikoislääkärin konsultaatiota. Kreatransporttihäiriö Erikoislääkäri


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


ikiön seulonta- ja kromosomitutkimukset

ikiön seulonta- ja kromosomitutkimukset POTILASOHJE 1 (8) S ikiön seulonta- ja kromosomitutkimukset POTILASOHJE 2 (8) SISÄLLYSLUETTELO Mitä kehityshäiriöiden seulonta tarkoittaa? 3 Ultraääniseulontatutkimukset 4 Varhainen ultraääniseulonta Toisen


Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa.

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa. 1 1/2011 Parkinsonin taudin perinnöllisyys Geenien ja ympäristötekijöiden vuorovaikutus sairastumisen taustalla Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla


NCL australiankarjakoirilla

NCL australiankarjakoirilla NCL australiankarjakoirilla Yleistä NCL-ryhmään kuuluvat sairaudet ovat kuolemaan johtavia, yleensä resessiivisesti periytyviä sairauksia. Niissä mutaatiosta johtuva geenivirhe aiheuttaa sen, että hermosoluihin


MaitoManagement 2020. Risteytysopas

MaitoManagement 2020. Risteytysopas Risteytysopas Lypsyrotujen risteytys on lisääntynyt maailmalla. Suomessa perimältään heikkotasoisia lypsylehmiä siemennetään yleisesti liharotuisten sonnien siemenellä, mutta eri lypsyrotujen risteyttäminen


PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa. Jyrki Lötjönen, johtava tutkija VTT

PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa. Jyrki Lötjönen, johtava tutkija VTT PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa Jyrki Lötjönen, johtava tutkija VTT 2 Alzheimerin taudin diagnostiikka Alzheimerin tauti on etenevä muistisairaus. Alzheimerin tauti


Diabetesepidemia aikamme tsunami. Markku Laakso, akatemiaprofessori Itä-Suomen yliopisto ja Kuopion yliopistollinen sairaala

Diabetesepidemia aikamme tsunami. Markku Laakso, akatemiaprofessori Itä-Suomen yliopisto ja Kuopion yliopistollinen sairaala Diabetesepidemia aikamme tsunami Markku Laakso, akatemiaprofessori Itä-Suomen yliopisto ja Kuopion yliopistollinen sairaala Diabetes on valtava terveysongelma maailmassa 2014 2035 Suomessa on n. 500,000


Autoimmuunitaudit: osa 1

Autoimmuunitaudit: osa 1 Autoimmuunitaudit: osa 1 Autoimmuunitaute tunnetaan yli 80. Ne ovat kroonisia sairauksia, joiden syntymekanismia eli patogeneesiä ei useimmissa tapauksissa ymmärretä. Tautien esiintyvyys vaihtelee maanosien,


vauriotyypit Figure 5-17.mhc.restriktio 9/24/14 Autoimmuniteetti Kudosvaurion mekanismit Petteri Arstila Haartman-instituutti Patogeeniset mekanismit

vauriotyypit Figure 5-17.mhc.restriktio 9/24/14 Autoimmuniteetti Kudosvaurion mekanismit Petteri Arstila Haartman-instituutti Patogeeniset mekanismit vauriotyypit Kudosvaurion mekanismit Autoimmuniteetti Petteri Arstila Haartman-instituutti Antigeenin tunnistus HLA:ssa pitää sisällään autoimmuniteetin riskin: jokaisella on autoreaktiivisia lymfosyyttejä


Auria Biopankin selvitys alaikäisen lapsen huoltajalle suostumuksen antamista varten

Auria Biopankin selvitys alaikäisen lapsen huoltajalle suostumuksen antamista varten Auria Biopankin selvitys alaikäisen lapsen huoltajalle suostumuksen antamista varten Teiltä pyydetään suostumusta lapsenne näytteiden ja henkilötietojen käsittelyyn biopankkitoiminnassa. Suostumusta pyydetään


Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet?

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Harvinaiset-seminaari TYKS 29.9.2011 Jaakko Ignatius TYKS, Perinnöllisyyspoliklinikka Miksi Harvinaiset-seminaarissa puhutaan


terveysvalmennus Erja Oksman Päijät-Hämeen sosiaali- ja terveysyhtymä Finnwell -loppuseminaari 29.4.2009

terveysvalmennus Erja Oksman Päijät-Hämeen sosiaali- ja terveysyhtymä Finnwell -loppuseminaari 29.4.2009 TERVA Päijät-Hämeen terveysvalmennus Erja Oksman projektipäällikkö Päijät-Hämeen sosiaali- ja terveysyhtymä Finnwell -loppuseminaari 29.4.2009 Yhteistyöhankeen osapuolet Toteutus ja rahoitus: SITRA, TEKES,


Mikä progeria on? Progeria tappaa lapsia ympäri maailmaa

Mikä progeria on? Progeria tappaa lapsia ympäri maailmaa COVER Keskitymme parannuskeinoon INSIDE LEFT PANEL Mikä progeria on? Progeria, joka tunnetaan myös Hutchinsonin-Gilfordin syndroomana (HGPS), on harvinainen, kuolemaan johtava "nopean vanhenemisen" sairaus.


Epigene'ikka ja terveysvies'nnän tabut

Epigene'ikka ja terveysvies'nnän tabut Biosynteesi XIV Biokeskus Helsinki 11.5. Epigene'ikka ja terveysvies'nnän tabut Mitä uuga bio'eteet tuovat terveyden tekijöihin? Miksi tutkimus'eto leviää niin hitaas'? Vienna Setälä- Pynnönen VTT, FL


Meretojan taudin myöhäisvaiheet

Meretojan taudin myöhäisvaiheet Meretojan taudin myöhäisvaiheet SAMY 22.10.2016 Eeva-Kaisa Schmidt, LK, DI KIITOS MERETOJAN TAUDIN MYÖHÄISVAIHEET Tutkimusryhmämme Dosentti, neurologian el Sari Kiuru-Enari LT, neurologian el Sari Atula


III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 15. Populaatiogenetiikka ja evoluutio 1. Avainsanat 2. Evoluutio muuttaa geenipoolia 3. Mihin valinta kohdistuu? 4. Yksilön muuntelua


Ennen verensiirtoa tehtävät tutkimukset miksi veret viipyvät?

Ennen verensiirtoa tehtävät tutkimukset miksi veret viipyvät? Ennen verensiirtoa tehtävät tutkimukset miksi veret viipyvät? 16.3.2016 Anu Korhonen Veriryhmät punasolun pintarakenne periytyvä löydetty siihen tarttuvan vasta-aineen perusteella veriryhmäjärjestelmät


Nanoteknologian mahdollisuudet lääkesovelluksissa

Nanoteknologian mahdollisuudet lääkesovelluksissa Nanoteknologian mahdollisuudet lääkesovelluksissa Marjo Yliperttula 1,3 ja Arto Urtti 1,2 1 Farmaseuttisten biotieteiden osasto, Lääketutkimuksen keskus, Farmasian tiedekunta, Helsingin Yliopisto, Helsinki;


Kosteusvauriot ja terveys. Juha Pekkanen, prof Helsingin Yliopisto Terveyden ja Hyvinvoinnin laitos

Kosteusvauriot ja terveys. Juha Pekkanen, prof Helsingin Yliopisto Terveyden ja Hyvinvoinnin laitos Kosteusvauriot ja terveys Juha Pekkanen, prof Helsingin Yliopisto Terveyden ja Hyvinvoinnin laitos Sidonnaisuudet LKT, prof Tutkimus ja kehitysrahoitus sisäilmahankkeisiin Suomen Akatemia, EU, säätiöt,


Normaalimikrobiston uusi tuleminen

Normaalimikrobiston uusi tuleminen PEOPLE ARE NOT JUST PEOPLE. THEY ARE AN AWFUL LOT MICROBES, TOO (The Economist 2012) Normaalimikrobiston uusi tuleminen FM Eveliina Munukka Projektitutkija 3.10.2014 Lee & Mazmanian, Science 2010 NORMAALIMIKROBISTON


Psyykkisten rakenteiden kehitys

Psyykkisten rakenteiden kehitys Psyykkisten rakenteiden kehitys Bio-psykososiaalinen näkemys: Ihmisen psyykkinen kasvu ja kehitys riippuu bioloogisista, psykoloogisista ja sosiaalisista tekijöistä Lapsen psyykkisen kehityksen kannalta


Vaikutamme terveysalan kasvuun 12.2.2015, Mikko Alkio

Vaikutamme terveysalan kasvuun 12.2.2015, Mikko Alkio Vaikutamme terveysalan kasvuun 12.2.2015, Mikko Alkio Introvertti Seminaarivaiheessa oleva Ongelmakeskeinen Suomi 1 Avautuminen 2 Ikääntyminen on Suomelle ongelma 3 Vaikuttavuus? Lääketutkimus Terveysteknologia


Harvinaiset sairaudet Euroopassa

Harvinaiset sairaudet Euroopassa Harvinaiset sairaudet Euroopassa Helena Kääriäinen 5.10.2012 Esityksen nimi / Tekijä 1 Euroopan unionin suositus toimista harvinaisten sairauksien alalla (suositus 2009/C 151/02) kansallinen ohjelma osaamiskeskukset


Liikkuva koululainen investointi kansalliseen hyvinvointiin?

Liikkuva koululainen investointi kansalliseen hyvinvointiin? Pekka Puska Pääjohtaja THL Liikkuva koululainen investointi kansalliseen hyvinvointiin? FTS - Tiedotustilaisuus 17.3.2011 THL suojelee ja edistää suomalaisten terveyttä ja hyvinvointia Kansanterveys suomessa


Kuolioinen suolistotulehdus kalkkunoilla -projektin kuulumisia. Päivikki Perko-Mäkelä Erikoistutkija, ELT Evira, Seinäjoki

Kuolioinen suolistotulehdus kalkkunoilla -projektin kuulumisia. Päivikki Perko-Mäkelä Erikoistutkija, ELT Evira, Seinäjoki Kuolioinen suolistotulehdus kalkkunoilla -projektin kuulumisia Päivikki Perko-Mäkelä Erikoistutkija, ELT Evira, Seinäjoki Tutkimuksen tarkoitus on ymmärtää paremmin kuolioisen suolistotulehduksen syntyä
