Koko: px
Aloita esitys sivulta:



1 RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA Johanna Mattson dosentti ylilääkäri, vs. toimialajohtaja HYKS Syöpäkeskus

2 RINTASYÖPÄ SUOMESSA 5008 uutta tapausta vuonna 2014 Paikallinen rintasyöpä n. 90 %:lla Paikallisesti edennyt n.5 %:lla Levinnyt rintasyöpä n. 5 %:lla 20%:lla tauti uusiutuu myöhemmin

3 Paikallinen ja levinnyt rintasyöpä 1. Leikkaus 2. Lääkehoidot a) solunsalpaajat b) hormonihoito c) HER-2 hoito 3. Sädehoito 4. Seuranta 1.Lääkehoidot a) solunsalpaajat b) hormonihoito c) HER-2 hoito d) uudet lääkehoidot 2. Sädehoito 3. Leikkaus 4. Oireenmukainen hoito

4 Rintasyövän hoidon kehitys Nowadays Clinical Oncology Pathological Oncology Molecular Oncology Personilized Medicine New therapeutic options Disease guided approach Specific treatment for different tumour types Pathological guided approach Targeted agents Molecular approach

5 Rutiinisti ei pidä tilata testejä, jos ei tiedä, mitä tehdä vastauksilla vaan osallistua (kliinisiin) tutkimusprojekteihin tai odottaa kansainvälisiä/kansallisia linjauksia uusien geenitestien sovaltamisesta kliiniseen käyttöön (ESMO 2013) Yksilöityjen lääkehoitojen off-label käyttö kliinisten tutkimusten puitteissa

6 UUDEN POLVEN SEKVENOINTI NGS eli uuden polven sekvenointi - yksittäiset geenit - valitaan geenipaneeli (esim johonkin tiettyyn syöpään tai säätelytiehen liittyviä) - laajempi Cancer-relevant genome content = 0.01% of genome - eksomi = 1% genomista - koko genomi


8 Ts-NGS hotspot syöpägeenipaneeli 1 kiinteiden kasvainten somaattisille muutoksille lähtien Ts-NGSsHS1 (480 e) Kaupallisella hotspot syöpägeenipaneelilla voidaan tutkia 50 geenistä valitut 2855 Cosmic-varianttia Tulokset 2-4 viikon kuluessa näytteen saapumisesta ABL1 EGFR GNAS KRAS PTPN11 AKT1 ERBB2 GNAQ MET RB1 ALK ERBB4 HNF1A MLH1 RET APC EZH2 HRAS MPL SMAD4 ATM FBXW7 IDH1 NOTCH1 SMARCB1 BRAF FGFR1 JAK2 NPM1 SMO CDH1 FGFR2 JAK3 NRAS SRC CDKN2A FGFR3 IDH2 PDGFRA S TK11 CSF1R FLT3 KDR PIK3CA TP53 CTNNB1 GNA11 KIT PTEN VHL

9 Uusi NGS-paneeli rintasyöpäkasvaimille alkaen Ts-NGSsBR1 (640 e) In House -rintasyöpägeenipaneelilla voidaan tutkia seitsemän syöpägeenin (EGFR, HER2, HER3, AKT, PIK3CA, PTEN, TP53) proteenia koodaavat eksonialueet Tulokset 4 viikon kuluessa näytteen saapumisesta Kiireellisestä tutkimuksesta (tulos kahden viikon sisällä) on ilmoitettava etukäteen laboratorioon

10 J 173 geeniä sekvenoitiin

11 J Löytyi 40 driveria

12 J

13 J Löytyi 93 todennäköistä driveria

14 Somaattisten mutaatioiden NGS diagnostiikka osana kliinisiä lääketutkimuksia Osassa kliinisistä lääkeainetutkimuksista edellytetään somaattisten mutaatioiden diagnostiikkaa Syöpäkeskuksen varhaisen vaiheen lääketutkimusyksikkö (Early Phase Unit) aloittaa toimintansa joulukuussa 2016 Tarkoituksena ohjata osa Kliinisen tutkimusyksikön yritysrahoituksesta somaattisten mutaatioiden NGS diagnostiikkaan Menestyksekäs toiminta edellyttää tarvittavien paneelien ripeää pystytystä ja vastausten saamista nopeasti Palveluiden tuottaminen In house vai alihankkijalta?

15 YHTEENVETO Rintasyövän NGS paneelien käyttö ei ole rutiinidiagnostiikkaa Niitä tarvitaan enenevästi kliinisten lääkeainetutkimusten sreeningtutkimuksina Tarvitaan paneelien ketterää kehittämistä Kliinisten tutkimuspotilaiden hoidon kannalta vastausten saaminen nopeasti keskeistä Syöpäkeskus suunnitellut ohjaavansa osan kliinisten lääkeainetutkimusten rahoituksesta NGS paneelien käytön lisääämiseen screening-tutkimuksina huomattavasti!

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS:n haasteet diagnostiikassa 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly


NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS-tutkimukset lääkärin työkaluna 17.11.2016 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Mihin genetiikkaa tarvitaan? taudin patogeneesin ymmärtäminen diagnoosin varmentaminen/vahvistaminen


Keuhkosyövän molekyylipatologia

Keuhkosyövän molekyylipatologia Professori Sakari Knuutila Helsingin yliopisto Keuhkosyövän molekyylipatologia Keuhkosyövän tunnuspiirteenä ovat lukuisat muutokset genomin rakenteessa ja toiminnassa. Sama ilmiö liittyy kaikkiin pitkälle


Uusia mahdollisuuksia FoundationOne

Uusia mahdollisuuksia FoundationOne Uusia mahdollisuuksia FoundationOne FI/FMI/1703/0019 Maaliskuu 2017 FoundationOne -palvelu FoundationOne on kattava genomianalysointipalvelu, jossa tutkitaan 315 geenistä koko koodaava alue sekä 28 geenistä


Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.


Muuttuva diagnostiikka avain yksilöityyn hoitoon

Muuttuva diagnostiikka avain yksilöityyn hoitoon Muuttuva diagnostiikka avain yksilöityyn hoitoon Olli Carpén, Patologian professori, Turun yliopisto ja Patologian palvelualue, TYKS-SAPA liikelaitos ChemBio Finland 2013 EGENTLIGA HOSPITAL FINLANDS DISTRICT


Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto



Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa


Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä

Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä Pirkko-Liisa Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori/ylilääkäri, Tay/Tays 20.11.2012 Sairaalapäivät,



VUODEN TÄRKEÄT SÄDEHOITOTUTKIMUKSET. Jan Seppälä. Sädehoitopäivät 2015 VUODEN TÄRKEÄT SÄDEHOITOTUTKIMUKSET Jan Seppälä Sädehoitopäivät 2015 17/04/2015 1 Viime vuoden tärkeät tapahtumat Adrian Begg (1946 2014), kuului mm. ESTROn säteilybiologiatoimikuntaan, piti kursseja kliinisestä


Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen

Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen eksoneissa 2, 3 ja 4) varmistaminen on tärkeää ennen Erbitux (setuksimabi) -hoidon aloittamista


Keuhkosyövän uudet lääkkeet

Keuhkosyövän uudet lääkkeet Keuhkosyövän uudet lääkkeet Jarkko Ahvonen Syöpätautien erikoislääkäri Tampereen yliopistollinen sairaala Sidonnaisuudet Asiantuntijapalkkio Boehringer Ingelheim, Bristol-Myers Squibb, Lilly, MSD, Roche


Syöpähoitojen kehitys haja- Pirkko Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori, ylilääkäri, TaY/TAYS 19.02.2008

Syöpähoitojen kehitys haja- Pirkko Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori, ylilääkäri, TaY/TAYS 19.02.2008 Syöpähoitojen kehitys haja- ammunnasta täsmäosumiin Pirkko Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori, ylilääkäri, TaY/TAYS 19.02.2008 Haasteet Syöpämäärien lisäys/väestön vanheminen Ennaltaehkäisy/seulonnat


Genomitieto kliinikon apuna nyt ja tulevaisuudessa

Genomitieto kliinikon apuna nyt ja tulevaisuudessa Genomitieto kliinikon apuna nyt ja tulevaisuudessa Helena Kääriäinen Tutkimusprofessori 19.3.2014 Genomitieto / Helena Kääriäinen 1 Mistä kliinikosta puhumme? Kliinisistä geeneetikoista eli perinnöllisyyslääkäreistä?


Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta


Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet

Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet Pia Österlund el, dosentti Kliininen opettaja HY/HYKS syöpätaudit 29 elokuuta 2014 Sidonnaisuudet Palkkioita ja/tai matkakorvauksia: Amgen, Bayer,





Miten ehkäistä suolisyöpää? Jukka- Pekka Mecklin Yleiskirurgian professori K- SKS ja Itä- Suomen yliopisto

Miten ehkäistä suolisyöpää? Jukka- Pekka Mecklin Yleiskirurgian professori K- SKS ja Itä- Suomen yliopisto Miten ehkäistä suolisyöpää? Jukka- Pekka Mecklin Yleiskirurgian professori K- SKS ja Itä- Suomen yliopisto Suolisyövän ehkäisy 1. Suolisyövän yleisyys väestössä 2. Suolisyövän riskiryhmät 3. Suolisyövän


Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5. Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.2016 Iina.Tuominen@tyks.fi Genetiikan tutkimukset sarkoomien diagnostiikassa


Uutta lääkkeistä: Palbosiklibi

Uutta lääkkeistä: Palbosiklibi Page 1 of 5 JULKAISTU NUMEROSSA 1/2017 UUTTA LÄÄKKEISTÄ Uutta lääkkeistä: Palbosiklibi Annikka Kalliokoski / Kirjoitettu 25.1.2017 / Julkaistu Ibrance 75 mg, 100 mg, 125 mg kovat kapselit, Pfizer Limited


Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet


Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien molekyylidiagnostiikkaa 30.8.2013 Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien WHO-luokitus on morfologinen Gradusten I-IV ryhmittelyn perustana on toiminut ennusteen huononeminen


Rintasyövän nykyaikainen hoito ja seuranta

Rintasyövän nykyaikainen hoito ja seuranta Rintasyövän nykyaikainen hoito ja seuranta One fits all vai Räätälöity hoito Rintasyöpä Suomessa Rintasyöpään sairastui 2007 4142 suomalaista naista ja 16 miestä Hoitotulokset ovat kansainvälisestikin


Seminoman hoito ja seuranta. S. Jyrkkiö

Seminoman hoito ja seuranta. S. Jyrkkiö Seminoman hoito ja seuranta S. Jyrkkiö 17.4.2015 Kivessyöpä yleistyy Pohjoismaissa Seminoman ja non-seminoomien yleisyys Pohjoismaissa Kuolleisuus kivessyöpään Pohjoismaissa Kivessyöpä 5 v OSS Kivestuumoreiden


Uutta melanoomasta. Pia Vihinen TYKS/Syöpäklinikka. Tutkimukset kun epäilet melanooman leviämistä

Uutta melanoomasta. Pia Vihinen TYKS/Syöpäklinikka. Tutkimukset kun epäilet melanooman leviämistä Uutta melanoomasta Pia Vihinen TYKS/Syöpäklinikka Tutkimukset kun epäilet melanooman leviämistä Vartalon TT tutkimus tai PET-TT Verikokeet; Hb, maksa-arvot, krea Korkea LDH huonon ennusteen merkki PAD:


Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä


Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän


Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012


Rintasyöpä. 12.2.2014 Messukeskus, Helsinki 2014 JO 4. VUOSI! Järjestäjänä: Mediayhteistyössä: TUNNETKO TULEVAISUUDEN HOITOMUODOT?

Rintasyöpä. 12.2.2014 Messukeskus, Helsinki 2014 JO 4. VUOSI! Järjestäjänä: Mediayhteistyössä: TUNNETKO TULEVAISUUDEN HOITOMUODOT? Rintasyöpä 12.2.2014 Messukeskus, Helsinki 2014 TUNNETKO TULEVAISUUDEN HOITOMUODOT? JO 4. VUOSI! 2014 TEEMAT: Tiedätkö tulevat uudet lääkehoidot? Kuule periytyvän rintasyövän geenitestauksesta ja neuvonnasta


Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:


Mitä uutta eturauhassyövän sädehoidosta? Mauri Kouri HUS Syöpätautien klinikka Onkologiapäivät 31.8.13 Turku

Mitä uutta eturauhassyövän sädehoidosta? Mauri Kouri HUS Syöpätautien klinikka Onkologiapäivät 31.8.13 Turku 1 Mitä uutta eturauhassyövän sädehoidosta? Mauri Kouri HUS Syöpätautien klinikka Onkologiapäivät 31.8.13 Turku 2 ASCO GU 2013 Radikaali prostatektomian jälkeinen sädehoito ARO 92-02 / AUO AP 09/95 10v


Gliooman uusista hoitosuosituksista. Heikki Minn

Gliooman uusista hoitosuosituksista. Heikki Minn Gliooman uusista hoitosuosituksista Heikki Minn Onkologiapäivät, Turku 30.8.2013 Sidonnaisuudet Konsulttina ja/tai kliinisenä tutkijana seuraavissa lääketieteellistä toimintaa harjoittavissa yrityksissä


Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa TYÖSUOJELURAHASTO 21.2..2015 LOPPURAPORTTI: Työterveyslaitoksen osuus Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa



Teijo Kuopio NESTEBIOPSIA 18.11.2016 Teijo Kuopio NESTEBIOPSIA TERMINOLOGIAA Nestebiopsia (liquid biopsy) Nestebiopsia Veren tai muiden kehon nesteiden erilaiset diagnostiset testit, jotka voi rinnastaa kiinteiden kudosten koepaloista


Geenitiedon hyödyntäminen asettaa uusia vaatimuksia terveydenhuollon tietojärjestelmille

Geenitiedon hyödyntäminen asettaa uusia vaatimuksia terveydenhuollon tietojärjestelmille Geenitiedon hyödyntäminen asettaa uusia vaatimuksia terveydenhuollon tietojärjestelmille Arto Orpana, FT, dos. Ylikemisti HUSLAB Genetiikan laboratorio Perimän ja ympäristön välinen merkitys vaihtelee


Mitä onkologi toivoo patologilta?

Mitä onkologi toivoo patologilta? Mitä onkologi toivoo patologilta? Mikä PAD-lausunnossa vaikuttaa kilpirauhassyövän hoitoon Hanna Mäenpää, dos HUS, Syöpätautien klinikka Onkologian trendejä Entiteetit pirstoutuvat pienemmiksi: lisää tietoa


Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa Tietoa työstä Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa LOPPURAPORTTI TYÖSUOJELURAHASTOLLE Sakari Knuutila


Onko ovarioperäistä karsinoomaa olemassakaan? - Ralf Bützow - HUSLAB ja Naistensairaala/HYKS

Onko ovarioperäistä karsinoomaa olemassakaan? - Ralf Bützow - HUSLAB ja Naistensairaala/HYKS Onko ovarioperäistä karsinoomaa olemassakaan? - Ralf Bützow - HUSLAB ja Naistensairaala/HYKS Serous, low grade Serous, high grade Endometrioid Clear cell Mucinous Transitiocellular/ Malignant Brenner OVARIOKARSINOOMAN


Rintasyövän perinnöllisyys

Rintasyövän perinnöllisyys Lääketieteellisen genetiikan kurssi 17.9.2012 Rintasyövän perinnöllisyys Perinnöllinen syöpäalttius - esimerkkinä rintasyöpä Kristiina Aittomäki, dos. ylilääkäri Genetiikan vastuuyksikköryhmä/huslab/hus


HYKS SYÖPÄKESKUS. Tiina Saarto, vs. yl 24.3.2015 1

HYKS SYÖPÄKESKUS. Tiina Saarto, vs. yl 24.3.2015 1 HYKS SYÖPÄKESKUS Tiina Saarto, vs. yl 24.3.2015 1 HYKS SYÖPÄKESUS Suomen suurin syöpäkeskus Syövän lääke- ja sädehoitokeskus kaikki kiinteät kasvaimet hematologiset maligniteetit rintarauhaskirurgia muu


HE4 LABQUALITY DAYS 2015 Helsinki 06.02.2015 Arto Leminen Dosentti, osastonylilääkäri Naistenklinikka

HE4 LABQUALITY DAYS 2015 Helsinki 06.02.2015 Arto Leminen Dosentti, osastonylilääkäri Naistenklinikka HE4 LABQUALITY DAYS 2015 Helsinki 06.02.2015 Arto Leminen Dosentti, osastonylilääkäri Naistenklinikka 1 HE4 Human epididyminis protein 4 Yksiketjuinen, WFDC (whey acidic four-disulfide)- ryhmän glukosyloitunut





Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Molekyylidiagnostiikka keuhkosyövän hoidossa Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Sidonnaisuudet Taloudelliset riippuvuudet: Konsultointi: - Tutkimusrahoitus: - Honorariat:


Tervekudosten huomiointi rinnan sädehoidossa

Tervekudosten huomiointi rinnan sädehoidossa Tervekudosten huomiointi rinnan sädehoidossa Onkologiapäivät 30.8.2013 Sairaalafyysikko Sami Suilamo Tyks, Syöpäklinikka Esityksen sisältöä Tervekudoshaittojen todennäköisyyksiä Tervekudosten annostoleransseja


Keuhkosyövän molekyylipatologinen diagnostiikka edellyttää perustietoja myös kliinikoilta

Keuhkosyövän molekyylipatologinen diagnostiikka edellyttää perustietoja myös kliinikoilta KATSAUS TEEMA Elisa Lappi-Blanco, Kaisa Salmenkivi, Soili Kytölä ja Juha Kononen Keuhkosyövän molekyylipatologinen diagnostiikka edellyttää perustietoja myös kliinikoilta Keuhkosyöpien histologisen luokittelun


Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi Tulehduksen osuus syövän synnyssä Ari Ristimäki, professori Patologia Helsingin yliopisto esiasteissa ja useissa eri syöpäkasvaintyypeissä. 1 A Mantovani, et al. NATURE Vol 454 24 July 2008 Figure 15.22d


Kansallinen syöpäkeskus Comprehensive Cancer Center Finland (FICAN)

Kansallinen syöpäkeskus Comprehensive Cancer Center Finland (FICAN) Kansallinen syöpäkeskus Comprehensive Cancer Center Finland (FICAN) Tuula Helander Kehittämispäällikkö, HYKS Syöpäkeskus Asiamies, Suomen Syöpäinstituutti Erityisasiantuntija, STM, Kansallinen syöpäkeskus


KEUHKOSYÖVÄN SEULONTA. Tiina Palva Dosentti, Syöpätautien ja sädehoidon erikoislääkäri, Väestövastuulääkäri, Kuhmoisten terveysasema

KEUHKOSYÖVÄN SEULONTA. Tiina Palva Dosentti, Syöpätautien ja sädehoidon erikoislääkäri, Väestövastuulääkäri, Kuhmoisten terveysasema KEUHKOSYÖVÄN SEULONTA Tiina Palva Dosentti, Syöpätautien ja sädehoidon erikoislääkäri, Väestövastuulääkäri, Kuhmoisten terveysasema Seulonta on tiettyyn väestöryhmään kohdistuva tutkimus, jolla pyritään



SYÖPÄTAUDIT 2009-2011 SYÖPÄTAUDIT Vastuuhenkilö: Prof. Heikki Joensuu KLL/Syöpätautien osasto, Haartmaninkatu 4, PL 180, 00029 HUS Puh. (09) 471 73208, heikki.joensuu@hus.fi Tavoitteet Syöpätautien erikoislääkärin


GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma

GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma Miika Linna, dos. TkT. Aalto-yliopisto HEMA / Terveyden ja hyvinvoinnin laitos Taustaa Uudet genomitietoon perustuvat hoidon


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


Uutta lääkkeistä: Vemurafenibi

Uutta lääkkeistä: Vemurafenibi Page 1 of 5 JULKAISTU NUMEROSSA 3/2012 UUTTA LÄÄKKEISTÄ Uutta lääkkeistä: Vemurafenibi Kristiina Airola / Julkaistu 28.9.2012. Zelboraf 240 mg kalvopäällysteinen tabletti, Roche Registration Ltd. Zelboraf-valmistetta


Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä


Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö

Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ituepidemia ja VTEC -tutkimukset elintarvikkeista Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ajankohtaista laboratoriorintamalla / 12.10.2011 EHEC-ITUEPIDEMIAN VAIHEITA: Vahva signaali epidemiasta


PÄIVI RUOKONIEMI LT, kliinisen farmakologian ja lääkehoidon erikoislääkäri Ylilääkäri, Fimea

PÄIVI RUOKONIEMI LT, kliinisen farmakologian ja lääkehoidon erikoislääkäri Ylilääkäri, Fimea TIIA TALVITIE FM Tiedottaja, Fimea PÄIVI RUOKONIEMI LT, kliinisen farmakologian ja lääkehoidon erikoislääkäri Ylilääkäri, Fimea Syövän lääkehoitojen kehittäminen vaatii KOKO ALAN DIALOGIA Täsmälääkkeet


Voidaanko geenitiedolla lisätä kansanterveyttä?

Voidaanko geenitiedolla lisätä kansanterveyttä? Voidaanko geenitiedolla lisätä kansanterveyttä? Duodecimin vuosipäivä 14.11.2014 Veikko Salomaa, LKT, tutkimusprofessori 21.11.2014 Esityksen nimi / Tekijä 1 Sidonnaisuudet Ei ole 21.11.2014 Esityksen


Juha Korhonen, DI Erikoistuva fyysikko, HYKS Syöpäkeskus Väitöskirja-projekti: MRI-based radiotherapy

Juha Korhonen, DI Erikoistuva fyysikko, HYKS Syöpäkeskus Väitöskirja-projekti: MRI-based radiotherapy Sädehoitopäivät, 16-17.4.2015, Turku MRI-pohjainen sädehoito Juha Korhonen, DI Erikoistuva fyysikko, HYKS Syöpäkeskus Väitöskirja-projekti: MRI-based radiotherapy Sädehoidon työvaiheet ja kuvien käyttö


Nykypäivän lääkekehitys edellyttää syvällistä. Jokainen potilas tutkimuspotilaaksi

Nykypäivän lääkekehitys edellyttää syvällistä. Jokainen potilas tutkimuspotilaaksi TEEMA KLIININEN LÄÄKETUTKIMUS KATSAUS Olli Carpén ja Tuula Helander Biopankit ja Kansallinen syöpäkeskus yhdenvertaisuuden asialla Jokainen potilas tutkimuspotilaaksi Täsmälääkkeiden kehittämiseen tähtäävä


Uuden sukupolven sekvensointimenetelmät ja diagnostiikka

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Juha-Pekka Pursiheimo Turun Yliopisto Turku Clinical Sequencing Laboratory (TCSL) Labquality Days 2016 11.02. 2016 n. 3,3 miljardia emäsparia kliinisesti








ylilääkäri Teijo Kuopio

ylilääkäri Teijo Kuopio ylilääkäri Teijo Kuopio 28.8.2013 Vasteiden tarkastelu voi tapahtua: Elinten tasolla (makroskooppinen patologia) Kudostasolla (histopatologia) Solutasolla (solupatologia) Molekyylitasolla (molekyylipatologia)


Oppimistavoitteet. Syöpien esiintyvyys, ennuste, hoito ja tutkimus. Syöpien esiintyvyys. Suomen syöpärekisteri. Lisäksi

Oppimistavoitteet. Syöpien esiintyvyys, ennuste, hoito ja tutkimus. Syöpien esiintyvyys. Suomen syöpärekisteri. Lisäksi Oppimistavoitteet Syöpien esiintyvyys, ennuste, hoito ja tutkimus Sirpa Leppä, professori Syöpätautien klinikka Hankkia yleiskäsitys syövän yleisyydestä, yleisimpien syöpien sairastavuudesta ja kuolleisuudesta


Viiveet keuhkosyövän diagnostiikassa ja

Viiveet keuhkosyövän diagnostiikassa ja Viiveet keuhkosyövän diagnostiikassa ja hoidossa Johanna Hietamäki Tutkija, Lääk.yo Esityksen kulku Kehittämishankkeen esittely Toteutettu selvitys Menetelmät, aineisto Tulokset Johtopäätökset ja jatkosuunnitelmat


Keuhkosyövän molekulaarinen patologia. Sakari Knuutila HY, Haartman Instituutti

Keuhkosyövän molekulaarinen patologia. Sakari Knuutila HY, Haartman Instituutti Keuhkosyövän molekulaarinen patologia Sakari Knuutila HY, Haartman Instituutti Tänään Keuhkosyöpä: äärimmäisen komplisoituneen taudin kuvaaminen systeemibiologisella lähestymistavalla auttaa ymmärtämään,





Sarkoomien onkologiset hoidot onko sarkoomatyypillä väliä? Paula Lindholm TYKS, syöpätautien klinikka

Sarkoomien onkologiset hoidot onko sarkoomatyypillä väliä? Paula Lindholm TYKS, syöpätautien klinikka Sarkoomien onkologiset hoidot onko sarkoomatyypillä väliä? Paula Lindholm TYKS, syöpätautien klinikka Pehmytkudos- ja luusarkoomissa eri hoito-ohjelmat pehmytkudossarkoomissa yleensä kirurgia ensin Onkologinen



TESTBED FOR NEXT GENERATION REASEARCH & INNOVATION PUBLIC-PRIVATE PARTNERSHIPS FOR NEW INNOVATIONS ACADEMIC RESEARCH INDUSTRY + PHARMA R&D SPEND Important decisions in drug discovery The Problem: It difficult to develop novel therapies that differentiate


Paikallisen eturauhassyövän uudet hoitotutkimukset

Paikallisen eturauhassyövän uudet hoitotutkimukset Paikallisen eturauhassyövän uudet hoitotutkimukset Vesa Kataja Kliinisen onkologian dosentti Johtajaylilääkäri, KSSHP Valtakunnalliset Onkologiapäivät 29.-30.8.2014, Oulu Paikallinen eturauhassyöpä Diagnostiikka:


Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede.

Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros Dan Lindholm Genominen lääketiede Genomiprojektit Ihmisgenomi - geenien ja niiden erojen Taudinaiheuttajien genomit - diagnostiikka





Focus Oncologiae. Syöpäsäätiön julkaisusarja No 9, 2008. Rintasyöpä

Focus Oncologiae. Syöpäsäätiön julkaisusarja No 9, 2008. Rintasyöpä Focus Oncologiae Syöpäsäätiön julkaisusarja No 9, 2008 Rintasyöpä Syöpäsäätiön XXXV Symposiumi 7. 8.2.2008 Focus Oncologiae -sarjan julkaisut: Rintasyöpä 2008 Munuaisen ja virtsarakon syövät 2007 Sarkoomat


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian



MIESTEN JA ALLE 35-VUOTIAIDEN NAISTEN RINTASYÖPÄ MIESTEN JA ALLE 35-VUOTIAIDEN NAISTEN RINTASYÖPÄ Ari-Pekka Asikainen LK & Minna Tanner Dosentti/ Oyl, TAYS, Syövän hoidon vastuualue Syventävien opintojen kirjallinen työ Tampereen yliopisto Lääketieteen


Rintojen kuvantaminen. Rintasyöpä. Rintakuvantaminen HUSalueella LT, radiologian erikoislääkäri Katja Hukkinen YL / Naistenklinikan Röntgen

Rintojen kuvantaminen. Rintasyöpä. Rintakuvantaminen HUSalueella LT, radiologian erikoislääkäri Katja Hukkinen YL / Naistenklinikan Röntgen Rintojen kuvantaminen LT, radiologian erikoislääkäri Katja Hukkinen YL / Naistenklinikan Röntgen Rintasyöpä Rintasyöpää n. 4700 / v. Suomessa. Naisten yleisin syöpä 1960-luvulta lähtien, määrä lisääntyy


FIT Biotech Oy - Innovatiivisia lääkehoitoja. Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK

FIT Biotech Oy - Innovatiivisia lääkehoitoja. Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK FIT Biotech Oy - Innovatiivisia lääkehoitoja Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK Tärkeää tietoa Tämä esitys saattaa sisältää tulevaisuutta koskevia lausumia, arvioita ja laskelmia Yhtiöstä


Kliiniset lääketutkimukset yliopistosairaalan näkökulma. Lasse Viinikka 18.3.2014 Etiikan päivä 2014

Kliiniset lääketutkimukset yliopistosairaalan näkökulma. Lasse Viinikka 18.3.2014 Etiikan päivä 2014 Kliiniset lääketutkimukset yliopistosairaalan näkökulma Lasse Viinikka 18.3.2014 Etiikan päivä 2014 Tutkimustyön merkitys potilashoidon kannalta parantaa asiantuntijuutta korkeatasoinen tutkija on alansa





Tiede- ja tutkimusstrategia 2020

Tiede- ja tutkimusstrategia 2020 Tiede- ja tutkimusstrategia 2020 Johtajaylilääkäri Turkka Tunturi 26.4.2012 1 VSSHP:n strategia vuosille 2007-2015 Vahva yliopistollinen yhteistyö Vahvistetaan tutkimustoiminnan edellytyksiä Vaikutetaan


Lasten immuunipuutokset. Merja Helminen Lasten infektiolääkäri TaYS lastenklinikka 2004

Lasten immuunipuutokset. Merja Helminen Lasten infektiolääkäri TaYS lastenklinikka 2004 Lasten immuunipuutokset Merja Helminen Lasten infektiolääkäri TaYS lastenklinikka 2004 Mikä on poikkeava infektioherkkyys lapsella? Sairausjaksot ikäryhmittäin päiväkotilapsilla Pönkä ym. 1994 Ikä (v)


Orionilainen lääketutkimus ja -kehitys. 13.5.2014 Mikko Kuoppamäki, neurologian dosentti Lääketieteellisen yksikön päällikkö

Orionilainen lääketutkimus ja -kehitys. 13.5.2014 Mikko Kuoppamäki, neurologian dosentti Lääketieteellisen yksikön päällikkö Orionilainen lääketutkimus ja -kehitys 13.5.2014 Mikko Kuoppamäki, neurologian dosentti Lääketieteellisen yksikön päällikkö Maailman paras T&K vuonna 2017 tavoite vuodesta 2008 Paras rakenne Paras johtajuus


Syövän hoidon parantaminen

Syövän hoidon parantaminen Syövän hoidon parantaminen Cancer Control Joint Action Sakari Karjalainen Helsinki 8.2.2016 Mikä on Cancon? Cancon on syövän hoitoon ja varhaisdiagnostiikkaan keskittyvä EUhanke, jossa Suomen Syöpäyhdistys


Rintasyöpä Suomessa. Mammografiapäivät Tampere 26.6.2009. Risto Sankila. Ylilääkäri, Suomen Syöpärekisteri, Helsinki

Rintasyöpä Suomessa. Mammografiapäivät Tampere 26.6.2009. Risto Sankila. Ylilääkäri, Suomen Syöpärekisteri, Helsinki Rintasyöpä Suomessa Mammografiapäivät Tampere 26.6.2009 Risto Sankila Ylilääkäri, Suomen Syöpärekisteri, Helsinki Suomen Syöpärekisteri Syöpätautien tilastollinen ja epidemiologinen tutkimuslaitos... syöpärekisteri


Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10.

Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10. Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10.2015 Tärkeää tietoa Tämä esitys saattaa sisältää tulevaisuutta



KLIININEN FARMAKOLOGIA JA LÄÄKEHOITO 2009 11 KLIININEN FARMAKOLOGIA JA LÄÄKEHOITO Vastuuhenkilö: Prof. Pertti Neuvonen KLL/Diagnostis-terapeuttinen osasto/kliinisen farmakologian yksikkö, Haartmaninkatu 4, PL 340, 00290 HUS Puh. (09) 471


Levinneen rintasyövän hoito

Levinneen rintasyövän hoito Johanna Mattson ja Riikka Huovinen KATSAUS Levinneen rintasyövän hoito Levinnyt rintasyöpä on edelleen parantumaton sairaus, vaikka sen hoitoon on viime vuosina tullut useita uusia tehokkaita lääkkeitä.


Kosteus- ja homeongelmat Suomessa

Kosteus- ja homeongelmat Suomessa Kosteus- ja homeongelmat Suomessa Eduskunnan Tarkastusvaliokunnan tutkimus 2012 Kari Reijula, LKT, professori Helsingin yliopisto ja Työterveyslaitos 19.6.2017 Kari Reijula Kosteus- ja homeongelmat Suomessa


Hoidetun rintasyöpäpotilaan seuranta

Hoidetun rintasyöpäpotilaan seuranta Hoidetun rintasyöpäpotilaan seuranta Tavoitteet Seurannassa pyritään rintasyövän mahdollisen paikallisen uusiutumisen ja vastakkaisen rinnan uuden syövän varhaiseen toteamiseen. Oireettomalle potilaalle


Ylidiagnostiikkaa: onko kohta enää terveitä? LL Iris Pasternack HYKS Psykiatrian klinikka, tiistailuento 25.2.2014

Ylidiagnostiikkaa: onko kohta enää terveitä? LL Iris Pasternack HYKS Psykiatrian klinikka, tiistailuento 25.2.2014 Ylidiagnostiikkaa: onko kohta enää terveitä? LL Iris Pasternack HYKS Psykiatrian klinikka, tiistailuento 25.2.2014 The New York Times Feb 11 2014 Miller A et al. 25 year follow up for breast cancer incidence


Pienet annokset seminooman sädehoidossa ja seurannassa. Sädehoitopäivät 17.4.2015 Turku Antti Vanhanen

Pienet annokset seminooman sädehoidossa ja seurannassa. Sädehoitopäivät 17.4.2015 Turku Antti Vanhanen Pienet annokset seminooman sädehoidossa ja seurannassa Sädehoitopäivät 17.4.2015 Turku Antti Vanhanen Seminooman adjuvantti sädehoito: muutokset kohdealueessa ja sädeannoksessa Muinoin: Para-aortaali-


RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO. Lynparza-valmisteen (olaparibi) riskienhallintasuunnitelman (RMP) yhteenveto

RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO. Lynparza-valmisteen (olaparibi) riskienhallintasuunnitelman (RMP) yhteenveto EMA/681881/2014 RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO Lynparza-valmisteen (olaparibi) riskienhallintasuunnitelman (RMP) yhteenveto VI.2 Julkisen yhteenvedon osiot Tämä on Lynparza-valmisteen


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


Mitä uutta rintasyövästä

Mitä uutta rintasyövästä Mitä uutta rintasyövästä Onkologiapäivät 2013 31.8.2013 Käsiteltäviä aiheita Neoadjuvanttihoidot NOAH-studyn pitkäaikaistulokset Adjuvanttihoidot Tamoksifeeni 5v. vs. 10 v. HERA-tutkimuksen päivityksiä


Mitä uutta rintasyövästä. Onkologiapäivät

Mitä uutta rintasyövästä. Onkologiapäivät Mitä uutta rintasyövästä Onkologiapäivät 2013 31.8.2013 Käsiteltäviä aiheita Neoadjuvanttihoidot NOAH-studyn pitkäaikaistulokset Adjuvanttihoidot Tamoksifeeni 5v. vs. 10 v. HERA-tutkimuksen päivityksiä


Neuroendokriinisten syöpien lääkehoito

Neuroendokriinisten syöpien lääkehoito Page 1 of 5 JULKAISTU NUMEROSSA 3/2015 TEEMAT Neuroendokriinisten syöpien lääkehoito Maija Tarkkanen / Kirjoitettu 16.6.2015 / Julkaistu 13.11.2015 Neuroendokriinisten (NE) syöpien ilmaantuvuus lisääntyy,


Monogeeniset sairaudet. Monogeeninen periytyminen. Perinnöllisten tautien prevalenssi. Monitekijäiset sairaudet. Dominantti vs.

Monogeeniset sairaudet. Monogeeninen periytyminen. Perinnöllisten tautien prevalenssi. Monitekijäiset sairaudet. Dominantti vs. Monogeeniset sairaudet Monogeeninen Pirkka-Pekka Laurila, LL Lääketieteellisen genetiikan osasto, HY Finnish Institute for Molecular Medicine, FIMM Mutaatio yhdessä geenissä riittävä aiheuttamaan sairauden


Instrumentariumin Tiedesäätiön apurahat 2016

Instrumentariumin Tiedesäätiön apurahat 2016 1 (5) Instrumentariumin Tiedesäätiön apurahat 2016 Instrumentariumin tiedesäätiö jakoi 9. maaliskuuta 2016 apurahoja 35. kerran. Tiedesäätiö jakaa vuosittain apurahoja lääketieteen ja lääketieteen tekniikan


Rintasyöpäpotilaan seuranta terveyskeskuksessa

Rintasyöpäpotilaan seuranta terveyskeskuksessa Katsaus Liisa Sailas syöpätautien ja sädehoidon erikoislääkäri KYS, Syöpäkeskus liisa.sailas@kuh.fi Pirjo Leinonen Terveyskeskuslääkäri Nurmeksen terveysasema Rintasyöpäpotilaan seuranta terveyskeskuksessa
