RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA

Save this PDF as:
 WORD  PNG  TXT  JPG

Koko: px
Aloita esitys sivulta:

Download "RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA"

Transkriptio

1 RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA Johanna Mattson dosentti ylilääkäri, vs. toimialajohtaja HYKS Syöpäkeskus

2 RINTASYÖPÄ SUOMESSA 5008 uutta tapausta vuonna 2014 Paikallinen rintasyöpä n. 90 %:lla Paikallisesti edennyt n.5 %:lla Levinnyt rintasyöpä n. 5 %:lla 20%:lla tauti uusiutuu myöhemmin

3 Paikallinen ja levinnyt rintasyöpä 1. Leikkaus 2. Lääkehoidot a) solunsalpaajat b) hormonihoito c) HER-2 hoito 3. Sädehoito 4. Seuranta 1.Lääkehoidot a) solunsalpaajat b) hormonihoito c) HER-2 hoito d) uudet lääkehoidot 2. Sädehoito 3. Leikkaus 4. Oireenmukainen hoito

4 Rintasyövän hoidon kehitys Nowadays Clinical Oncology Pathological Oncology Molecular Oncology Personilized Medicine New therapeutic options Disease guided approach Specific treatment for different tumour types Pathological guided approach Targeted agents Molecular approach

5 Rutiinisti ei pidä tilata testejä, jos ei tiedä, mitä tehdä vastauksilla vaan osallistua (kliinisiin) tutkimusprojekteihin tai odottaa kansainvälisiä/kansallisia linjauksia uusien geenitestien sovaltamisesta kliiniseen käyttöön (ESMO 2013) Yksilöityjen lääkehoitojen off-label käyttö kliinisten tutkimusten puitteissa

6 UUDEN POLVEN SEKVENOINTI NGS eli uuden polven sekvenointi - yksittäiset geenit - valitaan geenipaneeli (esim johonkin tiettyyn syöpään tai säätelytiehen liittyviä) - laajempi Cancer-relevant genome content = 0.01% of genome - eksomi = 1% genomista - koko genomi

7 GENOMICS DRIVEN ONCOLOGY = SOMAATTISET MUTAATIOT Garraway J Clin Oncol :

8 Ts-NGS hotspot syöpägeenipaneeli 1 kiinteiden kasvainten somaattisille muutoksille lähtien Ts-NGSsHS1 (480 e) Kaupallisella hotspot syöpägeenipaneelilla voidaan tutkia 50 geenistä valitut 2855 Cosmic-varianttia Tulokset 2-4 viikon kuluessa näytteen saapumisesta ABL1 EGFR GNAS KRAS PTPN11 AKT1 ERBB2 GNAQ MET RB1 ALK ERBB4 HNF1A MLH1 RET APC EZH2 HRAS MPL SMAD4 ATM FBXW7 IDH1 NOTCH1 SMARCB1 BRAF FGFR1 JAK2 NPM1 SMO CDH1 FGFR2 JAK3 NRAS SRC CDKN2A FGFR3 IDH2 PDGFRA S TK11 CSF1R FLT3 KDR PIK3CA TP53 CTNNB1 GNA11 KIT PTEN VHL

9 Uusi NGS-paneeli rintasyöpäkasvaimille alkaen Ts-NGSsBR1 (640 e) In House -rintasyöpägeenipaneelilla voidaan tutkia seitsemän syöpägeenin (EGFR, HER2, HER3, AKT, PIK3CA, PTEN, TP53) proteenia koodaavat eksonialueet Tulokset 4 viikon kuluessa näytteen saapumisesta Kiireellisestä tutkimuksesta (tulos kahden viikon sisällä) on ilmoitettava etukäteen laboratorioon

10 J 173 geeniä sekvenoitiin

11 J Löytyi 40 driveria

12 J

13 J Löytyi 93 todennäköistä driveria

14 Somaattisten mutaatioiden NGS diagnostiikka osana kliinisiä lääketutkimuksia Osassa kliinisistä lääkeainetutkimuksista edellytetään somaattisten mutaatioiden diagnostiikkaa Syöpäkeskuksen varhaisen vaiheen lääketutkimusyksikkö (Early Phase Unit) aloittaa toimintansa joulukuussa 2016 Tarkoituksena ohjata osa Kliinisen tutkimusyksikön yritysrahoituksesta somaattisten mutaatioiden NGS diagnostiikkaan Menestyksekäs toiminta edellyttää tarvittavien paneelien ripeää pystytystä ja vastausten saamista nopeasti Palveluiden tuottaminen In house vai alihankkijalta?

15 YHTEENVETO Rintasyövän NGS paneelien käyttö ei ole rutiinidiagnostiikkaa Niitä tarvitaan enenevästi kliinisten lääkeainetutkimusten sreeningtutkimuksina Tarvitaan paneelien ketterää kehittämistä Kliinisten tutkimuspotilaiden hoidon kannalta vastausten saaminen nopeasti keskeistä Syöpäkeskus suunnitellut ohjaavansa osan kliinisten lääkeainetutkimusten rahoituksesta NGS paneelien käytön lisääämiseen screening-tutkimuksina huomattavasti!

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS:n haasteet diagnostiikassa 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly

Lisätiedot

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS-tutkimukset lääkärin työkaluna 17.11.2016 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Mihin genetiikkaa tarvitaan? taudin patogeneesin ymmärtäminen diagnoosin varmentaminen/vahvistaminen

Lisätiedot

Keuhkosyövän molekyylipatologia

Keuhkosyövän molekyylipatologia Professori Sakari Knuutila Helsingin yliopisto Keuhkosyövän molekyylipatologia Keuhkosyövän tunnuspiirteenä ovat lukuisat muutokset genomin rakenteessa ja toiminnassa. Sama ilmiö liittyy kaikkiin pitkälle

Lisätiedot

Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.

Lisätiedot

Uusia mahdollisuuksia FoundationOne

Uusia mahdollisuuksia FoundationOne Uusia mahdollisuuksia FoundationOne FI/FMI/1703/0019 Maaliskuu 2017 FoundationOne -palvelu FoundationOne on kattava genomianalysointipalvelu, jossa tutkitaan 315 geenistä koko koodaava alue sekä 28 geenistä

Lisätiedot

Muuttuva diagnostiikka avain yksilöityyn hoitoon

Muuttuva diagnostiikka avain yksilöityyn hoitoon Muuttuva diagnostiikka avain yksilöityyn hoitoon Olli Carpén, Patologian professori, Turun yliopisto ja Patologian palvelualue, TYKS-SAPA liikelaitos ChemBio Finland 2013 EGENTLIGA HOSPITAL FINLANDS DISTRICT

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA Robert Winqvist SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PROFESSORILIITON SYYSSEMINAARI TUTKIMUSTA KAIKKIEN HYÖDYKSI

Lisätiedot

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa

Lisätiedot

Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä

Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä Pirkko-Liisa Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori/ylilääkäri, Tay/Tays 20.11.2012 Sairaalapäivät,

Lisätiedot

VUODEN TÄRKEÄT SÄDEHOITOTUTKIMUKSET. Jan Seppälä. Sädehoitopäivät 2015

VUODEN TÄRKEÄT SÄDEHOITOTUTKIMUKSET. Jan Seppälä. Sädehoitopäivät 2015 VUODEN TÄRKEÄT SÄDEHOITOTUTKIMUKSET Jan Seppälä Sädehoitopäivät 2015 17/04/2015 1 Viime vuoden tärkeät tapahtumat Adrian Begg (1946 2014), kuului mm. ESTROn säteilybiologiatoimikuntaan, piti kursseja kliinisestä

Lisätiedot

Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen

Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen eksoneissa 2, 3 ja 4) varmistaminen on tärkeää ennen Erbitux (setuksimabi) -hoidon aloittamista

Lisätiedot

Keuhkosyövän uudet lääkkeet

Keuhkosyövän uudet lääkkeet Keuhkosyövän uudet lääkkeet Jarkko Ahvonen Syöpätautien erikoislääkäri Tampereen yliopistollinen sairaala Sidonnaisuudet Asiantuntijapalkkio Boehringer Ingelheim, Bristol-Myers Squibb, Lilly, MSD, Roche

Lisätiedot

Syöpähoitojen kehitys haja- Pirkko Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori, ylilääkäri, TaY/TAYS 19.02.2008

Syöpähoitojen kehitys haja- Pirkko Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori, ylilääkäri, TaY/TAYS 19.02.2008 Syöpähoitojen kehitys haja- ammunnasta täsmäosumiin Pirkko Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori, ylilääkäri, TaY/TAYS 19.02.2008 Haasteet Syöpämäärien lisäys/väestön vanheminen Ennaltaehkäisy/seulonnat

Lisätiedot

LÄÄKETIETEELLINEN OPAS PERINNÖLLINEN ALTTIUS RINTA-, MUNASARJA- JA KOHTUSYÖVÄLLE

LÄÄKETIETEELLINEN OPAS PERINNÖLLINEN ALTTIUS RINTA-, MUNASARJA- JA KOHTUSYÖVÄLLE LÄÄKETIETEELLINEN OPAS PERINNÖLLINEN ALTTIUS RINTA-, MUNASARJA- JA KOHTUSYÖVÄLLE EDUT KATTAVA Paneelin kattamien geenien on tieellisesti osoitettu liittyvän rinta-, kohtu- ja munasarjasyöpiin. Potilaan

Lisätiedot

Genomitieto kliinikon apuna nyt ja tulevaisuudessa

Genomitieto kliinikon apuna nyt ja tulevaisuudessa Genomitieto kliinikon apuna nyt ja tulevaisuudessa Helena Kääriäinen Tutkimusprofessori 19.3.2014 Genomitieto / Helena Kääriäinen 1 Mistä kliinikosta puhumme? Kliinisistä geeneetikoista eli perinnöllisyyslääkäreistä?

Lisätiedot

Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta

Lisätiedot

PERINNÖLLINEN ALTTIUS RINTA-, MUNASARJA- JA KOHTUSYÖVÄLLE

PERINNÖLLINEN ALTTIUS RINTA-, MUNASARJA- JA KOHTUSYÖVÄLLE PERINNÖLLINEN ALTTIUS RINTA, MUNASARJA JA KOHTUSYÖVÄLLE RINTASYÖPÄ Vuosittain diagnosoidaan yli 1,600,000 uutta rintasyöpätapausta maailmanlaajuisesti. Keskimäärin yksi kahdeksasta naisesta saa rintasyöpädiagnoosin

Lisätiedot

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY T043 Liite 1.05 / Appendix 1.05 Sivu / Page 1(5) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY FIMLAB MEDICAL LABORATORIES LTD Tunnus Code Yksikkö tai toimintoala

Lisätiedot

Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet

Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet Pia Österlund el, dosentti Kliininen opettaja HY/HYKS syöpätaudit 29 elokuuta 2014 Sidonnaisuudet Palkkioita ja/tai matkakorvauksia: Amgen, Bayer,

Lisätiedot

Miten ehkäistä suolisyöpää? Jukka- Pekka Mecklin Yleiskirurgian professori K- SKS ja Itä- Suomen yliopisto

Miten ehkäistä suolisyöpää? Jukka- Pekka Mecklin Yleiskirurgian professori K- SKS ja Itä- Suomen yliopisto Miten ehkäistä suolisyöpää? Jukka- Pekka Mecklin Yleiskirurgian professori K- SKS ja Itä- Suomen yliopisto Suolisyövän ehkäisy 1. Suolisyövän yleisyys väestössä 2. Suolisyövän riskiryhmät 3. Suolisyövän

Lisätiedot

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5. Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.2016 Iina.Tuominen@tyks.fi Genetiikan tutkimukset sarkoomien diagnostiikassa

Lisätiedot

Uutta lääkkeistä: Palbosiklibi

Uutta lääkkeistä: Palbosiklibi Page 1 of 5 JULKAISTU NUMEROSSA 1/2017 UUTTA LÄÄKKEISTÄ Uutta lääkkeistä: Palbosiklibi Annikka Kalliokoski / Kirjoitettu 25.1.2017 / Julkaistu Ibrance 75 mg, 100 mg, 125 mg kovat kapselit, Pfizer Limited

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien molekyylidiagnostiikkaa 30.8.2013 Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien WHO-luokitus on morfologinen Gradusten I-IV ryhmittelyn perustana on toiminut ennusteen huononeminen

Lisätiedot

Rintasyövän nykyaikainen hoito ja seuranta

Rintasyövän nykyaikainen hoito ja seuranta Rintasyövän nykyaikainen hoito ja seuranta One fits all vai Räätälöity hoito Rintasyöpä Suomessa Rintasyöpään sairastui 2007 4142 suomalaista naista ja 16 miestä Hoitotulokset ovat kansainvälisestikin

Lisätiedot

Seminoman hoito ja seuranta. S. Jyrkkiö

Seminoman hoito ja seuranta. S. Jyrkkiö Seminoman hoito ja seuranta S. Jyrkkiö 17.4.2015 Kivessyöpä yleistyy Pohjoismaissa Seminoman ja non-seminoomien yleisyys Pohjoismaissa Kuolleisuus kivessyöpään Pohjoismaissa Kivessyöpä 5 v OSS Kivestuumoreiden

Lisätiedot

Uutta melanoomasta. Pia Vihinen TYKS/Syöpäklinikka. Tutkimukset kun epäilet melanooman leviämistä

Uutta melanoomasta. Pia Vihinen TYKS/Syöpäklinikka. Tutkimukset kun epäilet melanooman leviämistä Uutta melanoomasta Pia Vihinen TYKS/Syöpäklinikka Tutkimukset kun epäilet melanooman leviämistä Vartalon TT tutkimus tai PET-TT Verikokeet; Hb, maksa-arvot, krea Korkea LDH huonon ennusteen merkki PAD:

Lisätiedot

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä

Lisätiedot

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän

Lisätiedot

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012

Lisätiedot

Rintasyöpä. 12.2.2014 Messukeskus, Helsinki 2014 JO 4. VUOSI! Järjestäjänä: Mediayhteistyössä: TUNNETKO TULEVAISUUDEN HOITOMUODOT?

Rintasyöpä. 12.2.2014 Messukeskus, Helsinki 2014 JO 4. VUOSI! Järjestäjänä: Mediayhteistyössä: TUNNETKO TULEVAISUUDEN HOITOMUODOT? Rintasyöpä 12.2.2014 Messukeskus, Helsinki 2014 TUNNETKO TULEVAISUUDEN HOITOMUODOT? JO 4. VUOSI! 2014 TEEMAT: Tiedätkö tulevat uudet lääkehoidot? Kuule periytyvän rintasyövän geenitestauksesta ja neuvonnasta

Lisätiedot

Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:

Lisätiedot

Mitä uutta eturauhassyövän sädehoidosta? Mauri Kouri HUS Syöpätautien klinikka Onkologiapäivät 31.8.13 Turku

Mitä uutta eturauhassyövän sädehoidosta? Mauri Kouri HUS Syöpätautien klinikka Onkologiapäivät 31.8.13 Turku 1 Mitä uutta eturauhassyövän sädehoidosta? Mauri Kouri HUS Syöpätautien klinikka Onkologiapäivät 31.8.13 Turku 2 ASCO GU 2013 Radikaali prostatektomian jälkeinen sädehoito ARO 92-02 / AUO AP 09/95 10v

Lisätiedot

Gliooman uusista hoitosuosituksista. Heikki Minn

Gliooman uusista hoitosuosituksista. Heikki Minn Gliooman uusista hoitosuosituksista Heikki Minn Onkologiapäivät, Turku 30.8.2013 Sidonnaisuudet Konsulttina ja/tai kliinisenä tutkijana seuraavissa lääketieteellistä toimintaa harjoittavissa yrityksissä

Lisätiedot

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa TYÖSUOJELURAHASTO 21.2..2015 LOPPURAPORTTI: Työterveyslaitoksen osuus Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa

Lisätiedot

Teijo Kuopio NESTEBIOPSIA

Teijo Kuopio NESTEBIOPSIA 18.11.2016 Teijo Kuopio NESTEBIOPSIA TERMINOLOGIAA Nestebiopsia (liquid biopsy) Nestebiopsia Veren tai muiden kehon nesteiden erilaiset diagnostiset testit, jotka voi rinnastaa kiinteiden kudosten koepaloista

Lisätiedot

Histopatologia ja molekyylipatologia ihomelanooman diagnostiikassa ja hoidon suunnittelussa

Histopatologia ja molekyylipatologia ihomelanooman diagnostiikassa ja hoidon suunnittelussa TEEMA IHOMELANOOMA KATSAUS Susanna Juteau ja Soili Kytölä Histopatologia ja molekyylipatologia ihomelanooman diagnostiikassa ja hoidon suunnittelussa Epäiltäessä ihomelanoomaa tulee ihomuutos poistaa kokonaan

Lisätiedot

Geenitiedon hyödyntäminen asettaa uusia vaatimuksia terveydenhuollon tietojärjestelmille

Geenitiedon hyödyntäminen asettaa uusia vaatimuksia terveydenhuollon tietojärjestelmille Geenitiedon hyödyntäminen asettaa uusia vaatimuksia terveydenhuollon tietojärjestelmille Arto Orpana, FT, dos. Ylikemisti HUSLAB Genetiikan laboratorio Perimän ja ympäristön välinen merkitys vaihtelee

Lisätiedot

Mitä onkologi toivoo patologilta?

Mitä onkologi toivoo patologilta? Mitä onkologi toivoo patologilta? Mikä PAD-lausunnossa vaikuttaa kilpirauhassyövän hoitoon Hanna Mäenpää, dos HUS, Syöpätautien klinikka Onkologian trendejä Entiteetit pirstoutuvat pienemmiksi: lisää tietoa

Lisätiedot

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa Tietoa työstä Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa LOPPURAPORTTI TYÖSUOJELURAHASTOLLE Sakari Knuutila

Lisätiedot

Rintasyövän perinnöllisyys

Rintasyövän perinnöllisyys Lääketieteellisen genetiikan kurssi 17.9.2012 Rintasyövän perinnöllisyys Perinnöllinen syöpäalttius - esimerkkinä rintasyöpä Kristiina Aittomäki, dos. ylilääkäri Genetiikan vastuuyksikköryhmä/huslab/hus

Lisätiedot

Onko ovarioperäistä karsinoomaa olemassakaan? - Ralf Bützow - HUSLAB ja Naistensairaala/HYKS

Onko ovarioperäistä karsinoomaa olemassakaan? - Ralf Bützow - HUSLAB ja Naistensairaala/HYKS Onko ovarioperäistä karsinoomaa olemassakaan? - Ralf Bützow - HUSLAB ja Naistensairaala/HYKS Serous, low grade Serous, high grade Endometrioid Clear cell Mucinous Transitiocellular/ Malignant Brenner OVARIOKARSINOOMAN

Lisätiedot

HYKS SYÖPÄKESKUS. Tiina Saarto, vs. yl 24.3.2015 1

HYKS SYÖPÄKESKUS. Tiina Saarto, vs. yl 24.3.2015 1 HYKS SYÖPÄKESKUS Tiina Saarto, vs. yl 24.3.2015 1 HYKS SYÖPÄKESUS Suomen suurin syöpäkeskus Syövän lääke- ja sädehoitokeskus kaikki kiinteät kasvaimet hematologiset maligniteetit rintarauhaskirurgia muu

Lisätiedot

HE4 LABQUALITY DAYS 2015 Helsinki 06.02.2015 Arto Leminen Dosentti, osastonylilääkäri Naistenklinikka

HE4 LABQUALITY DAYS 2015 Helsinki 06.02.2015 Arto Leminen Dosentti, osastonylilääkäri Naistenklinikka HE4 LABQUALITY DAYS 2015 Helsinki 06.02.2015 Arto Leminen Dosentti, osastonylilääkäri Naistenklinikka 1 HE4 Human epididyminis protein 4 Yksiketjuinen, WFDC (whey acidic four-disulfide)- ryhmän glukosyloitunut

Lisätiedot

POTILAAN OSALLISTAMINEN

POTILAAN OSALLISTAMINEN POTILAAN OSALLISTAMINEN TUTKIMUKSEN EDISTÄMISTÄ JA HOIDON JATKUVAA LAADUN PARANTAMISTA, CASE HYKS SYÖPÄKESKUS Tuula Helander Kehittämispäällikkö, Hyks Syöpäkeskus, HUS Asiamies, Suomen Syöpäinstituutti

Lisätiedot

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Molekyylidiagnostiikka keuhkosyövän hoidossa Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Sidonnaisuudet Taloudelliset riippuvuudet: Konsultointi: - Tutkimusrahoitus: - Honorariat:

Lisätiedot

Tervekudosten huomiointi rinnan sädehoidossa

Tervekudosten huomiointi rinnan sädehoidossa Tervekudosten huomiointi rinnan sädehoidossa Onkologiapäivät 30.8.2013 Sairaalafyysikko Sami Suilamo Tyks, Syöpäklinikka Esityksen sisältöä Tervekudoshaittojen todennäköisyyksiä Tervekudosten annostoleransseja

Lisätiedot

Keuhkosyövän molekyylipatologinen diagnostiikka edellyttää perustietoja myös kliinikoilta

Keuhkosyövän molekyylipatologinen diagnostiikka edellyttää perustietoja myös kliinikoilta KATSAUS TEEMA Elisa Lappi-Blanco, Kaisa Salmenkivi, Soili Kytölä ja Juha Kononen Keuhkosyövän molekyylipatologinen diagnostiikka edellyttää perustietoja myös kliinikoilta Keuhkosyöpien histologisen luokittelun

Lisätiedot

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi Tulehduksen osuus syövän synnyssä Ari Ristimäki, professori Patologia Helsingin yliopisto esiasteissa ja useissa eri syöpäkasvaintyypeissä. 1 A Mantovani, et al. NATURE Vol 454 24 July 2008 Figure 15.22d

Lisätiedot

KEUHKOSYÖVÄN SEULONTA. Tiina Palva Dosentti, Syöpätautien ja sädehoidon erikoislääkäri, Väestövastuulääkäri, Kuhmoisten terveysasema

KEUHKOSYÖVÄN SEULONTA. Tiina Palva Dosentti, Syöpätautien ja sädehoidon erikoislääkäri, Väestövastuulääkäri, Kuhmoisten terveysasema KEUHKOSYÖVÄN SEULONTA Tiina Palva Dosentti, Syöpätautien ja sädehoidon erikoislääkäri, Väestövastuulääkäri, Kuhmoisten terveysasema Seulonta on tiettyyn väestöryhmään kohdistuva tutkimus, jolla pyritään

Lisätiedot

SYÖPÄTAUDIT

SYÖPÄTAUDIT 2009-2011 SYÖPÄTAUDIT Vastuuhenkilö: Prof. Heikki Joensuu KLL/Syöpätautien osasto, Haartmaninkatu 4, PL 180, 00029 HUS Puh. (09) 471 73208, heikki.joensuu@hus.fi Tavoitteet Syöpätautien erikoislääkärin

Lisätiedot

Kansallinen syöpäkeskus Comprehensive Cancer Center Finland (FICAN)

Kansallinen syöpäkeskus Comprehensive Cancer Center Finland (FICAN) Kansallinen syöpäkeskus Comprehensive Cancer Center Finland (FICAN) Tuula Helander Kehittämispäällikkö, HYKS Syöpäkeskus Asiamies, Suomen Syöpäinstituutti Erityisasiantuntija, STM, Kansallinen syöpäkeskus

Lisätiedot

GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma

GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma Miika Linna, dos. TkT. Aalto-yliopisto HEMA / Terveyden ja hyvinvoinnin laitos Taustaa Uudet genomitietoon perustuvat hoidon

Lisätiedot

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja

Lisätiedot

Uutta lääkkeistä: Vemurafenibi

Uutta lääkkeistä: Vemurafenibi Page 1 of 5 JULKAISTU NUMEROSSA 3/2012 UUTTA LÄÄKKEISTÄ Uutta lääkkeistä: Vemurafenibi Kristiina Airola / Julkaistu 28.9.2012. Zelboraf 240 mg kalvopäällysteinen tabletti, Roche Registration Ltd. Zelboraf-valmistetta

Lisätiedot

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä

Lisätiedot

Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö

Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ituepidemia ja VTEC -tutkimukset elintarvikkeista Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ajankohtaista laboratoriorintamalla / 12.10.2011 EHEC-ITUEPIDEMIAN VAIHEITA: Vahva signaali epidemiasta

Lisätiedot

PÄIVI RUOKONIEMI LT, kliinisen farmakologian ja lääkehoidon erikoislääkäri Ylilääkäri, Fimea

PÄIVI RUOKONIEMI LT, kliinisen farmakologian ja lääkehoidon erikoislääkäri Ylilääkäri, Fimea TIIA TALVITIE FM Tiedottaja, Fimea PÄIVI RUOKONIEMI LT, kliinisen farmakologian ja lääkehoidon erikoislääkäri Ylilääkäri, Fimea Syövän lääkehoitojen kehittäminen vaatii KOKO ALAN DIALOGIA Täsmälääkkeet

Lisätiedot

Voidaanko geenitiedolla lisätä kansanterveyttä?

Voidaanko geenitiedolla lisätä kansanterveyttä? Voidaanko geenitiedolla lisätä kansanterveyttä? Duodecimin vuosipäivä 14.11.2014 Veikko Salomaa, LKT, tutkimusprofessori 21.11.2014 Esityksen nimi / Tekijä 1 Sidonnaisuudet Ei ole 21.11.2014 Esityksen

Lisätiedot

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Juha-Pekka Pursiheimo Turun Yliopisto Turku Clinical Sequencing Laboratory (TCSL) Labquality Days 2016 11.02. 2016 n. 3,3 miljardia emäsparia kliinisesti

Lisätiedot

Juha Korhonen, DI Erikoistuva fyysikko, HYKS Syöpäkeskus Väitöskirja-projekti: MRI-based radiotherapy

Juha Korhonen, DI Erikoistuva fyysikko, HYKS Syöpäkeskus Väitöskirja-projekti: MRI-based radiotherapy Sädehoitopäivät, 16-17.4.2015, Turku MRI-pohjainen sädehoito Juha Korhonen, DI Erikoistuva fyysikko, HYKS Syöpäkeskus Väitöskirja-projekti: MRI-based radiotherapy Sädehoidon työvaiheet ja kuvien käyttö

Lisätiedot

Nykypäivän lääkekehitys edellyttää syvällistä. Jokainen potilas tutkimuspotilaaksi

Nykypäivän lääkekehitys edellyttää syvällistä. Jokainen potilas tutkimuspotilaaksi TEEMA KLIININEN LÄÄKETUTKIMUS KATSAUS Olli Carpén ja Tuula Helander Biopankit ja Kansallinen syöpäkeskus yhdenvertaisuuden asialla Jokainen potilas tutkimuspotilaaksi Täsmälääkkeiden kehittämiseen tähtäävä

Lisätiedot

Syöpäpotilaan täsmähoito on moniammatillista yhteistyötä

Syöpäpotilaan täsmähoito on moniammatillista yhteistyötä Ari Ristimäki, Soili Kytölä, Caj Haglund ja Petri Bono PATOLOGIA-TEEMA, KATSAUS Syöpäpotilaan täsmähoito on moniammatillista yhteistyötä Syöpätautien hoitoarsenaaliin kuuluu useita eri vaikutusmekanismeja

Lisätiedot

MUNASARJAN EI- EPITELIAALISTEN MALIGNIEN KASVAINTEN KIRURGINEN HOITO

MUNASARJAN EI- EPITELIAALISTEN MALIGNIEN KASVAINTEN KIRURGINEN HOITO MUNASARJAN EI- EPITELIAALISTEN MALIGNIEN KASVAINTEN KIRURGINEN HOITO Dosentti Johanna Mäenpää Naistenklinikka TAYS JM 05 KÄSITELTÄVÄT KASVAIMET Itusolukasvaimet Stroomaperäiset kasvaimet Kasvaimet epäspesifisestä

Lisätiedot

MONIAMMATILLINEN LÄHESTYMINEN RINTASYÖVÄN HOITOON RINTASYÖPÄ 15 MEDIAYHTEISTYÖSSÄ:

MONIAMMATILLINEN LÄHESTYMINEN RINTASYÖVÄN HOITOON RINTASYÖPÄ 15 MEDIAYHTEISTYÖSSÄ: MONIAMMATILLINEN LÄHESTYMINEN RINTASYÖVÄN HOITOON RINTASYÖPÄ 15 27.-28.1.2015 finlandia-talo, helsinki KUULE UUSIN TIETO NAISTEN YLEISIMMÄN SYÖVÄN KUKISTAMISEEN! TEEMAT 2015: hormoni- ja täsmälääkkeet

Lisätiedot

ylilääkäri Teijo Kuopio

ylilääkäri Teijo Kuopio ylilääkäri Teijo Kuopio 28.8.2013 Vasteiden tarkastelu voi tapahtua: Elinten tasolla (makroskooppinen patologia) Kudostasolla (histopatologia) Solutasolla (solupatologia) Molekyylitasolla (molekyylipatologia)

Lisätiedot

Clostridium difficile diagnostiikan nykyvaihe ja pulmat. Janne Aittoniemi, LT, dos, oyl Fimlab Laboratoriot Oy

Clostridium difficile diagnostiikan nykyvaihe ja pulmat. Janne Aittoniemi, LT, dos, oyl Fimlab Laboratoriot Oy Clostridium difficile diagnostiikan nykyvaihe ja pulmat Janne Aittoniemi, LT, dos, oyl Fimlab Laboratoriot Oy 1.10.2013 Cd-laboratoriodiagnostiikan pulmat - Kuinka Cd-infektio pitäisi diagnostisoida laboratoriossa?

Lisätiedot

Oppimistavoitteet. Syöpien esiintyvyys, ennuste, hoito ja tutkimus. Syöpien esiintyvyys. Suomen syöpärekisteri. Lisäksi

Oppimistavoitteet. Syöpien esiintyvyys, ennuste, hoito ja tutkimus. Syöpien esiintyvyys. Suomen syöpärekisteri. Lisäksi Oppimistavoitteet Syöpien esiintyvyys, ennuste, hoito ja tutkimus Sirpa Leppä, professori Syöpätautien klinikka Hankkia yleiskäsitys syövän yleisyydestä, yleisimpien syöpien sairastavuudesta ja kuolleisuudesta

Lisätiedot

Viiveet keuhkosyövän diagnostiikassa ja

Viiveet keuhkosyövän diagnostiikassa ja Viiveet keuhkosyövän diagnostiikassa ja hoidossa Johanna Hietamäki Tutkija, Lääk.yo Esityksen kulku Kehittämishankkeen esittely Toteutettu selvitys Menetelmät, aineisto Tulokset Johtopäätökset ja jatkosuunnitelmat

Lisätiedot

Sarkoomien onkologiset hoidot onko sarkoomatyypillä väliä? Paula Lindholm TYKS, syöpätautien klinikka

Sarkoomien onkologiset hoidot onko sarkoomatyypillä väliä? Paula Lindholm TYKS, syöpätautien klinikka Sarkoomien onkologiset hoidot onko sarkoomatyypillä väliä? Paula Lindholm TYKS, syöpätautien klinikka Pehmytkudos- ja luusarkoomissa eri hoito-ohjelmat pehmytkudossarkoomissa yleensä kirurgia ensin Onkologinen

Lisätiedot

Keuhkosyövän molekulaarinen patologia. Sakari Knuutila HY, Haartman Instituutti

Keuhkosyövän molekulaarinen patologia. Sakari Knuutila HY, Haartman Instituutti Keuhkosyövän molekulaarinen patologia Sakari Knuutila HY, Haartman Instituutti Tänään Keuhkosyöpä: äärimmäisen komplisoituneen taudin kuvaaminen systeemibiologisella lähestymistavalla auttaa ymmärtämään,

Lisätiedot

OSALLISTUMINEN EU:N TERVEYSOHJELMAN JOINT ACTIONEIHIN JA KANSALLISEN SYÖPÄKESKUKSEN RAKENTAMINEN

OSALLISTUMINEN EU:N TERVEYSOHJELMAN JOINT ACTIONEIHIN JA KANSALLISEN SYÖPÄKESKUKSEN RAKENTAMINEN OSALLISTUMINEN EU:N TERVEYSOHJELMAN JOINT ACTIONEIHIN JA KANSALLISEN SYÖPÄKESKUKSEN RAKENTAMINEN Tuula Helander HYKS Syöpäkeskus Mitä EU-hanke Cancon merkitsee Suomelle? Tarve syövän kansalliselle osaamiskeskukselle

Lisätiedot

TESTBED FOR NEXT GENERATION REASEARCH & INNOVATION

TESTBED FOR NEXT GENERATION REASEARCH & INNOVATION PUBLIC-PRIVATE PARTNERSHIPS FOR NEW INNOVATIONS ACADEMIC RESEARCH INDUSTRY + PHARMA R&D SPEND Important decisions in drug discovery The Problem: It difficult to develop novel therapies that differentiate

Lisätiedot

Kohti potilaskeskeistä hoitoa digitaalisten palveluiden avulla

Kohti potilaskeskeistä hoitoa digitaalisten palveluiden avulla Kohti potilaskeskeistä hoitoa digitaalisten palveluiden avulla Sosiaali- ja terveyspalvelut suurten murrosten kynnyksellä ja valtavien mahdollisuuksien äärellä 16.11.2017 Henri Virtanen Head of Product

Lisätiedot

Paikallisen eturauhassyövän uudet hoitotutkimukset

Paikallisen eturauhassyövän uudet hoitotutkimukset Paikallisen eturauhassyövän uudet hoitotutkimukset Vesa Kataja Kliinisen onkologian dosentti Johtajaylilääkäri, KSSHP Valtakunnalliset Onkologiapäivät 29.-30.8.2014, Oulu Paikallinen eturauhassyöpä Diagnostiikka:

Lisätiedot

Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede.

Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros Dan Lindholm Genominen lääketiede Genomiprojektit Ihmisgenomi - geenien ja niiden erojen Taudinaiheuttajien genomit - diagnostiikka

Lisätiedot

POTILAAN OSALLISTAMINEN

POTILAAN OSALLISTAMINEN POTILAAN OSALLISTAMINEN TUTKIMUKSEN EDISTÄMISTÄ JA HOIDON JATKUVAA LAADUN PARANTAMISTA, CASE HYKS SYÖPÄKESKUS Tuula Helander Kehittämispäällikkö, Hyks Syöpäkeskus, HUS Asiamies, Suomen Syöpäinstituutti

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

Focus Oncologiae. Syöpäsäätiön julkaisusarja No 9, 2008. Rintasyöpä

Focus Oncologiae. Syöpäsäätiön julkaisusarja No 9, 2008. Rintasyöpä Focus Oncologiae Syöpäsäätiön julkaisusarja No 9, 2008 Rintasyöpä Syöpäsäätiön XXXV Symposiumi 7. 8.2.2008 Focus Oncologiae -sarjan julkaisut: Rintasyöpä 2008 Munuaisen ja virtsarakon syövät 2007 Sarkoomat

Lisätiedot

Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta

Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta Ryhmäopetus 22.11.2012 Irma Järvelä Ihmisen kromosomisto: 46 kromosomiparia, joista kaksi sukupuolen määräävää: Naiset 46,

Lisätiedot

FIT Biotech Oy - Innovatiivisia lääkehoitoja. Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK

FIT Biotech Oy - Innovatiivisia lääkehoitoja. Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK FIT Biotech Oy - Innovatiivisia lääkehoitoja Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK Tärkeää tietoa Tämä esitys saattaa sisältää tulevaisuutta koskevia lausumia, arvioita ja laskelmia Yhtiöstä

Lisätiedot

Rintojen kuvantaminen. Rintasyöpä. Rintakuvantaminen HUSalueella LT, radiologian erikoislääkäri Katja Hukkinen YL / Naistenklinikan Röntgen

Rintojen kuvantaminen. Rintasyöpä. Rintakuvantaminen HUSalueella LT, radiologian erikoislääkäri Katja Hukkinen YL / Naistenklinikan Röntgen Rintojen kuvantaminen LT, radiologian erikoislääkäri Katja Hukkinen YL / Naistenklinikan Röntgen Rintasyöpä Rintasyöpää n. 4700 / v. Suomessa. Naisten yleisin syöpä 1960-luvulta lähtien, määrä lisääntyy

Lisätiedot

MIESTEN JA ALLE 35-VUOTIAIDEN NAISTEN RINTASYÖPÄ

MIESTEN JA ALLE 35-VUOTIAIDEN NAISTEN RINTASYÖPÄ MIESTEN JA ALLE 35-VUOTIAIDEN NAISTEN RINTASYÖPÄ Ari-Pekka Asikainen LK & Minna Tanner Dosentti/ Oyl, TAYS, Syövän hoidon vastuualue Syventävien opintojen kirjallinen työ Tampereen yliopisto Lääketieteen

Lisätiedot

Kliiniset lääketutkimukset yliopistosairaalan näkökulma. Lasse Viinikka 18.3.2014 Etiikan päivä 2014

Kliiniset lääketutkimukset yliopistosairaalan näkökulma. Lasse Viinikka 18.3.2014 Etiikan päivä 2014 Kliiniset lääketutkimukset yliopistosairaalan näkökulma Lasse Viinikka 18.3.2014 Etiikan päivä 2014 Tutkimustyön merkitys potilashoidon kannalta parantaa asiantuntijuutta korkeatasoinen tutkija on alansa

Lisätiedot

MILLOIN JA MITEN PALLIATIIVISEEN HOITOON ERIKOISTUNUT LÄÄKÄRI VOI PARHAITEN AUTTAA POTILAITAAN?

MILLOIN JA MITEN PALLIATIIVISEEN HOITOON ERIKOISTUNUT LÄÄKÄRI VOI PARHAITEN AUTTAA POTILAITAAN? MILLOIN JA MITEN PALLIATIIVISEEN HOITOON ERIKOISTUNUT LÄÄKÄRI VOI PARHAITEN AUTTAA POTILAITAAN? LL Kaisa Rajala, Palliatiivinen yksikkö, HUS Syöpäkeskus Geriatrian ja yleislääketieteen EL Palliatiivinen

Lisätiedot

Tiede- ja tutkimusstrategia 2020

Tiede- ja tutkimusstrategia 2020 Tiede- ja tutkimusstrategia 2020 Johtajaylilääkäri Turkka Tunturi 26.4.2012 1 VSSHP:n strategia vuosille 2007-2015 Vahva yliopistollinen yhteistyö Vahvistetaan tutkimustoiminnan edellytyksiä Vaikutetaan

Lisätiedot

Lasten immuunipuutokset. Merja Helminen Lasten infektiolääkäri TaYS lastenklinikka 2004

Lasten immuunipuutokset. Merja Helminen Lasten infektiolääkäri TaYS lastenklinikka 2004 Lasten immuunipuutokset Merja Helminen Lasten infektiolääkäri TaYS lastenklinikka 2004 Mikä on poikkeava infektioherkkyys lapsella? Sairausjaksot ikäryhmittäin päiväkotilapsilla Pönkä ym. 1994 Ikä (v)

Lisätiedot

Orionilainen lääketutkimus ja -kehitys. 13.5.2014 Mikko Kuoppamäki, neurologian dosentti Lääketieteellisen yksikön päällikkö

Orionilainen lääketutkimus ja -kehitys. 13.5.2014 Mikko Kuoppamäki, neurologian dosentti Lääketieteellisen yksikön päällikkö Orionilainen lääketutkimus ja -kehitys 13.5.2014 Mikko Kuoppamäki, neurologian dosentti Lääketieteellisen yksikön päällikkö Maailman paras T&K vuonna 2017 tavoite vuodesta 2008 Paras rakenne Paras johtajuus

Lisätiedot

Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10.

Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10. Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10.2015 Tärkeää tietoa Tämä esitys saattaa sisältää tulevaisuutta

Lisätiedot

Syövän hoidon parantaminen

Syövän hoidon parantaminen Syövän hoidon parantaminen Cancer Control Joint Action Sakari Karjalainen Helsinki 8.2.2016 Mikä on Cancon? Cancon on syövän hoitoon ja varhaisdiagnostiikkaan keskittyvä EUhanke, jossa Suomen Syöpäyhdistys

Lisätiedot

Kauanko hoitoa tulee jatkaa ALK-positiivisen NSCLC:n etenemisen jälkeen?

Kauanko hoitoa tulee jatkaa ALK-positiivisen NSCLC:n etenemisen jälkeen? Kauanko hoitoa tulee jatkaa ALK-positiivisen NSCLC:n etenemisen jälkeen? Edyta Urbanska osastonlääkäri Syöpätautien klinikka, Rigshospitalet, Tanska Otsikon yksinkertaiseen kysymykseen vastaaminen ja ongelman

Lisätiedot

Rintasyöpä Suomessa. Mammografiapäivät Tampere 26.6.2009. Risto Sankila. Ylilääkäri, Suomen Syöpärekisteri, Helsinki

Rintasyöpä Suomessa. Mammografiapäivät Tampere 26.6.2009. Risto Sankila. Ylilääkäri, Suomen Syöpärekisteri, Helsinki Rintasyöpä Suomessa Mammografiapäivät Tampere 26.6.2009 Risto Sankila Ylilääkäri, Suomen Syöpärekisteri, Helsinki Suomen Syöpärekisteri Syöpätautien tilastollinen ja epidemiologinen tutkimuslaitos... syöpärekisteri

Lisätiedot

KLIININEN FARMAKOLOGIA JA LÄÄKEHOITO

KLIININEN FARMAKOLOGIA JA LÄÄKEHOITO 2009 11 KLIININEN FARMAKOLOGIA JA LÄÄKEHOITO Vastuuhenkilö: Prof. Pertti Neuvonen KLL/Diagnostis-terapeuttinen osasto/kliinisen farmakologian yksikkö, Haartmaninkatu 4, PL 340, 00290 HUS Puh. (09) 471

Lisätiedot

Kosteus- ja homeongelmat Suomessa

Kosteus- ja homeongelmat Suomessa Kosteus- ja homeongelmat Suomessa Eduskunnan Tarkastusvaliokunnan tutkimus 2012 Kari Reijula, LKT, professori Helsingin yliopisto ja Työterveyslaitos 19.6.2017 Kari Reijula Kosteus- ja homeongelmat Suomessa

Lisätiedot

Levinneen rintasyövän hoito

Levinneen rintasyövän hoito Johanna Mattson ja Riikka Huovinen KATSAUS Levinneen rintasyövän hoito Levinnyt rintasyöpä on edelleen parantumaton sairaus, vaikka sen hoitoon on viime vuosina tullut useita uusia tehokkaita lääkkeitä.

Lisätiedot

DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen

DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen DNA-testit sukututkimuksessa 28.11.2017 Keravan kirjasto Paula Päivinen Solu tuma kromosomit 23 paria DNA Tumassa olevat kromosomit periytyvät jälkeläisille puoliksi isältä ja äidiltä Y-kromosomi periytyy

Lisätiedot

Matalamman riskin AML. Ei uusia täsmälääkkeitä Onko hoitotuloksia siten mahdollista saada paremmaksi

Matalamman riskin AML. Ei uusia täsmälääkkeitä Onko hoitotuloksia siten mahdollista saada paremmaksi Matalamman riskin AML Ei uusia täsmälääkkeitä Onko hoitotuloksia siten mahdollista saada paremmaksi 1. AI-induktio Nykyinen hoito 2. Mito-HDAraC induktio Mitoksantoni 4 pv + HDAraC 16 g/m2 8 g/m2 4 g/m2

Lisätiedot