Uuden sukupolven sekvensointimenetelmät ja diagnostiikka

Save this PDF as:

Koko: px
Aloita esitys sivulta:

Download "Uuden sukupolven sekvensointimenetelmät ja diagnostiikka"


1 Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Juha-Pekka Pursiheimo Turun Yliopisto Turku Clinical Sequencing Laboratory (TCSL) Labquality Days

2 n. 3,3 miljardia emäsparia kliinisesti merkittävät muutokset

3 teho hinta

4 n. 70 KB emästä -> 20 A4:sta n. 100 GB emästä 350 miljoonaa sekvenssiä (2x150 emästä) -> 30 miljoonaa sivua -> 3360m -> kg 10x


6 Uuden sukupolven sekvensointi: mitä sillä tarkoitetaan -Sekvensoidaan (analysoidaan) useita genomialueita moninkertaisesti useilta potilailta samanaikaisesti DNA rakennevirheet -pistemutaatiot (SNP) -deleetiot -insertiot Kromosomitason muutokset -deleetiot -insertiot -translokaatiot -aneuploidiat

7 Uuden sukupolven sekvensointi: miten se toimii 1. Genomisen materiaalin (gdna) muokkaus pilkonta rikastus (pyydystys tai monistus) 2. DNA-juosteiden erottelu ja kiinnittäminen lasilevy beadit 3. Kiinnitettyjen DNA-juosteiden monistaminen 4. Kaikkien monistettujen DNA-juosteiden samanaikainen analysointi sekvensointi synteesin avulla (SBS) 5. Data-analyysi

8 Uuden sukupolven sekvensointimenetelmien kliiniset hyödyt -Tehokkaampaa diagnostiikkaa Uudet tautigeenit, tautia aiheuttavat genomiset muutokset -Hoitotehon nosto (personalized medicine, precision medicine) precision medicine Is defined as tailoring of tehottomat / haitalliset hoidot vähenevät medical treatment to the individual characteristics -Ennaltaehkäisevät hoidot of each patient (National Research Council, 2011). -Luokittelu ja tautiryhmien jaottelu

9 Miten hyödyt saavutetaan parhaiten?? -Yhteistyö/informaation jako fenotyyppi/genotyyppi/hoitoteho - Laatuvarmistetut ja standardoidut työtavat/ohjeet/kitit - Laatuvarmistettu ja standardoitu data-analyysi muutosten löytäminen raportointi

10 Huomioon otettavia asioita suunniteltaessa Uuden sukupolven sekvensointia kliiniseen käyttöön Diagnostinen saanto/hyöty (Diagnostic yield): -Millä todennäköisyydellä menetelmällä löydetään taudin selittävä genominen muutos -Suhteutuu aina tutkimuskohteeseen ja käytössä olevaan menetelmään -Täytyy olla selkeästi parempi kuin kaytössä olevilla menetelmillä Tutkittavat geenit: -Kliinisessä diagnostiikassa vain ne geenit joilla selkeästi todennettu yhteys tutkittavaan tautiin sisällytetään geenilistaan -Lista täytyy laatia/suunnitella yhteistyössä alan kliinisten asiantuntijoiden kanssa -Analyysissä keskitytään vain näihin geeneihin (validaatiot) Testien rajoitteet: -Teknisistä syistä johtuvat testin sisäiset rajoitteet tulee selvittää testin tilaajalle. Selkeä informaatio siitä mitä voidaan luotettavasti tutkia

11 Haasteita: -Haastavat näytteet (määrä, laatu ) -Logistiikan toimivuus (näytteiden säilytys, käsittely, toimitusajat ) -Moniammatillisuus (mm. bioinformaatikkojen saatavuus) -Laitteiden, analyysiohjelmien toimiminen (varalaitteet, huollot, päivitykset ) -Tulosten pitkäaikainen säilyttäminen (paikallinen vai pilvipalvelu) -Data-analyysi (oma vai osto) -Tuntemattomat variantit, kliininen merkitys, merkintä ja lausuminen epävarmuutta löydetyistä muutoksista joiden merkitystä ei tunneta tutkimuksen ulkopuoliset löydökset (incidental findings) **Ei yhtenäistä toiminta tapaa, jokaisella omat

12 Uuden sukupolven sekvensointimenetelmien diagnostisia sovellutuksia

13 Koko genomin sekvensointi Whole Genome Sequencing (WGS) -Antaa nukleotiditason kuvan koko genomista (n.90%) -Mahdollisuus analysoida kaikki genomiset muutokset -Uudet tautigeenit ja tauteja aiheuttavat genomiset muutokset

14 -14v. kaksoset joilla DRD (Dopa-Responsive Dystonia) -Koko genomin sekvensoinnilla löydettiin het. mutaatiot SPR geenissä -Hoito: L-Dopa vaihdettiin 5-hydroxytryptofaaniin -Molempien potilaiden tila parani huomattavasti -6 potilasta joilla vakava epilepsia 4 Ohtaharan Syndrooma (OS) 2 NSEOE (non-syndromic early-onset epilepsy) -Aiemmat geneettiset analyysit ilman tulosta -Koko genomin sekvensoinnilla löydettiin OSpotilailta 2 de-novo mutaatiota (KCNT1 ja PIGQ) -NSEOE-potilailta CBL ja CSNK1G1 de-novo mutaatiot

15 Eksomisekvensointi Whole Exome Sequencing (WES) -Analysoidaan vain proteiineja koodaavat genomialueet, eli eksonit -n. 1% genomisesta materiaalista -Mahdollista kattaa yli 95% eksoneista, yli 85% tunnetuista tautia-aiheuttavista muutoksista -Kohdealuetta voidaan haluttaessa laajentaa -Uudet tautigeenit ja tauteja aiheuttavat genomiset muutokset -n. 200 tautigeeniä tunnistettu eksomisekvensoinnilla -Kliinisessä käytössä, voidaan helposti pilkkoa pienempiin paneeleihin -Useita eri versioita ja valmistajia

16 -Poika (15kk); oireita jotka viittasivat Chronin tautiin -Tarkoista kliinisistä tutkimuksista huolimatta ei diagnoosia -Eksomisekvensointi löysi hemitsygoottisen missense-mutaation X-linked Inhibitor of Apoptosis geenissä -Löydöksen pohjalta tehtiin allogeeninen solusiirto, jonka seurauksena oireet helpottivat merkittävästi -78 potilasta joilla eriasteisia neurologisia kehityshäiriöitä -Eksomisekvensointi löysi selittävän mutaation 32:lle potilaalle (41%) -Päätelmä: eksomisekvensointi tarjoaa luotettavan ja tehokkaan työkalun varhaiseen diagnosointiin ja hoidon ohjaukseen

17 Paneeli sekvensointi -Tarkasti tiettyyn tautiin/tautiryhmään suunniteltu geenilista -Rajattu, vain tunnetut muutokset -Useita menetelmiä kohdentamiseen

18 -HaloPlex-paneeli jossa 10 kardiomyopatian kehittymiseen liitettyä geeniä -Tarkkuus ja herkkyys sama kuin Sangerilla -Toimii luotettavasti kliinisessä tutkimuksessa -TruSeq Amplicon Cancer -paneeli (Illumina) jossa 54 syöpägeeniä -63 potilasta joilla AML -Pistemutaatiot, insertiot ja duplikaatiot voitiin luotettavasti analysoida -1.5% alleelifrekvenssi!!

19 Soluvapaa DNA (cell free DNA; cfdna) -DNA:ta vapautuu verenkiertoon kuolevista (apoptoosi/nekroosi) soluista ja/tai eksosomien kautta -Soluvapaata DNA:ta käytetään diagnostisissa tutkimuksisssa -Lyhyt puoliaika (dynamiikka) -Lyhyitä DNA-fragmentteja (n emäsparia) NIPT (Non-Invasive Prenatal Test) Syöpädiagnostiikka

20 NIPT (Non-Invasive Prenatal Test) -Sikiön DNA:ta vapautuu äidin verenkiertoon istukan soluista -Kromosomien 21 (Down syndrome), 18 (Edwards syndrome) ja 13 (Patau syndrome) aneuploidiat perustesti -Sukupuolikromosomien aneuploidiat -Sikiön DNA:n määrä

21 Soluvapaa DNA syöpädiagnostiikassa: -Kasvaimen geneettinen monimuotoisuus -Hoitovasteen seuranta -Kasvaimen muuttuminen hoidon seurauksena -Jäännöstautidiagnostiikka -Kasvaimen varhainen havaitseminen -Etäpesäkkeiden havaitseminen -Kasvain taakan havaitseminen

22 Soluvapaa DNA syöpädiagnostiikassa: Patient ARI Alternate Allele Frequency (%) KRAS c.35g>a TP53 c.584t>c SMAD4 c.1055g>a PTEN c.66c>g Weeks



NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS:n haasteet diagnostiikassa 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly


NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS-tutkimukset lääkärin työkaluna 17.11.2016 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Mihin genetiikkaa tarvitaan? taudin patogeneesin ymmärtäminen diagnoosin varmentaminen/vahvistaminen


Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet


Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012


Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän


NIPT. Non-invasiivinen prenataalitutkimus

NIPT. Non-invasiivinen prenataalitutkimus NIPT Non-invasiivinen prenataalitutkimus Non-invasiivinen prenataalitutkimus, NIPT B -NIPT-D ATK 8598 Non-invasiivinen prenataalitutkimus B -NIPTlaa ATK 8599 Non-invasiivinen prenataalitutkimus, laaja


Uusia mahdollisuuksia FoundationOne

Uusia mahdollisuuksia FoundationOne Uusia mahdollisuuksia FoundationOne FI/FMI/1703/0019 Maaliskuu 2017 FoundationOne -palvelu FoundationOne on kattava genomianalysointipalvelu, jossa tutkitaan 315 geenistä koko koodaava alue sekä 28 geenistä


Geneettiset tutkimukset sikiödiagnostiikassa EGO-koulutus

Geneettiset tutkimukset sikiödiagnostiikassa EGO-koulutus Geneettiset tutkimukset sikiödiagnostiikassa EGO-koulutus 27.10.2017 Tanja Saarela LT, perinnöllisyyslääketieteen el vs. yl TAYS perinnöllisyyspoliklinikka Geenitestit perinataalidiagnostiikassa: tavoitteet


Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016



RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA Johanna Mattson dosentti ylilääkäri, vs. toimialajohtaja HYKS Syöpäkeskus 28.11.2016 1 RINTASYÖPÄ SUOMESSA 5008 uutta tapausta vuonna 2014 Paikallinen rintasyöpä


Genomitieto kliinikon apuna nyt ja tulevaisuudessa

Genomitieto kliinikon apuna nyt ja tulevaisuudessa Genomitieto kliinikon apuna nyt ja tulevaisuudessa Helena Kääriäinen Tutkimusprofessori 19.3.2014 Genomitieto / Helena Kääriäinen 1 Mistä kliinikosta puhumme? Kliinisistä geeneetikoista eli perinnöllisyyslääkäreistä?


Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:


Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


Muuttuva diagnostiikka avain yksilöityyn hoitoon

Muuttuva diagnostiikka avain yksilöityyn hoitoon Muuttuva diagnostiikka avain yksilöityyn hoitoon Olli Carpén, Patologian professori, Turun yliopisto ja Patologian palvelualue, TYKS-SAPA liikelaitos ChemBio Finland 2013 EGENTLIGA HOSPITAL FINLANDS DISTRICT


PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto



Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Perinnöllinen informaatio sijaitsee dna:ssa eli deoksiribonukleiinihapossa


GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma

GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma Miika Linna, dos. TkT. Aalto-yliopisto HEMA / Terveyden ja hyvinvoinnin laitos Taustaa Uudet genomitietoon perustuvat hoidon


Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve


Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja


Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta

Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta Ryhmäopetus 22.11.2012 Irma Järvelä Ihmisen kromosomisto: 46 kromosomiparia, joista kaksi sukupuolen määräävää: Naiset 46,


Tuberkuloosin immunodiagnostiset testit. Dosentti Tamara Tuuminen, kliinisen mikrobiologian erl HY, HUSLAB Labquality 02.11.2007

Tuberkuloosin immunodiagnostiset testit. Dosentti Tamara Tuuminen, kliinisen mikrobiologian erl HY, HUSLAB Labquality 02.11.2007 Tuberkuloosin immunodiagnostiset testit Dosentti Tamara Tuuminen, kliinisen mikrobiologian erl HY, HUSLAB Labquality 02.11.2007 HUSLAB:n testivalikoima ELISPOT= Ly-TbSpot Mittaa IFNγ tuottavien solujen


Biopankkitoiminta Suomessa. Dos. Heli Salminen

Biopankkitoiminta Suomessa. Dos. Heli Salminen Biopankkitoiminta Suomessa Dos. Heli Salminen Suomalaisten sairaalabiopankkien erityispiirteet ja mahdollisuudet Miten biopankit vastaavat terveydenhuollon haasteisiin Perustuslaki Biopankkilaki Henkilötietolaki


Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,


Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä


Rintasyövän perinnöllisyys

Rintasyövän perinnöllisyys Lääketieteellisen genetiikan kurssi 17.9.2012 Rintasyövän perinnöllisyys Perinnöllinen syöpäalttius - esimerkkinä rintasyöpä Kristiina Aittomäki, dos. ylilääkäri Genetiikan vastuuyksikköryhmä/huslab/hus


Nanoteknologian mahdollisuudet lääkesovelluksissa

Nanoteknologian mahdollisuudet lääkesovelluksissa Nanoteknologian mahdollisuudet lääkesovelluksissa Marjo Yliperttula 1,3 ja Arto Urtti 1,2 1 Farmaseuttisten biotieteiden osasto, Lääketutkimuksen keskus, Farmasian tiedekunta, Helsingin Yliopisto, Helsinki;


Kokogenomisekvensointi (WGS)

Kokogenomisekvensointi (WGS) Kokogenomisekvensointi (WGS) - Esimerkkinä tuberkuloosi FT, Dos., johtava asiantuntija Hanna Soini Terveysturvallisuusosasto 14.11.2017 WGS - Hanna Soini 1 Sidonnaisuudet Hanna Soini Johtava asiantuntija,


Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012

Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012 Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012 Anna-Elina Lehesjoki, LKT Professori, tutkimusjohtaja Neurotieteen tutkimuskeskus, Helsingin yliopisto Lääketieteellisen genetiikan


Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi

Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Annika Rökman sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Oma taustani FM genetiikka 1998 sairaalageneetikko 2004 FT Perinnöllisestä eturauhassyövästä 2004 Finaksen teknisenä arvioijana vuodesta


Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5. Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.2016 Iina.Tuominen@tyks.fi Genetiikan tutkimukset sarkoomien diagnostiikassa


Miten biopankkitoiminta vaikuttaa patologian osastoissa

Miten biopankkitoiminta vaikuttaa patologian osastoissa Miten biopankkitoiminta vaikuttaa patologian osastoissa Markku Kallajoki TYKS-SAPA/patologia ja Auria Biopankki Labquality days 6.2. 2015 Sisältö Motivointi Biopankkilaki Tuorenäytekeräys Arkistotoimi


Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien molekyylidiagnostiikkaa 30.8.2013 Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien WHO-luokitus on morfologinen Gradusten I-IV ryhmittelyn perustana on toiminut ennusteen huononeminen


Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa

Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa Timo Kanninen, Biocomputing Platforms Oy 2012 all rights reserved BC Platforms genomisen datan hallintaa Geneettisen


A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen

A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen Asiasisältö Keskeisyys Taso 1 2 3 A B C 1 Yleiskäsitteitä periytymiseen liittyen 1.1 Penetranssi


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja






ASSQ 4/21/2009 AUTISMISPEKTRI. Viralliset suomenkieliset käännökset AUTISMISPEKTRIN KEHITYSHÄIRIÖIDEN TUTKIMUSMENETELMÄT. AUTISMISPEKTRIN KEHITYSHÄIRIÖIDEN TUTKIMUSMENETELMÄT AUTISMISPEKTRI 1. Poikkeava ja/tai puutteellinen sosiaalinen vuorovaikutus 2. Poikkeava ja/tai puutteellinen kommunikaatio Marja-Leena Mattila Lastentautien


Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008 16 Kromosomimuutokset Huhtikuussa 2008 Tätä työtä tuki EuroGentest, joka on Euroopan yhteisön tutkimuksen kuudennen puiteohjelman rahoittama verkosto. Kääntänyt Tiina Lund-Aho yhteistyössä Väestöliiton


Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten


Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine


Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Molekyylidiagnostiikka keuhkosyövän hoidossa Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Sidonnaisuudet Taloudelliset riippuvuudet: Konsultointi: - Tutkimusrahoitus: - Honorariat:



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


Kehitysvamma autismin liitännäisenä vai päinvastoin? Maria Arvio

Kehitysvamma autismin liitännäisenä vai päinvastoin? Maria Arvio Kehitysvamma autismin liitännäisenä vai päinvastoin? Maria Arvio Mitä yhteistä autismilla (A) ja kehitysvammalla (KV)? Elinikäiset tilat Oireita, ei sairauksia Diagnoosi tehdään sovittujen kriteereiden


6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?


Nivelreuman serologiset testit: mitä ne kertovat? LT, apulaisylilääkäri Anna-Maija Haapala TAYS Laboratoriokeskus

Nivelreuman serologiset testit: mitä ne kertovat? LT, apulaisylilääkäri Anna-Maija Haapala TAYS Laboratoriokeskus Nivelreuman serologiset testit: mitä ne kertovat? LT, apulaisylilääkäri Anna-Maija Haapala TAYS Laboratoriokeskus Sisältö 1. Nivelreuma: etiologia, esiintyvyys, diagnostiikka 2. Nivelreuman serologiset


X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 12 X-kromosominen periytyminen TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 FOLKHÄLSANS GENETISKA KLINIK PB 211, (Topeliusgatan 20) 00251 Helsingfors tel (09)


Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta

Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta Ryhmäopetus 22.11.2012 Irma Järvelä Ihmisen kromosomisto: 46 kromosomiparia, joista kaksi sukupuolen määräävää: Naiset 46,



Kreatransporttihäiriö Tietolehtiset on tarkoitettu yleiskatsauksiksi johonkin tiettyyn oireyhtymään tai sairauteen, ne eivät korvaa perinnöllisyysneuvontaa tai erikoislääkärin konsultaatiota. Kreatransporttihäiriö Erikoislääkäri


Erotusdiagnostiikasta. Matti Uhari Lastentautien klinikka, Oulun yliopisto

Erotusdiagnostiikasta. Matti Uhari Lastentautien klinikka, Oulun yliopisto Erotusdiagnostiikasta Matti Uhari Lastentautien klinikka, Oulun yliopisto Tavoitteena systemaattinen diagnostiikka Analysoi potilaan antamat tiedot ja kliiniset löydökset Tuota lista mahdollisista diagnooseista


DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =


Immuunipuutokset. Olli Vainio OY Diagnostiikan laitos OYS Kliinisen mikrobiologian laboratorio 17.10.2008

Immuunipuutokset. Olli Vainio OY Diagnostiikan laitos OYS Kliinisen mikrobiologian laboratorio 17.10.2008 Immuunipuutokset Olli Vainio OY Diagnostiikan laitos OYS Kliinisen mikrobiologian laboratorio 17.10.2008 Immuunijärjestelm rjestelmän n toiminta Synnynnäinen immuniteetti (innate) Välitön n vaste (tunneissa)


Uudet tekniikat infektio- diagnostiikassa

Uudet tekniikat infektio- diagnostiikassa Uudet tekniikat infektio- diagnostiikassa Labquality Days 5.2.2015 Kaisu Rantakokko-Jalava Tyks mikrobiologia ja genetiikka VSSHP Tyks-Sapa-liikelaitos Uusia tuulia kl. mikrobiologiassa MALDI-TOF bakteerien


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


Autoimmuunitaudit: osa 1

Autoimmuunitaudit: osa 1 Autoimmuunitaudit: osa 1 Autoimmuunitaute tunnetaan yli 80. Ne ovat kroonisia sairauksia, joiden syntymekanismia eli patogeneesiä ei useimmissa tapauksissa ymmärretä. Tautien esiintyvyys vaihtelee maanosien,


Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Tavallisten tautien genetiikkaa

Tavallisten tautien genetiikkaa Perinnölliset taudit Tavallisten tautien genetiikkaa Yhden geenin sairaudet Monitekijäiset sairaudet Irma Järvelä Lääketieteellisen genetiikan osasto Helsingin yliopisto 2012 Ilmiasu Säätelevä geeni Alttiusgeeni


Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin?

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? 26.3.2015 Kalaterveyspäivät, Tampere Krister Sundell Akvaattisen patobiologian laboratorio Åbo Akademi Flavobacterium psychrophilum Aiheuttaa


Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira

Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa Annikki Welling Kemian laboratoriopalvelut Evira Sisältö Elintarvikepetokset Menetelmiä elintarvikepetosten tunnistamiseksi DNA menetelmät DNA viivakoodaus



GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus GENOMINEN VALINTA HEVOSJALOSTUKSESSA Markku Saastamoinen MTT Hevostutkimus Genominen valinta genomisessa valinnassa eläimen jalostusarvo selvitetään DNA:n sisältämän perintöaineksen tiedon avulla Genomi


Keuhkoahtaumataudin varhaisdiagnostiikka ja spirometria. Esko Kurttila Keuhkosairauksien ja työterveyshuollon erikoislääkäri

Keuhkoahtaumataudin varhaisdiagnostiikka ja spirometria. Esko Kurttila Keuhkosairauksien ja työterveyshuollon erikoislääkäri Keuhkoahtaumataudin varhaisdiagnostiikka ja spirometria Esko Kurttila Keuhkosairauksien ja työterveyshuollon erikoislääkäri Epidemiologia N. 10%:lla suomalaisista on keuhkoahtaumatauti Keuhkoahtaumatauti


Suoritusarvot. Sample to Insight. Myöhemmät analyysit. Puhdistetun DNA:n tuotos. Versiotiedot. QIAamp DSP DNA FFPE Tissue Kit, Versio

Suoritusarvot. Sample to Insight. Myöhemmät analyysit. Puhdistetun DNA:n tuotos. Versiotiedot. QIAamp DSP DNA FFPE Tissue Kit, Versio Suoritusarvot QIAamp DSP DNA FFPE Tissue Kit, Versio 1 60404 Versiotiedot Tässä asiakirjassa on DSP DNA FFPE Tissue -pakkauksen suoritustiedot, versio 1, R3. Tarkista ennen kokeen suorittamista uusien


Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä. Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS

Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä. Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS Taustaa Miksi uudet tutkimustulokset lihastautien perimmäisistä


Clostridium difficile diagnostiikan nykyvaihe ja pulmat. Janne Aittoniemi, LT, dos, oyl Fimlab Laboratoriot Oy

Clostridium difficile diagnostiikan nykyvaihe ja pulmat. Janne Aittoniemi, LT, dos, oyl Fimlab Laboratoriot Oy Clostridium difficile diagnostiikan nykyvaihe ja pulmat Janne Aittoniemi, LT, dos, oyl Fimlab Laboratoriot Oy 1.10.2013 Cd-laboratoriodiagnostiikan pulmat - Kuinka Cd-infektio pitäisi diagnostisoida laboratoriossa?


Miten järjestäisin harvinaisepilepsian hyvän diagnostiikan ja hoidon; esimerkkinä Dravet n oireyhtymän haasteet

Miten järjestäisin harvinaisepilepsian hyvän diagnostiikan ja hoidon; esimerkkinä Dravet n oireyhtymän haasteet 20.3.2015 Miten järjestäisin harvinaisepilepsian hyvän diagnostiikan ja hoidon; esimerkkinä Dravet n oireyhtymän haasteet Eija Gaily oyl, lastenneurologian dos. HYKS, Lasten ja nuorten sairaala Sisältö


Kokemuksia uusien biopankkien eettisestä arvioinnista

Kokemuksia uusien biopankkien eettisestä arvioinnista Kokemuksia uusien biopankkien eettisestä arvioinnista HUS-piirin valtakunnallinen tutkimuseettisten toimikuntien koulutus- ja neuvottelupäivä 20.5.2014 Pääsihteeri Outi Konttinen TUKIJA 19.5.2014 Pääsihteeri


Terveyteen liittyvät geenitestit

Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Jokaisella meistä on vanhemmiltamme perittynä oma yksilöllinen geenivalikoimamme. Tämä geneettinen rakenteemme yhdessä erilaisten ympäristön



SÄTEILYN TERVEYSVAIKUTUKSET SÄTEILYN TERVEYSVAIKUTUKSET 25 Säteily- ja ydinturvallisuus -kirjasarjan toimituskunta: Sisko Salomaa, Wendla Paile, Tarja K. Ikäheimonen, Roy Pöllänen, Anne Weltner, Olavi Pukkila, Jorma Sandberg, Heidi


Genomin evoluutio. Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan?

Genomin evoluutio. Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan? Genomin evoluutio Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan? -duplikaatiot: geenien, geenin osien duplikaatiot, segmentaaliset, koko genomin duplikaatiot -duplikoituneiden geenien


Maria Aalto. BRIP1-geenin eksonien 12 ja 14 mutaatiomääritys munasarjasyövässä

Maria Aalto. BRIP1-geenin eksonien 12 ja 14 mutaatiomääritys munasarjasyövässä Maria Aalto BRIP1-geenin eksonien 12 ja 14 mutaatiomääritys munasarjasyövässä Metropolia Ammattikorkeakoulu Laboratorioanalyytikko Laboratorioalan koulutusohjelma Opinnäytetyö 26.4.2012 ALKULAUSE Tämä


PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa. Jyrki Lötjönen, johtava tutkija VTT

PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa. Jyrki Lötjönen, johtava tutkija VTT PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa Jyrki Lötjönen, johtava tutkija VTT 2 Alzheimerin taudin diagnostiikka Alzheimerin tauti on etenevä muistisairaus. Alzheimerin tauti





Lasten luuydinpatologiaa. Jouko Lohi HUSLAB, Patologian keskuslaboratorio ja Helsingin yliopisto

Lasten luuydinpatologiaa. Jouko Lohi HUSLAB, Patologian keskuslaboratorio ja Helsingin yliopisto Lasten luuydinpatologiaa Jouko Lohi HUSLAB, Patologian keskuslaboratorio ja Helsingin yliopisto Päivän prikalta 3 v 11 kk tyttö Ontuminen, jalkakipu Osteomyeliitti? Cristabiopsiat molemmin puolin Leder


Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä Matti Pirinen Suomen molekyylilääketieteen instituutti (FIMM) Helsingin Yliopisto 17.2.2015 Tilastollisen päättelyn kurssi Kumpula Sisältö


Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian








Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan. Minna Äikäs. Metropolia Ammattikorkeakoulu. Bioanalyytikko (AMK)

Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan. Minna Äikäs. Metropolia Ammattikorkeakoulu. Bioanalyytikko (AMK) Minna Äikäs Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan Metropolia Ammattikorkeakoulu Bioanalyytikko (AMK) Koulutusohjelma Opinnäytetyö 23.4.2014 Tiivistelmä Tekijä


Keuhkosyövän molekyylipatologia

Keuhkosyövän molekyylipatologia Professori Sakari Knuutila Helsingin yliopisto Keuhkosyövän molekyylipatologia Keuhkosyövän tunnuspiirteenä ovat lukuisat muutokset genomin rakenteessa ja toiminnassa. Sama ilmiö liittyy kaikkiin pitkälle


Muistisairaudet saamelaisväestössä

Muistisairaudet saamelaisväestössä Muistisairaudet saamelaisväestössä Anne Remes Professori, ylilääkäri Kliininen laitos, neurologia Itä-Suomen yliopisto, KYS Esityksen sisältö Muistisairauksista yleensä esiintyvyys tutkiminen tärkeimmät


Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset EU:ssa ei ole yleisesti hyväksyttyä elintarvikepetosten määritelmää. Yleinen ohjeistus löytyy elintarvikelainsäädäntöä


KEUHKOSYÖVÄN SEULONTA. Tiina Palva Dosentti, Syöpätautien ja sädehoidon erikoislääkäri, Väestövastuulääkäri, Kuhmoisten terveysasema

KEUHKOSYÖVÄN SEULONTA. Tiina Palva Dosentti, Syöpätautien ja sädehoidon erikoislääkäri, Väestövastuulääkäri, Kuhmoisten terveysasema KEUHKOSYÖVÄN SEULONTA Tiina Palva Dosentti, Syöpätautien ja sädehoidon erikoislääkäri, Väestövastuulääkäri, Kuhmoisten terveysasema Seulonta on tiettyyn väestöryhmään kohdistuva tutkimus, jolla pyritään


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri


Uskomusverkot: Lääketieteelliset sovellukset

Uskomusverkot: Lääketieteelliset sovellukset Teknillinen korkeakoulu Systeemianalyysin laboratorio Mat-2.142 Optimointiopin seminaari Referaatti Uskomusverkot: Lääketieteelliset sovellukset Sami Nousiainen 44433N Tf V 2 1. JOHDANTO 3 2. YKSINKERTAINEN


Plasmasolukasvaimet (hematologin näkökulmasta) Eeva-Riitta Savolainen LKT, dos Os.ylilääkäri

Plasmasolukasvaimet (hematologin näkökulmasta) Eeva-Riitta Savolainen LKT, dos Os.ylilääkäri Plasmasolukasvaimet (hematologin näkökulmasta) Eeva-Riitta Savolainen LKT, dos Os.ylilääkäri Monoklonaaliset gammapatiat (plasmasolutaudit) Plasmasolumyelooma Merkitykseltään epäselvä monoklonaalinen gammapatia


Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede.

Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros Dan Lindholm Genominen lääketiede Genomiprojektit Ihmisgenomi - geenien ja niiden erojen Taudinaiheuttajien genomit - diagnostiikka



HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA B-DNAmut-tutkimusnimikkeellä tehdyt lähetteet Fimlab Laboratoriot Oy:n genetiikan laboratoriossa vuosina 2013 ja 2014 Olli Kemppainen Emilia
