Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Save this PDF as:
 WORD  PNG  TXT  JPG

Koko: px
Aloita esitys sivulta:

Download "Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm"

Transkriptio

1 Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

2 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5!

3 Informaatioteknologian mullistus ?

4 Molekyylibiologian mullistus Yhdistelmä-DNAtekniikat DNA:n lukeminen (sekvensointi) keksitty Insuliini-hormonia tuotettiin bakteereissa diabeteksen hoitoon Ihmisen genomin läpiluennasta 10 v. Tuhansia tautigeenejä tunnetaan Siirto- ja poistogeeniset eliöt Yksilöllinen perimän luenta Ympäristönäytteiden DNA-luenta Yhden solun luenta?

5 Molekyylibiologian mullistus Yhden miljoonan emäksen luennan hinta (US$) Mooren laki 100,000-kertainen kustannusten lasku

6 Molekyylibiologian mullistus Yhden ihmisperimän luennan hinta (US$) Mooren laki

7 Suurimittakaavainen DNA-luenta High-throughput sequencing (HTS) Next Generation Sequencing (NGS) Massively Parallel Sequencing (MPS) Nykylaitteilla voidaan lukea ihmisgenomi päivässä (30 X peitto, 1 X peitto = 3,000,000,000 emästä) Yhden genomin hinta alle 4000

8 Missä olemme? Yli 4000 bakteerilajin ja noin 200 eukaryoottilajin (eläimet, kasvit) perimän sekvenssi tunnetaan Lajien vertailu osoittaa, että kaikki elämä on sukua keskenään ja peräisin samasta alkulähteestä Erityinen hanke (HapMap Project) tutki ihmisten välistä vaihtelua eri maanosissa ja väestöissä Voiko yksilöllinen vaihtelu selittää sairausriskejä? Kahden ihmisen perimät eroavat keskimäärin 0.3%

9 Tavalliset DNA:n vaihtelun muodot 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5!

10 Tavalliset DNA:n vaihtelun muodot Toistojaksojen pituusvaihtelu 5 ATCACACACAGTCCTGACGTGCTTAG 3! 3 TAGTGTGTGTCAGGACTGCACGAATC 5! 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5!

11 Tavalliset DNA:n vaihtelun muodot Toistojaksojen pituusvaihtelu 5 ATCACACACAGTCCTGACGTGCTTAG 3! 3 TAGTGTGTGTCAGGACTGCACGAATC 5! 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! 5 ATCACACACACACAGTCCTGATGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTACACG 5! Pistevaihtelu (SNP)

12 NHGRI GWA Catalog: GWAStudies

13 NHGRI GWA Catalog: GWAStudies Published Genome-Wide Associations through 03/2011, 1,319 published GWA at p 5x10-8 for 221 traits

14 1400 Tautigeenien löytäminen perimänlaajuisilla assosiaatiotutkimuksilla 1350 Julkaisuiden kokonaismäärä Through 6/30/12 postings Vuosi, kalenterineljännes

15 Riskien ymmärtäminen FGFR2 geeni rintasyövässä FGFR2 rs OR 1.2 (homotsyg. 1.6) p=10-75 Vertailun vuoksi: tupakointi ja keuhkosyöpä Miesten suhteellinen keuhkosyöpäriski tupakoinnin keston ja määrän mukaan

16 Yhden solun tutkimus Geenien ilmentyminen kolmen ensimmäisen päivän aikana Hovatta, Kere & Linnarsson labs Hedelmöityshoidoista ylijääneitä soluja lahjoituksina vanhemmilta. Solut kypsytetty maljalla 3 päivän ikään saakka.

17 Hienoa. Mutta mitä merkitystä tällä sitten on? Koskeeko tämä tavallisia ihmisiä?

18 Tulevaisuuden haasteita Ihmiset elävät yhä kauemmin. Elintasosairaudet (lihavuus, tyypin 2 diabetes, sydäntaudit, syöpä) yleistyvät monissa maissa. Mistä saamme energiaa 9 miljardin ihmisen tarpeisiin. Fossiiliset polttoaineet eivät riitä. Bioenergia? Väestönkasvu saavuttaa 9 miljardin rajan v Pandeemisten infektiotautien riski kasvaa. Mistä saamme tarpeeksi ruokaa 9 miljardille ihmiselle? Tärkeimmät lähteet vehnä, riisi ja maissi. Parempia lajikkeita geenimuuntelun avulla? Mistä juomavesi 9 miljardille ihmiselle? Veden biopuhdistus?

19 Molekyylibiologian mullistus Ihmisen genomiprojekti HGP Koko perimän luenta

20 Molekyylibiologian mullistus Mikrosirut Infektiotaudit Muut lajit Kasvinjalostus Ravinnon tuotanto Mikrobien sekvensointi Geenien vertailu HGP Yksilöllinen sekvensointi Epigenetiikka Perimän vaihtelu Farmakogenomiikka Sekvensointiteknologiat Metagenomiikka Evoluutiobiologia Tautiassosiaatiot Väestögenetiikka Syöpägenomiikka Uudet energialähteet Jätteiden käsittely

21 Molekyylibiologian mullistus Mikrosirut Infektiotaudit Muut lajit Kasvinjalostus Ravinnon tuotanto Uudet energialähteet Mikrobien sekvensointi Geenien vertailu Jätteiden käsittely HGP Yksilöllinen sekvensointi Epigenetiikka Perimän vaihtelu Farmakogenomiikka Sekvensointiteknologiat Metagenomiikka Evoluutiobiologia Tautiassosiaatiot Väestögenetiikka Syöpägenomiikka Syövän hoitovalinnat muuttuvat ensin: mikroskopiasta mikrosiruihin

22 Tulevaisuudennäkymiä Hinta/genomi 100k Diagnostinen hyöty suuri 10k 1k 0.1k pieni X 20XX Aika

23 The quantified self Exercise Food & drink Work habits Sleep Lab tests Own genome Cloud database My portable gadget Selfmonitoring Food & living habits Exercise programs Social groups Personal trainer Physician Hospital visits

24 The quantified self Yhä useammat ovat kiinnostuneita terveydestä ja sen ylläpitämisestä, ja tekniikka antaa mahdollisuuden monien asioiden mittaamiseen à Paljon mahdollisia hyötyjä: motivoituminen terveisiin elintapoihin, yksilöllinen suunnitelmallisuus terveyden ylläpitämiseksi, sairauksien varhaiset varoitusmerkit, parantunut potilas-lääkärikontakti, alentuneet terveydenhuollon kustannukset à mutta moni asia voi mennä pieleenkin: neuroottinen itsetarkkailu, menetetty elämänilo, terveysterrorismi, eriarvoistuminen osallistuviin ja osallistumattomiin, osallistumattomien syrjintä

25 Johtopäätöksiä 1 Virtuaalitodellisuus ja informaatioteknologiat eivät yksin voi ratkaista maailman suuria ongelmia seuraavan 35 vuoden aikana

26 Johtopäätöksiä 2 Biolääketieteen ja bioteknologian mullistus ovat tuottaneet keinoja ymmärtää ja ratkaista biologisen luonnon ongelmia

27

28 Kere group retreat, Sigtuna, September 2013

Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

Ravitsemus, terveys ja Suomen luonnosta saadut tuotteet. Raija Tahvonen

Ravitsemus, terveys ja Suomen luonnosta saadut tuotteet. Raija Tahvonen Ravitsemus, terveys ja Suomen luonnosta saadut tuotteet Raija Tahvonen Terveellinen ruokavalio on kasvivoittoinen Runsaasti: Kasviksia, marjoja ja hedelmiä Viljatuotteet pääosin täysjyväviljaa Kalaa ja

Lisätiedot

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS-tutkimukset lääkärin työkaluna 17.11.2016 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Mihin genetiikkaa tarvitaan? taudin patogeneesin ymmärtäminen diagnoosin varmentaminen/vahvistaminen

Lisätiedot

Perimän lukemisesta luetun ymmärtämiseen

Perimän lukemisesta luetun ymmärtämiseen Juha Kere ÄYRÄPÄÄN LUENTO 2011 Perimän lukemisesta luetun ymmärtämiseen Lääketieteen tutkimusmenetelmät ovat kehittyneet nopeasti viime vuosikymmeninä, ja yhä kiihtyvä kehitys näyttää jatkuvan vailla merkkiä

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä

Lisätiedot

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja

Lisätiedot

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Markus Perola, LT, geneettisen epidemiologian tutkimusprofessori THL, KATO, GETY markus.perola@thl.fi Määritelmiä L3/13.9.2012

Lisätiedot

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Markus Perola, LT, geneettisen epidemiologian tutkimusprofessori THL, KATO, GETY markus.perola@thl.fi Määritelmiä L3/28.8.2013

Lisätiedot

Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä Matti Pirinen Suomen molekyylilääketieteen instituutti (FIMM) Helsingin Yliopisto 17.2.2015 Tilastollisen päättelyn kurssi Kumpula Sisältö

Lisätiedot

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma Evoluutio BI Elämä ja evoluutio Leena Kangas-Järviluoma 1 Evoluutio lajinkehitystä, jossa eliölajit muuttuvat ja niistä voi kehittyä uusia lajeja on jatkunut elämän synnystä saakka, sillä ei ole päämäärää

Lisätiedot

PYLL-seminaari 30.3.2011. Näkökulmia Etelä-Savon shp:n väestön hyvinvoinnin seurantaan ja strategisiin johtopäätöksiin

PYLL-seminaari 30.3.2011. Näkökulmia Etelä-Savon shp:n väestön hyvinvoinnin seurantaan ja strategisiin johtopäätöksiin PYLL-seminaari 30.3.2011 Näkökulmia Etelä-Savon shp:n väestön hyvinvoinnin seurantaan ja strategisiin Sairaalajohtaja Jari Välimäki PYLL -menetelmä perustuu kuolleen iän ja odotettavissa olevan eliniän

Lisätiedot

Lataa Tartu toimeen - ehkäise diabetes. Lataa

Lataa Tartu toimeen - ehkäise diabetes. Lataa Lataa Tartu toimeen - ehkäise diabetes Lataa ISBN: 9789522453532 Sivumäärä: 70 Formaatti: PDF Tiedoston koko: 22.41 Mb Diabetes on ryhmä sairauksia, joihin liittyy pitkäaikaisesti kohonnut verensokeri.

Lisätiedot

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset

Lisätiedot

Paremman elämän puolesta

Paremman elämän puolesta Paremman elämän puolesta MSD toimii paremman elämän puolesta, suomalaisen potilaan parhaaksi. Meille on tärkeää, että jokainen lääkehoitoa tarvitseva saa juuri hänelle parhaiten sopivan hoidon. Me MSD:llä

Lisätiedot

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012

Lisätiedot

BIOLOGIA 1. kurssi 7. luokka

BIOLOGIA 1. kurssi 7. luokka 1. kurssi 7. luokka Kurssin tavoitteena on ohjata oppilasta ymmärtämään elämän perusilmiöitä ja vesiekosysteemien rakennetta ja toimintaa. Tavoitteena on, että oppilas oppii tunnistamaan ja luokittelemaan

Lisätiedot

Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä

Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Vesihuoltopäivät 10.5.2017, Jyväskylä Jenni Kesulahti Diplomityö Aalto-yliopistossa Hankkeessa

Lisätiedot

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen

Lisätiedot

Lihavuuden kustannuksia. Markku Pekurinen, osastojohtaja, tutkimusprofessori

Lihavuuden kustannuksia. Markku Pekurinen, osastojohtaja, tutkimusprofessori Lihavuuden kustannuksia Markku Pekurinen, osastojohtaja, tutkimusprofessori Lihavuus Monien sairauksien riskitekijä Väestötasolla nopeasti yleistyvä ongelma Taloudellisista vaikutuksista lisääntyvästi

Lisätiedot

GEENIVARAT OVAT PERUSTA KASVINJALOSTUKSELLE. Merja Veteläinen Boreal Kasvinjalostus Oy

GEENIVARAT OVAT PERUSTA KASVINJALOSTUKSELLE. Merja Veteläinen Boreal Kasvinjalostus Oy GEENIVARAT OVAT PERUSTA KASVINJALOSTUKSELLE Merja Veteläinen Boreal Kasvinjalostus Oy OPIT TÄNÄÄN Miksi kasvinjalostus tarvitsee geenivaroja? Miten geenivaroja käytetään kasvinjalostuksessa? Geenivarat

Lisätiedot

III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 15. Populaatiogenetiikka ja evoluutio 1. Avainsanat 2. Evoluutio muuttaa geenipoolia 3. Mihin valinta kohdistuu? 4. Yksilön muuntelua

Lisätiedot

Raskausdiabetes tyypin 2 diabeteksen riskitekijä. Johan Eriksson Professori, ylilääkäri Helsingin yliopisto ja HUS

Raskausdiabetes tyypin 2 diabeteksen riskitekijä. Johan Eriksson Professori, ylilääkäri Helsingin yliopisto ja HUS Raskausdiabetes tyypin 2 diabeteksen riskitekijä Johan Eriksson Professori, ylilääkäri Helsingin yliopisto ja HUS Raskausdiabetes Raskausdiabetes tarkoittaa poikkeavaa glukoosiaineenvaihduntaa - eli verensokerin

Lisätiedot

BIOLÄÄKETIETEEN LÄPIMURROT

BIOLÄÄKETIETEEN LÄPIMURROT BIOLÄÄKETIETEEN LÄPIMURROT Jussi Huttunen Tampere 20.4.2016 LÄÄKETIETEEN MEGATRENDIT Väestö vanhenee ja sairauskirjo muuttuu Teknologia kehittyy - HOITOTEKNOLOGIA - tietoteknologia Hoito yksilöllistyy

Lisätiedot

Avainsanat. populaatio yksilöiden levintätyypit ikärakenne sukupuolijakauma populaation kasvumallit ympäristön vastus elinkiertostrategiat

Avainsanat. populaatio yksilöiden levintätyypit ikärakenne sukupuolijakauma populaation kasvumallit ympäristön vastus elinkiertostrategiat Avainsanat populaatio yksilöiden levintätyypit ikärakenne sukupuolijakauma populaation kasvumallit ympäristön vastus elinkiertostrategiat Populaatio Populaatiolla tarkoitetaan tietyllä alueella tiettynä

Lisätiedot

Lataa Pysy nuorena - elä kauemmin - Hannu Vierola. Lataa

Lataa Pysy nuorena - elä kauemmin - Hannu Vierola. Lataa Lataa Pysy nuorena - elä kauemmin - Hannu Vierola Lataa Kirjailija: Hannu Vierola ISBN: 9789518852653 Sivumäärä: 328 Formaatti: PDF Tiedoston koko: 36.65 Mb Tupakoinnin ja syövän yhteys tunnetaan hyvin,

Lisätiedot

KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN

KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN Suomen Ympäristösairauskeskus perustettiin viime vuonna ajantasaisen ympäristösairaustiedon asiantuntijakeskukseksi. Tavoitteena on ajantasaisen,

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

Lataa Liikuntalääketiede. Lataa

Lataa Liikuntalääketiede. Lataa Lataa Liikuntalääketiede Lataa ISBN: 9789516564015 Sivumäärä: 699 Formaatti: PDF Tiedoston koko: 37.84 Mb Liikuntalääketiede on uusimpaan tieteelliseen näyttöön perustuva alan oppi- ja käsikirja. Liikuntalääketieteellisen

Lisätiedot

Alkoholi. lisää syövän vaaraa. Niillä, jotka kuluttavat säännöllisesi neljä alkoholiannosta päivässä, on. Alkoholi voi aiheuttaa ainakin

Alkoholi. lisää syövän vaaraa. Niillä, jotka kuluttavat säännöllisesi neljä alkoholiannosta päivässä, on. Alkoholi voi aiheuttaa ainakin Alkoholi lisää syövän vaaraa Alkoholi on yksi merkittävimmistä elintapoihin liittyvistä syöpäriskeistä. Mitä enemmän alkoholia käyttää, sitä suurempi on riski sairastua syöpään. Myös kohtuullinen alkoholinkäyttö

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

Globaali kiertotalous ja kestävä kehitys

Globaali kiertotalous ja kestävä kehitys Globaali kiertotalous ja kestävä kehitys KOHTI KESTÄVIÄ VALINTOJA MITEN VOIMME VAIKUTTAA KIERTOTALOUTEEN Tuula Pohjola TkT Crnet Oy 4/21/2015 Crnet Oy/Tuula Pohjola 1 Tuula Pohjola, TkT Erityisala vastuullinen

Lisätiedot

Luonnonmarjat ja kansanterveys. Raija Tahvonen MTT/BEL

Luonnonmarjat ja kansanterveys. Raija Tahvonen MTT/BEL Luonnonmarjat ja kansanterveys Raija Tahvonen MTT/BEL 15.8.2013 Jos poimit marjat itse, saat Liikuntaa Luonnossa liikkumisen hyvät vaikutukset aivoille Marjasi tuoreena Varman tiedot, mistä marjat ovat

Lisätiedot

Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and

Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and Duodecim, and a textbook chapter on viral gene therapy for

Lisätiedot

Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa

Lisätiedot

Mitä teollinen biotekniikka oikein on?

Mitä teollinen biotekniikka oikein on? 1 Mitä teollinen biotekniikka oikein on? Seminaari 17.8.2006 Biotekniikan neuvottelukunta 2 Bioteknologia! Bioteknologia on eliöiden, solujen, solujen osien tai solussa esiintyvien molekyylien toimintojen

Lisätiedot

Diabetesepidemia aikamme tsunami. Markku Laakso, akatemiaprofessori Itä-Suomen yliopisto ja Kuopion yliopistollinen sairaala

Diabetesepidemia aikamme tsunami. Markku Laakso, akatemiaprofessori Itä-Suomen yliopisto ja Kuopion yliopistollinen sairaala Diabetesepidemia aikamme tsunami Markku Laakso, akatemiaprofessori Itä-Suomen yliopisto ja Kuopion yliopistollinen sairaala Diabetes on valtava terveysongelma maailmassa 2014 2035 Suomessa on n. 500,000

Lisätiedot

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli

Lisätiedot

Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa

Lisätiedot

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays

Lisätiedot

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS:n haasteet diagnostiikassa 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly

Lisätiedot

Lataa Lapsen diabetes. Lataa

Lataa Lapsen diabetes. Lataa Lataa Lapsen diabetes Lataa ISBN: 9789524860505 Sivumäärä: 98 Formaatti: PDF Tiedoston koko: 36.32 Mb Olemme suunnitelleet oppaan alle 15-vuotiaana tyypin 1 diabetekseen sairastuneiden lasten vanhemmille.

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Katja Aktan-Collan Alkoholi ja syöpä

Katja Aktan-Collan Alkoholi ja syöpä Katja Aktan-Collan Alkoholi ja syöpä Alkoholi ja syöpä Maarit Rautio Matti Rautalahti Alkoholin kulutus 10 l/vuodessa Suomessa ja Tanskassa 9 l/vuodessa Ruotsissa 6,5 l/vuodessa Norjassa Alkoholi on Suomessa

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

Biologia ylioppilaskoe

Biologia ylioppilaskoe Biologia ylioppilaskoe 12 tehtävää, joista kahdeksaan (8) vastataan Tehtävät vaikeutuvat loppua kohden, jokeritehtävät merkitty +:lla Molempiin jokereihin saa vastata ja ne lasketaan mukaan kahdeksaan

Lisätiedot

5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede.

Genominen lääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros. HUGOnjälkeen1. Genomilääketiede. Mikä on genomilääketiede? Dan Lindholm, BiolääketieteenLaitos 2kerros Dan Lindholm Genominen lääketiede Genomiprojektit Ihmisgenomi - geenien ja niiden erojen Taudinaiheuttajien genomit - diagnostiikka

Lisätiedot

Mustaruoste uhkaa romahduttaa maailman vehnäsadot jälleen

Mustaruoste uhkaa romahduttaa maailman vehnäsadot jälleen Mustaruoste uhkaa romahduttaa maailman vehnäsadot jälleen Ruosteenkestävät ja lyhytkortiset vehnälajikkeet...toivat "vihreän kumouksen" vehnän viljelyyn 60-luvulla: Peltonen-Sainio P. Vihreä vallankumous,

Lisätiedot

BI4 Ihmisen Biologia KAUSTISEN MUSIIKKILUKIO

BI4 Ihmisen Biologia KAUSTISEN MUSIIKKILUKIO BI4 Ihmisen Biologia KAUSTISEN MUSIIKKILUKIO 2016-2017 Tervetuloa BI4-kurssille! Kurssin tavoitteena on, että opiskelija osaa: ihmissolun erilaistumisen pääperiaatteet sekä kudosten ja elinten rakenteet

Lisätiedot

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin?

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? 26.3.2015 Kalaterveyspäivät, Tampere Krister Sundell Akvaattisen patobiologian laboratorio Åbo Akademi Flavobacterium psychrophilum Aiheuttaa

Lisätiedot

VÄESTÖTUTKIMUKSET: miksi niitä tehdään? Seppo Koskinen ja työryhmä

VÄESTÖTUTKIMUKSET: miksi niitä tehdään? Seppo Koskinen ja työryhmä VÄESTÖTUTKIMUKSET: miksi niitä tehdään? Seppo Koskinen ja työryhmä Tutkimusten tarkoitus 1) Tilanteen kuvaaminen Millaisia terveys- ja hyvinvointiongelmia väestössä on? (esim. sydäntaudit, allergiat, mielenterveysongelmat,

Lisätiedot

Lataa Evoluutiobiologia - Mats Björklund. Lataa

Lataa Evoluutiobiologia - Mats Björklund. Lataa Lataa Evoluutiobiologia - Mats Björklund Lataa Kirjailija: Mats Björklund ISBN: 9789524950763 Sivumäärä: 260 Formaatti: PDF Tiedoston koko: 29.63 Mb Evoluutioteoria on kaikkea biologista tietoa yhdistävä

Lisätiedot

Healthy eating at workplace promotes work ability. Terveellinen ruokailu työpaikalla edistää työkykyä

Healthy eating at workplace promotes work ability. Terveellinen ruokailu työpaikalla edistää työkykyä Healthy eating at workplace promotes work ability Terveellinen ruokailu työpaikalla edistää työkykyä Jaana Laitinen Dosentti, Team Leader Työterveyslaitos, Suomi Finnish Institute of Occupational Health

Lisätiedot

Uusia mahdollisuuksia FoundationOne

Uusia mahdollisuuksia FoundationOne Uusia mahdollisuuksia FoundationOne FI/FMI/1703/0019 Maaliskuu 2017 FoundationOne -palvelu FoundationOne on kattava genomianalysointipalvelu, jossa tutkitaan 315 geenistä koko koodaava alue sekä 28 geenistä

Lisätiedot

Kuolevuusseminaari 9.4.2013

Kuolevuusseminaari 9.4.2013 Kuolevuusseminaari 9.4.2013 Jari Niittuinperä Kuolevuuseminaari 19.3. Vakuutusalan viimeaikaiset kuolevuustutkimukset Prosessi ja siihen liittyvät haasteet (data, mallintaminen, laskenta, tulosten verifiointi)

Lisätiedot

Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012. Lihavuus kansanterveyden haasteena

Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012. Lihavuus kansanterveyden haasteena Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012 Lihavuus kansanterveyden haasteena Lihavuus kuoleman vaaratekijänä Yli 6000 lihavan keskimäärin 15 vuoden seuranta

Lisätiedot

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen käyttöön liittyviä haasteita Juhani Eskola 310505 7.6.2005 1 Valitut painopistealueet Kansantautien ja terveyden geenitausta Mikrobit ja

Lisätiedot

Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia

Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Genomi-ilmentyminen Genom expression (uttryckning) DNA RNA 7.12.2017 Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Osaamistavoitteet Lärandemål Luennon jälkeen ymmärrät pääperiaatteet

Lisätiedot

Olen saanut tyypin 2 diabeteksen

Olen saanut tyypin 2 diabeteksen Bolujem od dijabetesa tip 2 Olen saanut tyypin 2 diabeteksen Kysymyksiä ja vastauksia Pitanja i odgovori Mitä diabetekseen sairastuminen merkitsee? On täysin luonnollista, että diabetekseen sairastunut

Lisätiedot

Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen

Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Opintori 10.5.2012 Minna Männikkö Biolääketieteen laitos Lääketieteellisen biokemian ja molekyylibiologian kurssi 15 op, 170 opiskelijaa Kemia:

Lisätiedot

Diabetes. Iida, Sofia ja Vilma

Diabetes. Iida, Sofia ja Vilma Diabetes Iida, Sofia ja Vilma Diabetes Monia aineenvaihduntasairauksia, joissa veren sokeripitoisuus kohoaa liian korkeaksi Useimmiten syynä on haiman erittämän insuliinihormonin vähäisyys tai sen puuttuminen

Lisätiedot

GEENIT JA KORONAARITAUDIN RISKI

GEENIT JA KORONAARITAUDIN RISKI GEENIT JA KORONAARITAUDIN RISKI LT Kirsi Auro 17/10/2013 1 Aiheet Sydän- ja verisuonitautien preventiosta Suomessa Geneettiset riskilaskut Loppupäätelmät Sydän- ja verisuonitautien riskitekijöitä Sukupuoli

Lisätiedot

Bioenergia ry 6.5.2014

Bioenergia ry 6.5.2014 Bioenergia ry 6.5.2014 Hallituksen bioenergiapolitiikka Hallitus on linjannut energia- ja ilmastopolitiikan päätavoitteista puhtaan energian ohjelmassa. Hallitus tavoittelee vuoteen 2025 mennessä: Mineraaliöljyn

Lisätiedot

Lataa Liikkujan kasvisruokavalio - Jussi Riekki. Lataa

Lataa Liikkujan kasvisruokavalio - Jussi Riekki. Lataa Lataa Liikkujan kasvisruokavalio - Jussi Riekki Lataa Kirjailija: Jussi Riekki ISBN: 9789527196106 Sivumäärä: 192 Formaatti: PDF Tiedoston koko: 28.72 Mb Kirja kaikille, jotka haluavat syödä vastuullisesti

Lisätiedot

Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen

Lisätiedot

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does

Lisätiedot

Tärkeiden selittävien tekijöiden ja ryhmien etsintä potilasrekistereistä

Tärkeiden selittävien tekijöiden ja ryhmien etsintä potilasrekistereistä Tärkeiden selittävien tekijöiden ja ryhmien etsintä potilasrekistereistä Loppuseminaari: Terveydenhuollon uudet analyysimenetelmät (TERANA) Elina Parviainen AB HELSINKI UNIVERSITY OF TECHNOLOGY Department

Lisätiedot

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset EU:ssa ei ole yleisesti hyväksyttyä elintarvikepetosten määritelmää. Yleinen ohjeistus löytyy elintarvikelainsäädäntöä

Lisätiedot

Tunnista lajit ja logot

Tunnista lajit ja logot Tunnista lajit ja logot Tehtävässä testataan kuinka monta lähiympäristön eläin- tai kasviasukasta oppilaat tuntevat. Tarkoituksena on sen jälkeen miettiä, miksi näistä (ja muista) lajeista on syytä välittää.

Lisätiedot

Lataa Virus - Matti Jalasvuori. Lataa

Lataa Virus - Matti Jalasvuori. Lataa Lataa Virus - Matti Jalasvuori Lataa Kirjailija: Matti Jalasvuori ISBN: 9789522911667 Sivumäärä: 187 Formaatti: PDF Tiedoston koko: 39.86 Mb Mikä virus oikeastaan on? Miksi käytämme samaa termiä niin Iranin

Lisätiedot

Hyvä käyttäjä! Ystävällisin terveisin. Toimitus

Hyvä käyttäjä! Ystävällisin terveisin. Toimitus Hyvä käyttäjä! Tämä pdf-tiedosto on ladattu Tieteen Kuvalehden verkkosivuilta (www.tieteenkuvalehti.com). Tiedosto on tarkoitettu henkilökohtaiseen käyttöön, eikä sitä saa luovuttaa kolmannelle osapuolelle.

Lisätiedot

Terveyserot Pohjois-Pohjanmaalla 28.10.2009 Jukka Murto

Terveyserot Pohjois-Pohjanmaalla 28.10.2009 Jukka Murto Terveyserot Pohjois-Pohjanmaalla 28.10.2009 Jukka Murto 1 Koulutusryhmien väliset erot koetussa terveydessä Pohjois-Pohjanmaalla naisilla hieman suuremmat ja miehillä pienemmät kuin koko Suomessa Terveytensä

Lisätiedot

RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA

RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA Johanna Mattson dosentti ylilääkäri, vs. toimialajohtaja HYKS Syöpäkeskus 28.11.2016 1 RINTASYÖPÄ SUOMESSA 5008 uutta tapausta vuonna 2014 Paikallinen rintasyöpä

Lisätiedot

Suomen metsäbiotalouden tulevaisuus

Suomen metsäbiotalouden tulevaisuus Suomen metsäbiotalouden tulevaisuus Puumarkkinapäivät Reima Sutinen Työ- ja elinkeinoministeriö www.biotalous.fi Biotalous on talouden seuraava aalto BKT ja Hyvinvointi Fossiilitalous Luontaistalous Biotalous:

Lisätiedot

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia

Lisätiedot

EUROOPAN UNIONIN NEUVOSTO. Bryssel, 6. kesäkuuta 2005 (13.06) (OR. en) 9803/05 SAN 99

EUROOPAN UNIONIN NEUVOSTO. Bryssel, 6. kesäkuuta 2005 (13.06) (OR. en) 9803/05 SAN 99 EUROOPAN UNIONIN NEUVOSTO Bryssel, 6. kesäkuuta 2005 (13.06) (OR. en) 9803/05 SAN 99 SAATE Lähettäjä: Pääsihteeristö Vastaanottaja: Valtuuskunnat Ed. asiak. nro: 9181/05 SAN 67 Asia: Neuvoston päätelmät

Lisätiedot

Lataa Terve tuki- ja liikuntaelimistö. Lataa

Lataa Terve tuki- ja liikuntaelimistö. Lataa Lataa Terve tuki- ja liikuntaelimistö Lataa ISBN: 9789522453617 Sivumäärä: 149 Formaatti: PDF Tiedoston koko: 24.75 Mb Tuki- ja liikuntaelinten sairaudet ovat kallis ja kasvava kansanterveysongelma. Yhteiskunnalle

Lisätiedot

KEESHONDIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,

Lisätiedot

Perustietoa hankkeesta / Basic facts about the project. Koulutuksen järjestäjät oppilaitoksineen. Oppilaitokset Suomessa: Partners in Finland:

Perustietoa hankkeesta / Basic facts about the project. Koulutuksen järjestäjät oppilaitoksineen. Oppilaitokset Suomessa: Partners in Finland: Perustietoa hankkeesta / Basic facts about the project Kam oon China- verkostoon kuuluu kaksitoista (12) koulutuksen järjestäjää eri puolilta Suomea. Verkosto on perustettu 1998 alkaen. Hankkeen hallinnoijana

Lisätiedot

Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä?

Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Antti Latvala Sosiaalilääketieteen päivät 28.11.2012 Esityksen teemat Miksi ja miten huomioida geneettisten

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta

BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja

Lisätiedot

Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä

Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä Huippuyksikköseminaari 12.11.2013 Leena Vähäkylä Menestystarinat Akatemian viestinnässä Akatemian pitkäjänteinen rahoitus laadukkaaseen tutkimukseen näkyy rahoitettujen ja menestyneiden tutkijoiden tutkijanurasta

Lisätiedot

Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi

Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi 19.05.2014 DNA:n sekvensointi DNA:n pilkotaan lyhyiksi mallipalasiksi, templaateiksi, joiden emäsjärjestys selvitetään.

Lisätiedot

Korkeakoulutus ja tutkimus terveyden edistämisen tukena. Helsinki, 28.01.2009 Peruspalveluministeri Paula Risikko

Korkeakoulutus ja tutkimus terveyden edistämisen tukena. Helsinki, 28.01.2009 Peruspalveluministeri Paula Risikko Korkeakoulutus ja tutkimus terveyden edistämisen tukena Helsinki, 28.01.2009 Peruspalveluministeri Paula Risikko Tilanne nyt Kaikkien väestöryhmien hyvinvointi ja terveydentila parantunut: Parempi kuin

Lisätiedot

POHJOIS-POHJANMAAN SAIRAANHOITOPIIRI. Pohjois-Pohjanmaan sairaanhoitopiiri Terveyden edistäminen

POHJOIS-POHJANMAAN SAIRAANHOITOPIIRI. Pohjois-Pohjanmaan sairaanhoitopiiri Terveyden edistäminen POHJOIS-POHJANMAAN SAIRAANHOITOPIIRI Pohjois-Pohjanmaan sairaanhoitopiiri Terveyden edistäminen MIKSI PPSHP PANOSTAA TERVEYDEN EDISTÄMISEEN? Sairastavuutemme on korkea maakunnassamme on terveyseroja palvelujen

Lisätiedot

Monitekijäisten tautien genetiikka

Monitekijäisten tautien genetiikka Juha Kere, Samuli Ripatti ja Markus Perola TEEMA: LEENA PELTONEN-PALOTIE Monitekijäisten tautien genetiikka Monitekijäisillä taudeilla tarkoitetaan sellaisia, paljolti tavallisia tauteja, joiden syntyyn

Lisätiedot

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 2. Solun perusrakenne

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 2. Solun perusrakenne Solun perusrakenne I Solun perusrakenne 2. Solun perusrakenne 1. Avainsanat 2. Kaikille soluille yhteiset piirteet 3. Kasvisolun rakenne 4. Eläinsolun rakenne 5. Sienisolun rakenne 6. Bakteerisolun rakenne

Lisätiedot

Uusien elintarvikebioprosessien kehitys, sivuvirtojen hyödyntäminen, elintarviketurvallisuus ja ravitsemus

Uusien elintarvikebioprosessien kehitys, sivuvirtojen hyödyntäminen, elintarviketurvallisuus ja ravitsemus Uusien elintarvikebioprosessien kehitys, sivuvirtojen hyödyntäminen, elintarviketurvallisuus ja ravitsemus Riitta Laitinen, ryhmäpäällikkö Uudet tuotteet, palvelut ja teknologia-ryhmä Kokkola Material

Lisätiedot

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus

Lisätiedot

Olen saanut tyypin 2 diabeteksen. Kysymyksiä ja vastauksia. Kysymyksiä ja mietteitä. Jos haluat saada lisätietoja, ota yhteyttä

Olen saanut tyypin 2 diabeteksen. Kysymyksiä ja vastauksia. Kysymyksiä ja mietteitä. Jos haluat saada lisätietoja, ota yhteyttä Kysymyksiä ja mietteitä Jos haluat saada lisätietoja, ota yhteyttä Sairaalaan/terveyskeskukseen puh: Diabetessairaanhoitajaan puh: Diabeteslääkäriin puh: Esite julkaistaan Bayer Health Care -yrityksen

Lisätiedot

Matkalle PUHTAAMPAAN. maailmaan UPM BIOPOLTTOAINEET

Matkalle PUHTAAMPAAN. maailmaan UPM BIOPOLTTOAINEET Matkalle PUHTAAMPAAN maailmaan UPM BIOPOLTTOAINEET NYT TEHDÄÄN TEOLLISTA HISTORIAA Olet todistamassa ainutlaatuista tapahtumaa teollisuushistoriassa. Maailman ensimmäinen kaupallinen biojalostamo valmistaa

Lisätiedot

ETÄLUENNALLA ENERGIATEHOKKAAMMAKSI

ETÄLUENNALLA ENERGIATEHOKKAAMMAKSI ETÄLUENNALLA ENERGIATEHOKKAAMMAKSI Energianeuvontailta 1 Energia-alan energiatehokkuusopimus Keravan Energia -yhtiöt liittyivät energiatehokkuussopimukseen huhtikuussa 2008 Energian tuotanto, siirto ja

Lisätiedot

BIOS 1 ja OPS 2016 OPS Biologian opetussuunnitelma Opetuksen tavoitteet

BIOS 1 ja OPS 2016 OPS Biologian opetussuunnitelma Opetuksen tavoitteet BIOS 1 ja OPS 2016 Biologian opetussuunnitelma 2016 Biologian opetuksen tehtävänä on tukea opiskelijan luonnontieteellisen ajattelun kehittymistä. Opetus lisää ymmärrystä biologian merkityksestä osana

Lisätiedot