DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

Koko: px
Aloita esitys sivulta:

Download "DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia"

Transkriptio

1 DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1

2 Sisältö DNA:n rakenne DNA:n kahdentuminen Geenien ilmentyminen: transkriptio Genomin muuntuminen ja virheiden korjaus 2

3 Kirjallisuus Heino, Vuento: Biokemian ja solubiologian perusteet 2. painos Luku 2 Biomolekyylit s ja luku 6 (Genomin rakenne ja geenien ilmentyminen) Alberts: Molecular biology of The Cell, luvut 4 ja 5 3

4 DNA:N RAKENNE 4

5 DNA:n rakenne nukleotidit sokeri (deoksiriboosi) emäs (adeniini, tymiini, sytosiini ja guaniini) Fosfaattiryhmä(t) Esim. ATP, TTP, CTP, GTP sallitut emäsparit A-T: kaksi vetysidosta G-C: kolme vetysidosta DNA on kaksoisjuoste, jossa suosteet ovat aina vastakkaissuuntaiset 5 -pää: vapaa fosfaatti 3 -pää: vapaa OH ryhmä

6 DNA on makromolekyyli Yhden eukaryoottisolun tumassa on DNA:ta noin 1,8 metriä Eukaryoottien DNA on jakautunut kromosomeihin (bakteereissa yleensä yksi rengasmainen) 6

7 Ihmisen perimässä on kolme miljardia emäsparia Diploidien solujen tumassa 46 kromosomiparia, joista 22 somaattista paria ja kaksi sukukromosomia (joko XX tai XY). Merkitään 44+x,y tai 46, XY. Haploidien sukusolujen tumassa 23 kromosomia. Ihmisen (haploidin) genomin koko on n. 3 x 10 9 emäsparia. Mitokondioissa (ja kasvien kloroplasteissa) on oma DNA, joka on rengasmainen ja muistuttaa bakteerien kromosomeja. Nisäkkäillä mitokondrio-dna:n koko on n emäsparia (alle 0.001% genomista) Figure 4-11 Molecular Biology of the Cell ( Garland Science 2008)

8 DNA pakkautuu 8

9 REPLIKAATIO 9

10 Eukaryoottisolun perimä sijaitsee (pääosin) tumassa perimä, perintöaines, genomi 1.(suppea merkitys:) haploidisen kromosomiston kaikki perintötekijät 2.(laaja merkitys:) diploidisen solun perintötekijät, jotka koostuvat äidiltä periytyneistä ja isältä periytyneistä tuman perintötekijöistä sekä mitokondrioiden perintötekijöistä 10

11 Tuman kromosomit kahdentuvat ennen mitoosia Figure fig. from ch. 17, 5 and 4 Molecular Biology of the Cell ( Garland Science 2008)

12 Kromosomien DNA kahdentuu Kumpikin juoste kopioidaan Emäspariutumisen yksikäsitteisyyden johdosta kopioituva juoste on identtinen templaatin alkuperäisen vastinjuosteen kanssa Uusissa DNAmolekyyleissä on yksi vanha ja yksi vastasyntetisoitu juoste semikonservatiivisesti 12

13 Replikaatio etenee aloituskohdasta molempiin suuntiin Eukaryooteissa replikaatiolla on kromosomissa monta aloituskohtaa (bakteereilla yksi), joista kahdentaminen etenee molempiin suuntiin kunnes replikaatiohaarukat kohtaavat 13

14 DNA:n replikaatio 14 Figure 5-19a Molecular Biology of the Cell ( Garland Science 2008)

15 GEENIEN ILMENTYMINEN 15

16 Geeni on. Klassinen määritelmä: Yksi geeni = yksi entsyymi geeni, gene [ge'ne],{e}, gen -en arvsanlag -en ärfligt anlag {r} (<< ge'nos {kr} syntyperä) perintötekijä DNA:n (joillakin viruksilla RNA:n) jakso, joka riittää yhden spesifisen polypeptidin koodittamiseen (MOT Lääketiede 2.0) A DNA segment that contributes to phenotype/function. (HUGO Gene Nomenclature committee) 16

17 Geeni = perimän jakso joka koodaa toiminnallisen molekyylin Proteiini (rakenneproteiinit ja entsyymit) RNA-molekyyli, joka osallistuu solun toimintaan (lähetti-rna, ribosomaalinen RNA, snrna, sno-rna) RNA-molekyyli, joka katalysoi reaktioita (ribozyymi) RNA-molekyyli, joka säätelee geenien ilmentymistä (mikro-rna) 17

18 Geenien arvioitu lukumäärä eri lajeissa (2004) Pallokala Lituruoho Hiiri Ihminen Seeprakala Sukkulamato Banaanikärpänen Hiiva

19 ENCODE projekti (2012) Ihmisen genomissa proteiineja koodaavia geenejä Tämän lisäksi 8800 lyhyitä ja 9640 pitkiä ei-koodaavia RNA-molekyylejä koodaavaa aluetta >80% genomista toiminnallista 19

20 Eri soluissa on samat geenit, ilmentyminen määrää fenotyypin Kussakin solutyypissä ilmentyy vain osa genomin sisältämistä geeneistä. Osa on kullekin solutyypille ominaisia, osa kaikille soluille yhteisiä. Erilaistuneissa soluissa osa geeneistä on hiljennetty epigeneettisin mekanismein, jotka säätelevät esim. DNA:n pakkautumista. Epigeneettinen säätely periytyy tytärsoluille. 20 (Duodecim Terveyskirjasto)

21 TRANSKRIPTIO 21

22 Transkriptiossa koodaavan juosteen informaatio kopiodaan RNA:han RNA-nukleotidit valitaan muodostamalla emäspareja templaatin DNA-nukleotidien kanssa Tymiinin tilalla RNA:ssa urasiili Figure 6-7 Molecular Biology of the Cell ( Garland Science 2008) 22

23 Lähetti-RNA välittää DNA-tiedon proteiinisynteesiin 23

24 Geenien ilmentyminen 24 Figure 6-21b Molecular Biology of the Cell ( Garland Science 2008)

25 Lähetti-RNA:n muokkaus ja Geenin ilmentymistä säätelevät geeniaktivaattorit (transkriptiotekijät), jotka käynnistävät transkription. Intronit poistetaan RNA-kopiosta silmukoimalla. Vaihtoehtoisella silmukoinnilla voidaan tuottaa erilaisia lähetti-rna-molekyylejä -> erilaiset proteiinituotteet ilmentymisen säätely (eukaryootit) Mikro-RNA molekyylit estävät toisten geenien ilmentymistä mirna Figure 6-21a Molecular Biology of the Cell ( Garland Science 2008) 25

26 Transkription aktivointi Aktivaattorit sitoutuvat säätelyalueille Mediaattori välittää tiedon transkription aloituskoneistolle DNA:n pakkausta pitää löyhentää (histoniasetylaasit ja muut histoneja muokkaavat entsyymit, kromatiininmuokkauskompleksit Aktivointiin voivat vaikuttaa esim. solun energiatila tai solun ulkopuoliset viestit (esim. hormonit) Figure 6-19 Molecular Biology of the Cell ( Garland Science 2008)

27 PERIMÄN MUUNTUMINEN 27

28 Miten perimä muuntuu ja miten sitä pyritään estämään DNA:n kahdentumisessa syntyy virheitä DNA:han tulee vaurioita sekä elimistön oman toiminnan että ympäristön vaikutuksesta vesimolekyylien liike aineenvaihduntatuotteet mutageenit säteily Vain n. 1/1000 vauriosta johtaa pysyvään muutokseen. DNA:n korjausmekanismit pyrkivät korjaamaan muutokset 28

29 Replikaatiovirheiden korjaus Virheitä / genomi DNA-polymeraasi tarkistaa jälkensä : 3 5 eksonukleaasiaktiivisuus Jonkin aikaa replikaation jälkeen voidaan yhteensopimattomista emäksistä päätellä kumpi on uusi (= virheellinen) ja vaihtaa se oikeaan Table 5-1 Molecular Biology of the Cell ( Garland Science 2008)

30 Esimerkki: UV-säteily aiheuttaa vierekkäisten emästen välille virheellisiä sidoksia Virheellinen sidos aiheuttaa mutkan kaksoiskierteen rakenteessa Mutka tunnistetaan juoste katkaistaan vauriokohdan molemmin puolin ja aukko täytetään (nukleotidienpoistokorjaus) 30

31 DNA:han kuulumattomat rakenteet voidaan tunnistaa Figures 5-48a and 5-50a Molecular Biology of the Cell ( Garland Science 2008)

32 Metyylisytosiinista tulee tymiini Geenien aktiivisuutta säädellään mm. metyloimalla sytosiineja erukaryoottien DNA:ssa paljon metyylisytosiineja 5-metyylisytosiinin deaminaatio tymiini: DNA:N LUONNOLLINEN EMÄS Alkuperäinen G-C pari voi muuttua A-T pariksi korjausmekanismien avulla Noin 1/3 tauteja aiheuttavista pistemutaatioista on tämän mekanismin kautta syntyneitä Figure 5-50b Molecular Biology of the Cell ( Garland Science 2008)

33 Virheiden vaikutus Pistemutaatio eksonissa Muutokset aminohapposekvenssissä Uusi lopetuskodoni -> lyhentynyt proteiini Hiljaiset mutaatiot: aminohapposekvenssi ei muutu Pistemutaatio intronissa: eksoni-intronirajojen muutokset Säätelyalueiden mutaatiot (voivat olla myös introneissa) muutokset geenin ilmentymisessä Insertiot ja deleetiot aminohappojärjestys muuttuu toimimaton tuote (yl.) geenituotteen puute 33

34 Syövän kehittyminen Solun muuttuminen pahanlaatuiseksi vaatii useiden uusien ominaisuuksien kehittymistä ja useiden mutaatioiden kertymistä samaan soluun. Siksi syövän yleisyys lisääntyy väestön vanhetessa. Hanahan D, Weinberg RA: Hallmarks of Cancer: The Next Generation Cell 144(5), 2011,

35 Mutaatioiden merkitys Evoluutio uusia alleeleja (ABOveriryhmäantigeenit) ja uusia ominaisuuksia (lajiutuminen) Hyödyllisiä ominaisuuksia laktoosin sieto! Mutta myös sairauksia Perinnölliset taudit (mutaatiot sukusoluissa) Somaattisten solujen mutaatiot -> syöpä Suomalainen tautiperintö: meillä yleisiä peittyvästi periytyviä mutaatioita Korjausmekanismien virheet aiheuttavat perinnöllisen syöpäalttiuden (esim. Xeroderma pigmentosum)

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri

Lisätiedot

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,

Lisätiedot

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä

Lisätiedot

SÄTEILYN TERVEYSVAIKUTUKSET

SÄTEILYN TERVEYSVAIKUTUKSET SÄTEILYN TERVEYSVAIKUTUKSET 25 Säteily- ja ydinturvallisuus -kirjasarjan toimituskunta: Sisko Salomaa, Wendla Paile, Tarja K. Ikäheimonen, Roy Pöllänen, Anne Weltner, Olavi Pukkila, Jorma Sandberg, Heidi

Lisätiedot

Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa

Lisätiedot

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 BIOLÄÄKETIETEEN Henkilötunnus: - KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 Kirjoita selvästi nimesi ja muut henkilötietosi niille varattuun

Lisätiedot

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Seoksen komponentit voidaan erotella toisistaan kromatografisilla menetelmillä. Mihin kromatografiset menetelmät perustuvat? (2p) Menetelmät perustuvat seoksen osasten erilaiseen sitoutumiseen paikallaan

Lisätiedot

NON-CODING RNA (ncrna)

NON-CODING RNA (ncrna) NON-CODING RNA (ncrna) 1. Yleistä NcRNA eli non-coding RNA tarkoittaa kaikkia proteiinia koodaamattomia rnamolekyylejä. Näistä yleisimmin tunnetut ovat ribosomaalinen RNA (rrna) sekä siirtäjä-rna (trna),

Lisätiedot

Nimi sosiaaliturvatunnus

Nimi sosiaaliturvatunnus Valintakoe 2013 / Biokemia Nimi sosiaaliturvatunnus 1. Selitä: (3,0 p) a) Mitä ovat eksonit ja intronit ja miten ne eroavat toisistaan? b) Mitä eläinsolulle tapahtuu, jos se laitetaan sen sisällä olevaa

Lisätiedot

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu

Lisätiedot

465 E MOLEKYYLIBIOLOGIAA

465 E MOLEKYYLIBIOLOGIAA 465 E MOLEKYYLIBIOLOGIAA 466 E1 Geneettinen koodi elämän yhteinen kieli Latvala Juho & Seppälä Mika Solu-ja kehitysbiologian kurssin kirjoitelma Anatomian ja solubiologian laitos, Oulun yliopisto 12.9.2009

Lisätiedot

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.

Lisätiedot

DNA, RNA ja proteiinirakenteen ennustaminen

DNA, RNA ja proteiinirakenteen ennustaminen S-114.500 Solubiosysteemien perusteet Harjoitustyö Syksy 2003 DNA, RNA ja proteiinirakenteen ennustaminen Ilpo Tertsonen, 58152p Jaakko Niemi, 55114s Sisällysluettelo 1. Alkusanat... 3 2. Johdanto... 4

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna Ihmisen keho muodostuu miljardeista soluista. Vaikka nämä solut ovat tietyssä mielessä meidän omiamme, ne polveutuvat itsenäisistä yksisoluisista elämänmuodoista, jotka ovat säilyttäneet monia itsenäisen

Lisätiedot

Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1 1) Tunnista molekyylit (1 piste) ja täytä seuraava taulukko (2 pistettä) a) b) c) d) a) Syklinen AMP (camp) (0.25) b) Beta-karoteeni (0.25 p) c) Sakkaroosi (0.25 p) d) -D-Glukopyranoosi (0.25 p) 2 Taulukko.

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi

Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Tehtävä 1: Solusykli, 0 9 p. Etsi oppikirjasta (ainakin Lehningeristä ja Albertsista löytyy) tai verkosta kuva solusyklistä (cell

Lisätiedot

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,

Lisätiedot

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow Genomi Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta Hannu Sariola, Irma Thesleff ja Marja Makarow Malliorganismeiksi kutsutaan lajeja, joita tutkijat käyttävät

Lisätiedot

EUROOPAN PARLAMENTTI

EUROOPAN PARLAMENTTI EUROOPAN PARLAMENTTI 1999 2004 Ihmisgenetiikkaa ja nykylääketieteen muita uusia tekniikoita käsittelevä väliaikainen valiokunta VÄLIAIKAINEN 26. heinäkuuta 2001 Par2 KERTOMUSLUONNOS Ihmisgenetiikan sosiaaliset,

Lisätiedot

Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa

Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Susan Thorpe-Vargas Ph.D., John Cargill MA, MBA, MS, D. Caroline Coile, Ph.D. Käännös Inkeri Kangasvuo Koskaan ei ehkä

Lisätiedot

SÄTEILYN GENEETTISET VAIKUTUKSET

SÄTEILYN GENEETTISET VAIKUTUKSET 8 SÄTEILYN GENEETTISET VAIKUTUKSET Sisko Salomaa SISÄLLYSLUETTELO 8.1 Ihmisen perinnölliset sairaudet... 122 8.2 Perinnöllisten sairauksien taustailmaantuvuus... 125 8.3 Perinnöllisen riskin arviointi...

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 12 X-kromosominen periytyminen TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 FOLKHÄLSANS GENETISKA KLINIK PB 211, (Topeliusgatan 20) 00251 Helsingfors tel (09)

Lisätiedot

ELÄMÄN MÄÄRITTELEMINEN. LUENTO 1 Kyösti Ryynänen Seutuviikko 2014, Jämsä MITÄ ELÄMÄ ON? EI-ELÄVÄ LUONTO ELÄVÄ LUONTO PAUL DAVIES 26.3.

ELÄMÄN MÄÄRITTELEMINEN. LUENTO 1 Kyösti Ryynänen Seutuviikko 2014, Jämsä MITÄ ELÄMÄ ON? EI-ELÄVÄ LUONTO ELÄVÄ LUONTO PAUL DAVIES 26.3. LUENTO 1 Kyösti Ryynänen Seutuviikko 2014, Jämsä MITEN ELÄMÄÄ VOIDAAN MÄÄRITELLÄ? MAA-ELÄMÄN RAKENNUSSARJAN SISÄLTÖ 1 ELÄMÄN MÄÄRITTELEMINEN ASTROBIOLOGIA TARVITSEE JA EDELLYTTÄÄ KOSMOLOGISTA JA UNIVERSAALIA

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

KEESHONDIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,

Lisätiedot

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyvaikutuksen synty Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyn ja biologisen materian vuorovaikutus Koska ihmisestä 70% on vettä, todennäköisin (ja tärkein) säteilyn ja biologisen

Lisätiedot

Huhtikuun 14. päivänä tänä vuonna julistettiin

Huhtikuun 14. päivänä tänä vuonna julistettiin Katsaus Märkäisistä haavasiteistä yksilön genomiin Tiina Immonen ja Hannu Sariola Vuotta 2003 juhlittiin DN:n juhlavuotena ympäri maailmaa. Tähän antoi aiheen ihmisen genomi -hankkeen loppuun saattaminen

Lisätiedot

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä

Lisätiedot

*2,3,4,5 *1,2,3,4,5. Helsingin yliopisto. hakukohde. Sukunimi. Tampereen yliopisto. Etunimet. Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30. Tehtävä 1.

*2,3,4,5 *1,2,3,4,5. Helsingin yliopisto. hakukohde. Sukunimi. Tampereen yliopisto. Etunimet. Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30. Tehtävä 1. Helsingin yliopisto Molekyylibiotieteiden hakukohde Tampereen yliopisto Bioteknologian hakukohde Henkilötunnus - Sukunimi (myös entinen) Etunimet Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30 Tehtävä 1.

Lisätiedot

Solun kemiallinen peruskoostumus eläinsolu. Solun kemia. Solun kemiallinen peruskoostumus bakteerisolu. Vesi 1

Solun kemiallinen peruskoostumus eläinsolu. Solun kemia. Solun kemiallinen peruskoostumus bakteerisolu. Vesi 1 Solun kemiallinen peruskoostumus eläinsolu Solun kemia paino-% Vesi 75-90 proteiinit 10-20 Lipidit 2 Hiilihydraatit 1 RNA/DNA 0,7/0,4 Epäorg. 1,5 Solun kemiallinen peruskoostumus bakteerisolu Vesi 1 paino-%

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki

Lisätiedot

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =

Lisätiedot

? LUCA (Last universal common ancestor) 3.5 miljardia v.

? LUCA (Last universal common ancestor) 3.5 miljardia v. Mitä elämä on? - Geneettinen ohjelma, joka kykenee muuttamaan ainehiukkaset ja molekyylit järjestyneeksi itseään replikoivaksi kokonaisuudeksi. (= geneettistä antientropiaa) ? LUCA (Last universal common

Lisätiedot

-1- Ota henkilötodistus mukaasi jättäessäsi vastauspaperin. Kysymyksiin voi vastata suomeksi, ruotsiksi tai englanniksi.

-1- Ota henkilötodistus mukaasi jättäessäsi vastauspaperin. Kysymyksiin voi vastata suomeksi, ruotsiksi tai englanniksi. Oulun yliopiston biokemian koulutusohjelman valintakoe 21.5.2014 Nimi: Henkilötunnus: Ota henkilötodistus mukaasi jättäessäsi vastauspaperin. Kysymyksiin voi vastata suomeksi, ruotsiksi tai englanniksi.

Lisätiedot

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan

Lisätiedot

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008 16 Kromosomimuutokset Huhtikuussa 2008 Tätä työtä tuki EuroGentest, joka on Euroopan yhteisön tutkimuksen kuudennen puiteohjelman rahoittama verkosto. Kääntänyt Tiina Lund-Aho yhteistyössä Väestöliiton

Lisätiedot

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut Hemopoiesis Tuma Mitochondrion Tuma 2 Flagellum Peroxisome Centrioles Microfilaments Microtubules Nuclear envelope Rough endoplasmic reticulum Ribosomes NUCLEUS muoto: pallomainen liuskoittunut (esim.

Lisätiedot

Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.

Lisätiedot

KEMIA 25.3.2011 lyhennettyjä ratkaisuja. 1. a) Vesiliukoisia: B, C, D, F, G

KEMIA 25.3.2011 lyhennettyjä ratkaisuja. 1. a) Vesiliukoisia: B, C, D, F, G KEMIA 25.3.2011 lyhennettyjä ratkaisuja 1. a) Vesiliukoisia: B,, D, F, G b) Ioniyhdisteitä: B,, F c) Happamia: d) Hiilitabletti on erittäin hienojakoista hiiltä (aktiivihiiltä). Suuren pinta alansa johdosta

Lisätiedot

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun

Lisätiedot

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Periytyvyys ja sen matematiikka

Periytyvyys ja sen matematiikka Periytyvyys ja sen matematiikka 30.7.2001 Katariina Mäki MMM,tutkija Helsingin yliopisto, Kotieläintieteen laitos / kotieläinten jalostustiede katariina.maki@animal.helsinki.fi Jalostuksen tavoitteena

Lisätiedot

Solujen viestintäjärjestelmät. Katri Koli, Solu- ja molekyylibiologian dosentti Helsingin Yliopisto 16.04.2014

Solujen viestintäjärjestelmät. Katri Koli, Solu- ja molekyylibiologian dosentti Helsingin Yliopisto 16.04.2014 Solujen viestintäjärjestelmät Katri Koli, Solu- ja molekyylibiologian dosentti Helsingin Yliopisto 16.04.2014 Solujen kasvu Geneettinen koodi Liukoiset viestimolekyylit Kontakti ympäristöön Kantasolut

Lisätiedot

x _ Miksi elinikä ei ole rajaton? Mediterranean fruitfly (Ceratitis capitata) Eliniän jakautuma

x _ Miksi elinikä ei ole rajaton? Mediterranean fruitfly (Ceratitis capitata) Eliniän jakautuma Vanhenemisen fysiologia 1 Elinikä ja vanheneminen Käsitteet Elinikä - yksilön elinikä Eliniän odotusarvo, aktuaarinen (kirjanpidollinen) elinikä - keskimääräinen odotettavissa oleva elinikä tietylle lajille,

Lisätiedot

Tuija Solismaa IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS

Tuija Solismaa IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS Tuija Solismaa IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS RAPORTIN NIMIÖSIVU IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS

Lisätiedot

ENTSYYMIKATA- LYYSIN PERUSTEET (dos. Tuomas Haltia)

ENTSYYMIKATA- LYYSIN PERUSTEET (dos. Tuomas Haltia) ENTSYYMIKATA- LYYSIN PERUSTEET (dos. Tuomas Haltia) Elämän edellytykset: Solun täytyy pystyä (a) replikoitumaan (B) katalysoimaan tarvitsemiaan reaktioita tehokkaasti ja selektiivisesti eli sillä on oltava

Lisätiedot

Epigenetiikka, geeninsäätely ja syöpä

Epigenetiikka, geeninsäätely ja syöpä Katsaus Mikko Taipale Epigenetiikka, geeninsäätely ja syöpä Geenitutkimus on totunnaisesti keskittynyt DNA:han. Kuitenkin perimän perusyksikkö kromosomi koostuu DNA:n lisäksi histoneista ja muista proteiineista,

Lisätiedot

Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

SOLUJEN RAKENTEET, ERI SOLUTYYPIT

SOLUJEN RAKENTEET, ERI SOLUTYYPIT 71 B SOLUJEN RAKENTEET, ERI SOLUTYYPIT 72 B1 Tuma miten aitotumallinen säilyttää ja käsittelee informaatiota Stenius, Hannele & Valli, Noora Solu-ja kehitysbiologian kurssin kirjoitelma Anatomian ja solubiologian

Lisätiedot

Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and

Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and Duodecim, and a textbook chapter on viral gene therapy for

Lisätiedot

Synteettinen biologia

Synteettinen biologia Synteettinen biologia Julkaisun on toimittanut biotekniikan neuvottelukunta (BTNK) Kirjoittajat: Anneli Ritala, Outi Koivistoinen, Jussi Jäntti Teknologian tutkimuskeskus VTT Marko Ahteensuu Helsingin

Lisätiedot

LAKTOOSI-INTOLERANSSIN MÄÄRITTÄMINEN RT-PCR- MENETELMÄLLÄ

LAKTOOSI-INTOLERANSSIN MÄÄRITTÄMINEN RT-PCR- MENETELMÄLLÄ OPINNÄYTETYÖ - AMMATTIKORKEAKOULUTUTKINTO SOSIAALI-, TERVEYS- JA LIIKUNTA-ALA LAKTOOSI-INTOLERANSSIN MÄÄRITTÄMINEN RT-PCR- MENETELMÄLLÄ Työohjeiden laatiminen bioanalyytikko-opiskelijoille T EKI- JÄT:

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Mitä tarkoitetaan biopolymeerilla? Mihin kolmeen ryhmään biopolymeerit voidaan jakaa? (1,5 p) Biopolymeerit ovat luonnossa esiintyviä / elävien solujen muodostamia polymeerejä / makromolekyylejä.

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien

Lisätiedot

TESTITULOSTEN YHTEENVETO

TESTITULOSTEN YHTEENVETO TESTITULOSTEN YHTEENVETO LIHASTEN VÄSYMINEN JA PALAUTUMINEN Lihaksesi eivät väsy niin helposti ja ne palautuvat nopeammin. Kehitettävä Hyvä AEROBINEN KUNTO Sinulla on edellytyksiä kasvattaa aerobista kuntoa

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

Kehitysbiologia ja histologia

Kehitysbiologia ja histologia Kehitysbiologia ja histologia Opettajat: Harjoitustyöt: Verkossa Luennot: Esa Hohtola kehitysbiologia: 5 4 h http://cc.oulu.fi/~ehohtola salasana: kbkbkb Harjoitukset: histologia: 6 4 h Yliopisto-opettaja

Lisätiedot

5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin

Lisätiedot

Laskuharjoitus 1 palautus 21. 10. 2003 mennessä Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi

Laskuharjoitus 1 palautus 21. 10. 2003 mennessä Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Laskuharjoitus 1 palautus 21. 10. 2003 mennessä Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Yleistä Kurssin maksimipistemäärä on 44. Kaikista mahdollisista pisteistä 36 on jaossa kurssin tentissä, 4

Lisätiedot

e-oppi Oy. Materiaalin käyttö sallittua vain osana e-opin oppimateriaalia ja maksettua käyttölisenssiä.

e-oppi Oy. Materiaalin käyttö sallittua vain osana e-opin oppimateriaalia ja maksettua käyttölisenssiä. LUKU1 makromolekyyli, macromolecule Suurikokoinen molekyyli, joka on usein polymeeri. Makromolekyylejä ovat proteiinit, dna ja polysakkaridit kuten selluloosa. solukalvo, cell membrane Solukalvo rajoittaa

Lisätiedot

Toivomme, että tämä sanasto auttaa osaltaan selkeyttämään bioalasta käytävää keskustelua ja viestintää.

Toivomme, että tämä sanasto auttaa osaltaan selkeyttämään bioalasta käytävää keskustelua ja viestintää. BIOSANASTO ALKUSANAT Monenlaiset uudet bio-ilmiöt ovat tulleet jäädäkseen suomalaiseen keskusteluun. Bioalan valtaisa kehitys viime vuosina on saanut niin maallikon, toimittajan kuin kokeneen tutkijankin

Lisätiedot

Bioinformatiikan sanasto

Bioinformatiikan sanasto Bioinformatiikan sanasto A A-DNA : - A-DNA B-DNA:sta dehydraation kautta syntynyt rakennemuoto, jossa on 11 emäsparia/kierre. - Katso myös: B-DNA, Z-DNA ab initio : - lat. alusta, perusteista Laskennassa

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN

JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN Anne Vaittinen Maisterintutkielma Helsingin yliopisto Maataloustieteiden laitos HEBIOT Biotekniikka

Lisätiedot

Minun valinnoillani voi olla vaikutusta lapsiini, lastenlapsiini ja vieläkin kauemmas.

Minun valinnoillani voi olla vaikutusta lapsiini, lastenlapsiini ja vieläkin kauemmas. Epigenetiikka linkittää ympäristön ja sairaudet Hankittu epigeneettinen vaurio voi periytyä yli sukupolvien, osoittavat jo useat tutkimukset. Ihmiskunnan tautikentän muutoksen selittäjää kannattaa etsiä

Lisätiedot

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa.

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa. 1 1/2011 Parkinsonin taudin perinnöllisyys Geenien ja ympäristötekijöiden vuorovaikutus sairastumisen taustalla Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla

Lisätiedot

Epigeneettiset muutokset ja genominen valinta liharotuisilla naudoilla. Maiju Pesonen

Epigeneettiset muutokset ja genominen valinta liharotuisilla naudoilla. Maiju Pesonen 111 Epigeneettiset muutokset ja genominen valinta liharotuisilla naudoilla Maiju Pesonen 111 Epigeneettiset muutokset ja genominen valinta liharotuisilla naudoilla Maiju Pesonen ISBN: 978-952-487-477-9

Lisätiedot

VASTAUS 2a: Ruusukaijasten väri

VASTAUS 2a: Ruusukaijasten väri VASTAUS 2a: Ruusukaijasten väri Merkitään: ZK= Vihreän värin aiheuttava dominoiva alleeli Zk= keltaisen värin aiheuttava resessiivinen alleeli W= W-kromosomi Keltaisen koiraan perimä ZkZk, vihreän naaraan

Lisätiedot

PROTEIINIEN MUOKKAUS JA KULJETUS

PROTEIINIEN MUOKKAUS JA KULJETUS PROTEIINIEN MUOKKAUS JA KULJETUS 1.1 Endoplasmakalvosto Endoplasmakalvosto on organelli joka sijaitsee tumakalvossa kiinni. Se on topologisesti siis yhtä tumakotelon kanssa. Se koostuu kahdesta osasta:

Lisätiedot

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten

Lisätiedot

Ihmisten erilaisuuden geneettinen perusta

Ihmisten erilaisuuden geneettinen perusta hmisten erilaisuuden geneettinen perusta etter ortin hmisen genomin tutkimus on astunut uuteen vaiheeseen kun on alettu tutkia ihmisen geneettisen monimuotoisuuden määrää ja laatua. seita tätä tutkimushanketta

Lisätiedot

RAD50:N MERKITYS PERINNÖLLISESSÄ RINTASYÖPÄALTTIUDESSA

RAD50:N MERKITYS PERINNÖLLISESSÄ RINTASYÖPÄALTTIUDESSA RAD50:N MERKITYS PERINNÖLLISESSÄ RINTASYÖPÄALTTIUDESSA Aune Aho Syventävien opintojen kirjallinen työ Tampereen yliopisto Lääketieteen yksikkö Syöpägenetiikan tutkimusryhmä Helmikuu 2014 Tampereen yliopisto

Lisätiedot

5.2.2 IGF-I / MGF... 39 5.2.3 Insuliini... 41 5.2.4 Kasvuhormoni... 41 5.2.5 Androgeenit - testosteroni... 42 5.2.6 Kortisoli... 43 5.

5.2.2 IGF-I / MGF... 39 5.2.3 Insuliini... 41 5.2.4 Kasvuhormoni... 41 5.2.5 Androgeenit - testosteroni... 42 5.2.6 Kortisoli... 43 5. HERAPROTEIININ VAIKUTUS MYOSTATIININ JA SOLUSYKLIÄ SÄÄTELEVIEN GEENIEN ILMENTYMISEEN SEKÄ NÄIDEN YHTEYS ANDROGEENEIHIN VOIMA- HARJOITUKSEN YHTEYDESSÄ IKÄÄNTYNEILLÄ MIEHILLÄ Inna Lisko Pro gradu -tutkielma

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien

Lisätiedot

842_FI. Olet mitä mummosi söi. Osa ihmisen hankkimista ominaisuuksista näyttää siirtyvän lapsille. Menevätkö evoluutio-opit uusiksi?

842_FI. Olet mitä mummosi söi. Osa ihmisen hankkimista ominaisuuksista näyttää siirtyvän lapsille. Menevätkö evoluutio-opit uusiksi? Olet mitä mummosi söi Osa ihmisen hankkimista ominaisuuksista näyttää siirtyvän lapsille. Menevätkö evoluutio-opit uusiksi? Kymmenen vuotta sitten laborato-rioista leyhähteli voitonriemua käytäviin ja

Lisätiedot

Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa

Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa Kati Rajanen & Mira Tyni Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa Metropolia Ammattikorkeakoulu Bioanalyytikko Bioanalytiikan koulutusohjelma Opinnäytetyö 6.4.03 Tiivistelmä Tekijä(t) Otsikko

Lisätiedot

SIKIÖDIAGNOSTIIKKA SUOMESSA

SIKIÖDIAGNOSTIIKKA SUOMESSA SIKIÖDIAGNOSTIIKKA SUOMESSA Geneettisten tutkimusmenetelmien kehitys Enni Loven Päivi Suorsa Opinnäytetyö Lokakuu 2011 Bioanalytiikan koulutusohjelma Tampereen ammattikorkeakoulu 2 TIIVISTELMÄ Tampereen

Lisätiedot

HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA

HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA B-DNAmut-tutkimusnimikkeellä tehdyt lähetteet Fimlab Laboratoriot Oy:n genetiikan laboratoriossa vuosina 2013 ja 2014 Olli Kemppainen Emilia

Lisätiedot

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio:

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio: -mesenkyymi-vuorovaikutukset, esimerkkinä hammas ja ihokarva elimiä muodostuu kaikista alkiokerroksista, usein epiteelin ja mesenkyymin vuorovaikutuksesta epiteeli ektodermi kumpi aloittaa elimen kehityksen:

Lisätiedot

Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa

Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa KOTIELÄINJALOSTUKSEN TIEDOTE No 82 Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa Sampo Sirkkomaa ja Matti Ojala Kotieläinten jalostustieteen laitos Helsinki 1988 Julkaistjat: Kotieläinten

Lisätiedot

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015 Katekoli-O-metyylitransferaasi ja kipu Oleg Kambur Kipu Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 1 Katekoli-O-metyylitransferaasi (COMT) proteiini tuotetaan

Lisätiedot

Ureakierron häiriöt ja rgaanishappovirtsaisuudet Lapsille

Ureakierron häiriöt ja rgaanishappovirtsaisuudet Lapsille Ureakierron häiriöt ja rgaanishappovirtsaisuudet Lapsille www.e-imd.org Mikä on ureakierron häiriö/orgaanishappovirtsaisuus? Kehomme hajottaa syömämme ruoan tuhansien kemiallisten reaktioiden avulla ja

Lisätiedot

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012

Lisätiedot

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan?

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? 2012-2013 Lasse Lensu 2 Ihmisen, eläinten ja kasvien hyvinvoinnin kannalta nykyaikaiset mittaus-,

Lisätiedot

Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme?

Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme? Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme? Riikka Kivelä, LitT Tutkijatohtori Molekyyli ja syöpäbiologian tutkimusohjelma Lääketieteellinenen

Lisätiedot

Terveyteen liittyvät geenitestit

Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Jokaisella meistä on vanhemmiltamme perittynä oma yksilöllinen geenivalikoimamme. Tämä geneettinen rakenteemme yhdessä erilaisten ympäristön

Lisätiedot