Uusia mahdollisuuksia FoundationOne CDx. keystocancer.fi

Save this PDF as:

Koko: px
Aloita esitys sivulta:

Download "Uusia mahdollisuuksia FoundationOne CDx. keystocancer.fi"

Transkriptio

1 Uusia mahdollisuuksia FoundationOne CDx keystocancer.fi FI/FMI/1810/0067 Lokakuu 2018

2 FoundationOne CDx -geeniprofilointi FoundationOne CDx on kattava geeniprofilointipalvelu, jossa tutkitaan syöpäkasvaimen DNA:ssa tapahtuneita muutoksia. Syöpä syntyy, kun ihmisen solujen DNA:ssa tapahtuu muutoksia, joita elimistö ei tunnista tai pysty korjaamaan. Näitä muutoksia voivat olla esimerkiksi DNA:n ns. pistemutaatiot, insertiot, t, kopio lukumuutokset ja geenifuusiot. PERUSTEELLINEN Tunnistaa kaikentyyppiset mutaatiot OIKEA LÄÄKE OIKEA POTILAS LAAJA Analysoi kerralla 324 geeniä FoundationOne CDx tunnistaa kaikentyyppiset mutaatiot, jotka mahdollisesti vaikuttavat syöpäkasvaimen kasvuun. FoundationOne CDx -geeniprofiloinnin tuloksena syntyy kattava raportti, jonka avulla lääkäri saa kasvaimesta arvokasta lisätietoa ja pystyy arvioimaan, sopiiko joku olemassa olevista täsmälääkehoidoista potilaan kasvaimen hoitoon. KATTAVA Antaa kasvaimesta arvokasta lisätietoa Syöpäkasvainten genomimuutostyypit Insertiot ja t Deleetioissa DNA:sta irtoaa ja poistuu yksittäistä emäsparia, DNA:n tärkeintä rakenneyksikköä, isompi osa. Insertioissa vastaavasti DNA:han tulee pätkä DNA:ta lisää. Kopiolukumuutokset Kokonaisia geenejä kopioituu perimään lisää tai poistuu kokonaan. Pistemutaatiot Yksi emäspari muuttuu toiseksi. Uudelleenjärjestäytyminen Kaksi aiemmin eri geeneissä ollutta pätkää DNA:sta liittyy yhteen, jolloin syntyy niin sanottu fuusi o geeni. Y Z ZY

3 Miten geeniprofilointi eroaa perinteisestä syövänhoidosta? Perinteinen syövänhoidossa käytetty geenitesti tunnistaa yleensä vain yhden tai kahden tyyppiset genomimuutokset. FoundationOne CDx geeniprofilointi tunnistaa useita erityyppisiä muutoksia ja pystyy löytämään mahdollisesti hoitoon vaikuttavia mutaatioita jopa 90%:sta kasvaimia. (Lähde: Schwaederle M et al. Mol Cancer Ther 2015; 14: ). Perinteinen geenitesti uudelleenjärjestäytyminen kopiolukumuutos pistemutaatio FoundationOne CDx -geeniprofilointi uudelleenjärjestäytyminen kopiolukumuutos pistemutaatio Kokemus jo :sta potilaasta Kuvasta on nähtävissä FoundationOne CDx -geeni profilointi analyysien jakaantumisen eri syöpätyyppien kesken ensimmäisten Foundation Medicinen analysoiman potilaan kohdalta. Tutkitut tapaukset sisältävät yli 55 erilaista kasvain tyyppiä. Yleisimmät syövät olivat keuhko-, rinta- ja paksusuolen syövät. Kuitenkin yksi kolmasosa kasvaimista oli harvinaisia kasvain tyyppejä. Näitä olivat esimerkiksi neuroendokriini-, sylkirauhas-, lisämunuaiskasvaimet, melanoomat, paksu suolen ulkopuoliset ruoansulatus kanavan kasvaimet ja neuroblastoomat. FoundationOne CDx geeni profiloinnin avulla myös harvinaisista syövistä saadaan lisätietoa, josta voi olla hoidon suunnittelussa apua. RAKKO MAHA ETURAUHANEN IHO MUNUAINEN PÄÄN ALUE MAKSA KOHTU HAIMA MUNASARJA FoundationOne- PROFILOINNIT SYÖPÄTYYPEITTÄIN PEHMYT- KUDOS AIVOT LUU KEUHKO RINTA PAKSUSUOLI

4 Jokainen syöpä on ainutlaatuinen miksei hoitokin? Hoitoon vaikuttavien mutaatioiden tunnistamisen kautta kohdennetuista täsmä hoidoista on saatu lupaavia tuloksia. Samalla täsmähoidot ovat muuttaneet syövän hoitoa, sillä monet tavallisetkin syövät ovat jakautuneet alatyyppeihin, joiden hoidot poikkeavat toisistaan. Esimerkiksi vuonna 2003 keuhkosyövän ajateltiin olevan yksi ja sama syöpä. Vuonna 2004 pystyttiin tunnistamaan vain 2 hoidon kannalta merkittävää geenimuutosta keuhkosyövässä. Vuonna 2016 pystyttiin tunnistamaan yli 20 hoidon kannalta mahdollisesti merkittävää geenimuutosta keuhkosyövässä, mikä on mahdollistanut keuhkosyövän yksilöllisen hoidon. Ei ole olemassa vain yhdenlaista keuhkosyöpää erilaisia keuhkosyöpiä on yhtä monta kuin potilaitakin KRAS EGFR 2004 EGFR T790M EGFR EKSONI 20 EGFR WT AMP EGFR HERKISTÄVÄ EI MUTAATIOTA 2016 MUU MARKKERI PTEN LOSS CDKN2A LOSS BRAF NON-V600E NF1 LOSS FGFR1/2 NRAS PIK3CA MAP2K1 ERBB2 MUT TSC1/2 LOSS BRCA 1/2 LOSS ERBB AMP MET AMP KRAS ALK FUUSIO MET SPLICE BRAF V600E RET FUUSIO ROS1 FUUSIO Pao ja Girard, 2011 Jordan et al Vuonna 2004 pystyttiin tunnistamaan vain 2 hoidon kannalta merkittävää geenimuutosta keuhkosyövässä. Vuonna 2016 pystyttiin tunnistamaan jo yli 20 hoidon kannalta mahdollisesti merkittävää geenimuutosta keuhkosyövässä.

5 Miksi FoundationOne CDx? Kattava tutkimus tuottaa luotettavat tulokset Tunnistaa kaikki genomin muutostyypit pistemutaatiot, insertiot ja t, kopiolukumuutokset ja fuusiot. FoundationOne CDx on kiinteiden kasvainten kattava geeni profilointipalvelu, joka on validoitu vertaisarvioidussa tieteellisessä julkaisussa. * Uusia mahdollisuuksia Perinteiset geenitestit tunnistavat yleensä vain yhden tai kahden tyyppisiä genomin muutoksia. FoundationOne CDx :n avulla on mahdollista löytää enemmän hoitovaihtoehtoja. Säästä näytettä ja aikaa Analyysin tekemiseen tarvitaan vain pieni määrä näytettä biopsiat ja ohutneulanäytteet mahdollisia tietyissä tapauksissa Tuloksena kattava raportti Lääkäri saa kasvaimesta arvokasta lisätietoa ja pystyy arvioimaan, sopiiko joku olemassa olevista täsmälääkehoidoista potilaan kasvaimen hoitoon. Lääkärisi käy tulokset kanssasi henkilökohtaisesti läpi. * Frampton GM, Fichtenholtz A, Otto GA, et al., Development and validation of a clinical cancer genomic pro ling test based on massively parallel DNA sequencing. Nat Biotechnol Oct 20.

Uusia mahdollisuuksia FoundationOne

Uusia mahdollisuuksia FoundationOne Uusia mahdollisuuksia FoundationOne FI/FMI/1703/0019 Maaliskuu 2017 FoundationOne -palvelu FoundationOne on kattava genomianalysointipalvelu, jossa tutkitaan 315 geenistä koko koodaava alue sekä 28 geenistä

Lisätiedot

BI4 IHMISEN BIOLOGIA

BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava

Lisätiedot

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS-tutkimukset lääkärin työkaluna 17.11.2016 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Mihin genetiikkaa tarvitaan? taudin patogeneesin ymmärtäminen diagnoosin varmentaminen/vahvistaminen

Lisätiedot

Molekyyligeneettiset testit syövän hoidon suuntaajina. Laura Lahtinen Molekylibiologi, FT Patologia Keski-Suomen keskussairaala

Molekyyligeneettiset testit syövän hoidon suuntaajina. Laura Lahtinen Molekylibiologi, FT Patologia Keski-Suomen keskussairaala Molekyyligeneettiset testit syövän hoidon suuntaajina Laura Lahtinen Molekylibiologi, FT Patologia Keski-Suomen keskussairaala Perinteisesti kasvaimet on luokiteltu histologian perusteella Samanlainen

Lisätiedot

RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA

RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA Johanna Mattson dosentti ylilääkäri, vs. toimialajohtaja HYKS Syöpäkeskus 28.11.2016 1 RINTASYÖPÄ SUOMESSA 5008 uutta tapausta vuonna 2014 Paikallinen rintasyöpä

Lisätiedot

Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS:n haasteet diagnostiikassa 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly

Lisätiedot

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Keuhkosyövän molekyylipatologia

Keuhkosyövän molekyylipatologia Professori Sakari Knuutila Helsingin yliopisto Keuhkosyövän molekyylipatologia Keuhkosyövän tunnuspiirteenä ovat lukuisat muutokset genomin rakenteessa ja toiminnassa. Sama ilmiö liittyy kaikkiin pitkälle

Lisätiedot

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna Ihmisen keho muodostuu miljardeista soluista. Vaikka nämä solut ovat tietyssä mielessä meidän omiamme, ne polveutuvat itsenäisistä yksisoluisista elämänmuodoista, jotka ovat säilyttäneet monia itsenäisen

Lisätiedot

Katja Aktan-Collan Alkoholi ja syöpä

Katja Aktan-Collan Alkoholi ja syöpä Katja Aktan-Collan Alkoholi ja syöpä Alkoholi ja syöpä Maarit Rautio Matti Rautalahti Alkoholin kulutus 10 l/vuodessa Suomessa ja Tanskassa 9 l/vuodessa Ruotsissa 6,5 l/vuodessa Norjassa Alkoholi on Suomessa

Lisätiedot

DNA sukututkimuksen tukena

DNA sukututkimuksen tukena Järvenpää 12,2,2019 Teuvo Ikonen teuvo.ikonen@welho.com DNA sukututkimuksen tukena DNA sukututkimuksessa (Peter Sjölund: Släktforska med DNA) tiesitkö, että olet kävelevä sukukirja? on kuin lukisit kirjaa

Lisätiedot

Hyvä käyttäjä! Ystävällisin terveisin. Toimitus

Hyvä käyttäjä! Ystävällisin terveisin. Toimitus Hyvä käyttäjä! Tämä pdf-tiedosto on ladattu Tieteen Kuvalehden verkkosivuilta (www.tieteenkuvalehti.com). Tiedosto on tarkoitettu henkilökohtaiseen käyttöön, eikä sitä saa luovuttaa kolmannelle osapuolelle.

Lisätiedot

DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen

DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen DNA-testit sukututkimuksessa 28.11.2017 Keravan kirjasto Paula Päivinen Solu tuma kromosomit 23 paria DNA Tumassa olevat kromosomit periytyvät jälkeläisille puoliksi isältä ja äidiltä Y-kromosomi periytyy

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

Muuttuva diagnostiikka avain yksilöityyn hoitoon

Muuttuva diagnostiikka avain yksilöityyn hoitoon Muuttuva diagnostiikka avain yksilöityyn hoitoon Olli Carpén, Patologian professori, Turun yliopisto ja Patologian palvelualue, TYKS-SAPA liikelaitos ChemBio Finland 2013 EGENTLIGA HOSPITAL FINLANDS DISTRICT

Lisätiedot

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA Robert Winqvist SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PROFESSORILIITON SYYSSEMINAARI TUTKIMUSTA KAIKKIEN HYÖDYKSI

Lisätiedot

- Jakautuvat kahteen selvästi erottuvaan luokkaan,

- Jakautuvat kahteen selvästi erottuvaan luokkaan, Syöpä, osa II Syöpäkriittiset geenit - Geenejä, joiden mutaatiot usein havaitaan syöpien kanssa korreloituneena - Jakautuvat kahteen selvästi erottuvaan luokkaan, - dominoiviin onkogeeneihin - resessiivisiin

Lisätiedot

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Molekyylidiagnostiikka keuhkosyövän hoidossa Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Sidonnaisuudet Taloudelliset riippuvuudet: Konsultointi: - Tutkimusrahoitus: - Honorariat:

Lisätiedot

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä

Lisätiedot

Vectibix (panitumumabi) levinneessä suolistosyövässä

Vectibix (panitumumabi) levinneessä suolistosyövässä Vectibix (panitumumabi) levinneessä suolistosyövässä Opas potilaan ohjaukseen lääkärille ja hoitajalle HOITOHENKILÖKUNNALLE Ensikäynnille Sisältö Mikä lääke Vectibix on? Miten se annostellaan? Odotettavissa

Lisätiedot

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan

Lisätiedot

Syövän synty. Esisyöpägeenit (proto-onkogeenit)

Syövän synty. Esisyöpägeenit (proto-onkogeenit) Esisyöpägeenit (proto-onkogeenit) Syövän synty 1. Säätelevät solunjakautumista ja mitoosia (solunjakaantumisen kaasupolkimia). 2. Kasvunrajoitegeenit hillitsevät solun jakaantumista tai pysäyttävät se

Lisätiedot

Tupakkalain muutos 2010

Tupakkalain muutos 2010 Tupakkalaki Tupakkalain muutos 2010 Tupakkalain muutos tuli voimaan 1.10.2010. Lain tavoitteena on tupakkatuotteiden käytön vähittäinen loppuminen. 2010 Suomessa työssään päivittäin passiivisesti tupakalle

Lisätiedot

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne

Lisätiedot

Yleispatologia Johdanto

Yleispatologia Johdanto Mitä patologia on? Yleispatologia Johdanto Jarkko Hietanen professori, LKT, HLL, M.Sc Hammaslääketieteen laitos Hammaslääketieteellinen patologia Patologia on tautioppia. Inflammaatio ja immunologiset

Lisätiedot

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten

Lisätiedot

Tutkimus Auria Biopankissa ja tulevaisuuden visiot Samu Kurki, FT, data-analyytikko

Tutkimus Auria Biopankissa ja tulevaisuuden visiot Samu Kurki, FT, data-analyytikko AURIA BIOPANKKI Tutkimus Auria Biopankissa ja tulevaisuuden visiot 8.3.2019 Samu Kurki, FT, data-analyytikko www.auria.fi Biopankkiprojektit vuosina 2014-2018 Akateemiset projektit 54% Yritysprojektit

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun

Lisätiedot

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays

Lisätiedot

Potilasesite Robottitekniikkaan perustuvaa tarkkuussädehoitoa Kuopiossa

Potilasesite Robottitekniikkaan perustuvaa tarkkuussädehoitoa Kuopiossa Potilasesite Robottitekniikkaan perustuvaa tarkkuussädehoitoa Kuopiossa 2 Tarkkuussädehoitoa Kuopion yliopistollisen sairaalan (KYS) sädehoitoyksikössä sijaitsee Pohjoismaiden ensimmäinen robottitekniikkaan

Lisätiedot

Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

6 GEENIT OHJAAVAT SOLUN TOIMINTAA nukleiinihapot DNA ja RNA Geenin rakenne Geneettinen informaatio Proteiinisynteesi

6 GEENIT OHJAAVAT SOLUN TOIMINTAA nukleiinihapot DNA ja RNA Geenin rakenne Geneettinen informaatio Proteiinisynteesi 6 GEENIT OHJAAVAT SOLUN TOIMINTAA nukleiinihapot DNA ja RNA Geenin rakenne Geneettinen informaatio Proteiinisynteesi GENEETTINEN INFORMAATIO Geeneihin pakattu informaatio ohjaa solun toimintaa ja siirtyy

Lisätiedot

Clinical impact of serum proteins on drug delivery Felix Kratz, Bakheet Elsadek Journal of Controlled Release 161 (2012)

Clinical impact of serum proteins on drug delivery Felix Kratz, Bakheet Elsadek Journal of Controlled Release 161 (2012) Clinical impact of serum proteins on drug delivery Felix Kratz, Bakheet Elsadek Journal of Controlled Release 161 (2012) 429 445 Sampo Kurvonen 25.10.2017 Sisältö Plasmaproteiineista Albumiini Transferriini

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

Syöpähoitojen kehitys haja- Pirkko Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori, ylilääkäri, TaY/TAYS 19.02.2008

Syöpähoitojen kehitys haja- Pirkko Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori, ylilääkäri, TaY/TAYS 19.02.2008 Syöpähoitojen kehitys haja- ammunnasta täsmäosumiin Pirkko Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori, ylilääkäri, TaY/TAYS 19.02.2008 Haasteet Syöpämäärien lisäys/väestön vanheminen Ennaltaehkäisy/seulonnat

Lisätiedot

Istukkagonadotropiini (hcg) - enemmän kuin raskaushormoni. Kristina Hotakainen, LT. Kliinisen kemian yksikkö Helsingin yliopisto ja HUSLAB

Istukkagonadotropiini (hcg) - enemmän kuin raskaushormoni. Kristina Hotakainen, LT. Kliinisen kemian yksikkö Helsingin yliopisto ja HUSLAB Istukkagonadotropiini (hcg) - enemmän kuin raskaushormoni Kristina Hotakainen, LT. Kliinisen kemian yksikkö Helsingin yliopisto ja HUSLAB Istukkagonadotropiini (Human Chorionic Gonadotropin, hcg) Kuuluu

Lisätiedot

Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä

Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä Pirkko-Liisa Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori/ylilääkäri, Tay/Tays 20.11.2012 Sairaalapäivät,

Lisätiedot

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne

Lisätiedot

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyvaikutuksen synty Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyn ja biologisen materian vuorovaikutus Koska ihmisestä 70% on vettä, todennäköisin (ja tärkein) säteilyn ja biologisen

Lisätiedot

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja

Lisätiedot

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki

Lisätiedot

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla 1. Avainsanat 2. Solut lisääntyvät jakautumalla 3. Dna eli deoksiribonukleiinihappo sisältää perimän

Lisätiedot

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Juha-Pekka Pursiheimo Turun Yliopisto Turku Clinical Sequencing Laboratory (TCSL) Labquality Days 2016 11.02. 2016 n. 3,3 miljardia emäsparia kliinisesti

Lisätiedot

Harvinaissairauksien diagnostiikan ja hoidon tulevaisuuden näkymiä

Harvinaissairauksien diagnostiikan ja hoidon tulevaisuuden näkymiä Harvinaissairauksien diagnostiikan ja hoidon tulevaisuuden näkymiä Helena Kääriäinen Perinnöllisyyslääkäri Tutkimusprofessori 19.10.2018 Geenitiedosta genomitietoon / Helena Kääriäinen 1 Sidonnaisuudet

Lisätiedot

Uutta lääkkeistä: Vemurafenibi

Uutta lääkkeistä: Vemurafenibi Page 1 of 5 JULKAISTU NUMEROSSA 3/2012 UUTTA LÄÄKKEISTÄ Uutta lääkkeistä: Vemurafenibi Kristiina Airola / Julkaistu 28.9.2012. Zelboraf 240 mg kalvopäällysteinen tabletti, Roche Registration Ltd. Zelboraf-valmistetta

Lisätiedot

MRI ja kohdunrunkosyövän leikkauksen suunnittelu 1 GKS. 26.09.2013 Helsinki. Arto Leminen

MRI ja kohdunrunkosyövän leikkauksen suunnittelu 1 GKS. 26.09.2013 Helsinki. Arto Leminen MRI ja kohdunrunkosyövän leikkauksen suunnittelu 1 GKS 26.09.2013 Helsinki Arto Leminen 2 Yleisimmät syövät Suomessa 2011 3 Naiset N Miehet N Rinta 4865 Eturauhanen 4719 Paksusuoli 874 Keuhko + ht 1570

Lisätiedot

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,

Lisätiedot

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän

Lisätiedot

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi Tulehduksen osuus syövän synnyssä Ari Ristimäki, professori Patologia Helsingin yliopisto esiasteissa ja useissa eri syöpäkasvaintyypeissä. 1 A Mantovani, et al. NATURE Vol 454 24 July 2008 Figure 15.22d

Lisätiedot

Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

Mutaatiot ovat muutoksia perimässä

Mutaatiot ovat muutoksia perimässä Mutaatiot ovat muutoksia perimässä Aiheuttajina mutageenit (säteily, myrkyt) myös spontaanimutaatioita, vai onko? Geenimutaatiot (syntyy uusia alleeleja) Yksittäinen emäs voi kadota tai vaihtua toiseksi.

Lisätiedot

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY T043 Liite 1.05 / Appendix 1.05 Sivu / Page 1(5) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY FIMLAB MEDICAL LABORATORIES LTD Tunnus Code Yksikkö tai toimintoala

Lisätiedot

Syöpä Esipuhe 2. 2 Syöpätilanne Ilmaantuvuus ja kuolleisuus 4. 4 Potilaiden elossaolo 13

Syöpä Esipuhe 2. 2 Syöpätilanne Ilmaantuvuus ja kuolleisuus 4. 4 Potilaiden elossaolo 13 26.11.2018 Sisältö 1 Esipuhe 2 2 Syöpätilanne 2016 3 3 Ilmaantuvuus ja kuolleisuus 4 4 Potilaiden elossaolo 13 5 Riski sairastua ja kuolla syöpään 16 6 Vallitsevuus 17 7 Taulukot 19 7.1 Ilmaantuvuus, kuolleisuus

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

Francis Crick ja James D. Watson

Francis Crick ja James D. Watson Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel-palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän

Lisätiedot

DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 -päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 -päässä vapaana sokeri

Lisätiedot

Kirurgisen leikkauspreparaatin raportointikäyt

Kirurgisen leikkauspreparaatin raportointikäyt Kirurgisen leikkauspreparaatin raportointikäyt ytännöt Heikki Aho TYKS patologia Labqualityn laaduntarkkailupäiv ivät Helsinki 5.2.2008 Raportoinnin vaatimukset Lausunnon tulee sisält ltää sellaiset tiedot,

Lisätiedot

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Perinnöllinen informaatio sijaitsee dna:ssa eli deoksiribonukleiinihapossa

Lisätiedot

ENDOMETRIOOSI JA SYÖPÄRISKI 24.9.2015. Ralf Bützow

ENDOMETRIOOSI JA SYÖPÄRISKI 24.9.2015. Ralf Bützow ENDOMETRIOOSI JA SYÖPÄRISKI 24.9.2015 Ralf Bützow HUSLAB/Naistensairaalan tutkimuslaboratorio Karsinoomat Itusolukasvaimet Sex cordstroomatuumorit ENDOMETRIOOSI 6 % (2-22%) OVARIOKARSINOOMA 1,5 % ENDOMETRIOOSI

Lisätiedot

Julkisen yhteenvedon osiot

Julkisen yhteenvedon osiot Erlotinib STADA 25 mg, 100 mg ja 150 mg kalvopäällysteiset tabletit 17.3.2017, versio V1.2 RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO VI.2 Julkisen yhteenvedon osiot VI.2.1 Tietoa sairauden esiintyvyydestä

Lisätiedot

VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen

Lisätiedot

Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.

Lisätiedot

Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016

Lisätiedot

MUNASARJAN EI- EPITELIAALISTEN MALIGNIEN KASVAINTEN KIRURGINEN HOITO

MUNASARJAN EI- EPITELIAALISTEN MALIGNIEN KASVAINTEN KIRURGINEN HOITO MUNASARJAN EI- EPITELIAALISTEN MALIGNIEN KASVAINTEN KIRURGINEN HOITO Dosentti Johanna Mäenpää Naistenklinikka TAYS JM 05 KÄSITELTÄVÄT KASVAIMET Itusolukasvaimet Stroomaperäiset kasvaimet Kasvaimet epäspesifisestä

Lisätiedot

rakko ja virtsatiet (C65 68, D09.0 1, D30.1 9, D41.1)

rakko ja virtsatiet (C65 68, D09.0 1, D30.1 9, D41.1) Syöpäpotilaiden eloonjäämisluvut alueittain Sivuilla 2 14 esitetään suhteelliset elossaololuvut yliopistollisten sairaaloiden vastuualueilla vuosina 2005 2012 todetuilla ja 2010 2012 seuratuilla potilailla

Lisätiedot

Levinneen suolistosyövän hoito

Levinneen suolistosyövän hoito Levinneen suolistosyövän hoito Yhteyshoitajakoulutus 29.9. LT ylilääkäri Pirkanmaan Syöpäyhdistys Uusien tapausten lukumäärät, yleisimpien syöpien mennyt ja ennustettu trendi, miehet Uusien tapausten lukumäärät,

Lisätiedot

Terveyteen liittyvät geenitestit

Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Jokaisella meistä on vanhemmiltamme perittynä oma yksilöllinen geenivalikoimamme. Tämä geneettinen rakenteemme yhdessä erilaisten ympäristön

Lisätiedot

Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen

Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen Solun toiminta on tarkoin säädeltyä ja monimutkaista. Solu reagoi ulkoapäin tuleviin ärsykkeisiin - kuten säteilyaltistukseen

Lisätiedot

GMO analytiikka Annikki Welling Kemian tutkimusyksikkö Evira

GMO analytiikka Annikki Welling Kemian tutkimusyksikkö Evira GMO analytiikka Annikki Welling Kemian tutkimusyksikkö Evira Millaisia GM kasvit ovat ja kuinka tätä käytetään hyväksi analytiikassa Aromaattisten aminohappojen biosynteesireitti kasvissa Kasvi tarvitsee

Lisätiedot

Suomen Syöpärekisteri Syöpätautien tilastollinen ja epidemiologinen tutkimuslaitos. Syöpäpotilaiden eloonjäämisluvut alueittain

Suomen Syöpärekisteri Syöpätautien tilastollinen ja epidemiologinen tutkimuslaitos. Syöpäpotilaiden eloonjäämisluvut alueittain Syöpäpotilaiden eloonjäämisluvut alueittain Sivuilla 2 15 esitetään ikävakioidut suhteelliset elossaololuvut yliopistollisten sairaaloiden vastuualueilla vuosina 2007 2014 todetuilla ja 2012 2014 seuratuilla

Lisätiedot

DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri

Lisätiedot

Rintasyövän perinnöllisyys

Rintasyövän perinnöllisyys Lääketieteellisen genetiikan kurssi 17.9.2012 Rintasyövän perinnöllisyys Perinnöllinen syöpäalttius - esimerkkinä rintasyöpä Kristiina Aittomäki, dos. ylilääkäri Genetiikan vastuuyksikköryhmä/huslab/hus

Lisätiedot

Hallikaisten varhaisvaiheet ja suvun DNA-tulokset Ari Kolehmainen Suku- ja historiapalvelu Menneen jäljet

Hallikaisten varhaisvaiheet ja suvun DNA-tulokset Ari Kolehmainen Suku- ja historiapalvelu Menneen jäljet Hallikaisten varhaisvaiheet ja suvun DNA-tulokset 28.7.2018 Ari Kolehmainen Suku- ja historiapalvelu Menneen jäljet Tutkijan esittely ja sukututkimustausta Suomen historian maisteri (Joensuun yliopisto

Lisätiedot

Potilasopas. 2 PL 24, 90029 OYS puh (08) 315 3218 faksi (08) 315 3105

Potilasopas. 2 PL 24, 90029 OYS puh (08) 315 3218 faksi (08) 315 3105 2 PL 24, 90029 OYS puh (08) 315 3218 faksi (08) 315 3105 Perinnöllisten Syöpien Ennakoivat Geenitutkimukset TAYS Kliinisen genetiikan yksikkö PL 2000, 33521 Tampere Perinnöllisyyspoliklinikka puh (03)

Lisätiedot

Vectibix (panitumumabi) levinneessä suolistosyövässä. Opas potilaan ohjaukseen lääkärille ja hoitajalle

Vectibix (panitumumabi) levinneessä suolistosyövässä. Opas potilaan ohjaukseen lääkärille ja hoitajalle Vectibix (panitumumabi) levinneessä suolistosyövässä Opas potilaan ohjaukseen lääkärille ja hoitajalle Vectibix (panitumumabi) levinneessä suolistosyövässä Opas potilaan ohjaukseen lääkärille ja hoitajalle

Lisätiedot

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5. Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.2016 Iina.Tuominen@tyks.fi Genetiikan tutkimukset sarkoomien diagnostiikassa

Lisätiedot

Suoritusarvot. Sample to Insight. Myöhemmät analyysit. Puhdistetun DNA:n tuotos. Versiotiedot. QIAamp DSP DNA FFPE Tissue Kit, Versio

Suoritusarvot. Sample to Insight. Myöhemmät analyysit. Puhdistetun DNA:n tuotos. Versiotiedot. QIAamp DSP DNA FFPE Tissue Kit, Versio Suoritusarvot QIAamp DSP DNA FFPE Tissue Kit, Versio 1 60404 Versiotiedot Tässä asiakirjassa on DSP DNA FFPE Tissue -pakkauksen suoritustiedot, versio 1, R3. Tarkista ennen kokeen suorittamista uusien

Lisätiedot

Lääketieteellinen Systeemibiologia

Lääketieteellinen Systeemibiologia Lääketieteellinen Systeemibiologia Sampsa Hautaniemi Biolääketieteen laitos Genomibiologian tutkimusohjelma Syöpägenetiikan tutkimuksen huippuyksikkö Luentorunko Johdanto Reduktionismin rajoitteet Systeeminen

Lisätiedot

POTILASTIEDOTE JA SUOSTUMUS GEENITESTIT Hoitavan lääkärinne pyynnöstä toteutettavat ja Genzymen tarjoamat diagnostiset testit

POTILASTIEDOTE JA SUOSTUMUS GEENITESTIT Hoitavan lääkärinne pyynnöstä toteutettavat ja Genzymen tarjoamat diagnostiset testit POTILASTIEDOTE JA SUOSTUMUS GEENITESTIT Hoitavan lääkärinne pyynnöstä toteutettavat ja Genzymen tarjoamat diagnostiset testit Johdanto Lääkärinne on todennut, että saatatte sairastaa lysosomaalista kertymäsairautta.

Lisätiedot

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008 16 Kromosomimuutokset Huhtikuussa 2008 Tätä työtä tuki EuroGentest, joka on Euroopan yhteisön tutkimuksen kuudennen puiteohjelman rahoittama verkosto. Kääntänyt Tiina Lund-Aho yhteistyössä Väestöliiton

Lisätiedot

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien molekyylidiagnostiikkaa 30.8.2013 Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien WHO-luokitus on morfologinen Gradusten I-IV ryhmittelyn perustana on toiminut ennusteen huononeminen

Lisätiedot

Farmakogeneettiset testit apuna lääkehoidon arvioinnissa

Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit Farmakogenetiikalla tarkoitetaan geneettisiä variaatioita, jotka vaikuttavat lääkeainevasteeseen. Geneettisen tiedon hyödyntäminen

Lisätiedot

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012

Lisätiedot

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015 Katekoli-O-metyylitransferaasi ja kipu Oleg Kambur Kipu Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 1 Katekoli-O-metyylitransferaasi (COMT) proteiini tuotetaan

Lisätiedot

Mustaruoste uhkaa romahduttaa maailman vehnäsadot jälleen

Mustaruoste uhkaa romahduttaa maailman vehnäsadot jälleen Mustaruoste uhkaa romahduttaa maailman vehnäsadot jälleen Ruosteenkestävät ja lyhytkortiset vehnälajikkeet...toivat "vihreän kumouksen" vehnän viljelyyn 60-luvulla: Peltonen-Sainio P. Vihreä vallankumous,

Lisätiedot

BIOLOGIAN OSIO (45 p.)

BIOLOGIAN OSIO (45 p.) BIOLÄÄKETIETEEN KOULUTUSOHJELMA PÄÄSYKOE 17.5.2017 BIOLOGIAN OSIO (45 p.) HYVÄN VASTAUKSEN PIIRTEET I) Esseetehtävät (2 kpl) a) Selitä perustellen, miten kuvaan merkittyihin kohtiin osuvat mutaatiot voivat

Lisätiedot

BIOLOGIAN OSIO (45 p.)

BIOLOGIAN OSIO (45 p.) BIOLÄÄKETIETEEN KOULUTUSOHJELMA PÄÄSYKOE 17.5.2017 BIOLOGIAN OSIO (45 p.) HYVÄN VASTAUKSEN PIIRTEET I) Esseetehtävät (2 kpl) a) Selitä perustellen, miten kuvaan merkittyihin kohtiin osuvat mutaatiot voivat

Lisätiedot

PATOLOGIA PATOLOGIAN TUTKIMUSNIMIKKEET

PATOLOGIA PATOLOGIAN TUTKIMUSNIMIKKEET PATOLOGIA Patologian nimikkeistön tarkoituksena on varmistaa, että näytettä lähetettäessä yksikäsitteisesti pyritään määrittelemään haluttu tutkimus. Nimikkeen tulee perustua näin ollen pyyntöön. Tällä

Lisätiedot

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30 Tampereen yliopisto Bioteknologian tutkinto-ohjelma Valintakoe 21.5.2015 Henkilötunnus - Sukunimi Etunimet Tehtävä 3 Pisteet / 30 3. a) Alla on lyhyt jakso dsdna:ta, joka koodaa muutaman aminohappotähteen

Lisätiedot

Perinnöllisyys 2. Enni Kaltiainen

Perinnöllisyys 2. Enni Kaltiainen Perinnöllisyys 2 Enni Kaltiainen Tunnin sisältö: Kytkeytyneiden geenien periytyminen Ihmisen perinnöllisyys Sukupuu Mutaatiot Kytkeytyneet geenit Jokainen kromosomi sisältää kymmeniä geenejä (= kytkeytyneet)

Lisätiedot

TESTITULOSTEN YHTEENVETO

TESTITULOSTEN YHTEENVETO TESTITULOSTEN YHTEENVETO LIHASTEN VÄSYMINEN JA PALAUTUMINEN Lihaksesi eivät väsy niin helposti ja ne palautuvat nopeammin. Kehitettävä Hyvä AEROBINEN KUNTO Sinulla on edellytyksiä kasvattaa aerobista kuntoa

Lisätiedot