NGS:n haasteet diagnostiikassa Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

Koko: px
Aloita esitys sivulta:

Download "NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio"

Transkriptio

1 NGS:n haasteet diagnostiikassa Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

2 Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly

3 NGS:n haasteita näytteen haastavuus logistiikan toimivuus moniammatillista (mm. bioinformaatikkojen saatavuus) sovituissa toimitusajoissa pysyminen laitteiden, analyysiohjelmien toimiminen data pilvipalvelussa oman serverin hankkiminen raakadatan pitkäaikainen ja rajallinen säilöminen tuntemattomat variantit, merkintä, kliininen merkitys ja lausuminen ituratamutaatiot lausuntojen selkokielisyys lääkäreille potilaiden pääsy lausuntoihinsa (kanta)

4 Next generation sequencing, NGS sekvensoidaan moninkertaisesti useita geenialueita useilta potilailta samanaikaisesti nopea analytiikka kohdennetut geenipaneelit, transkriptomit, eksomit, koko genomi

5 NGS-laitevertailua

6 Illuminan MiSeq vai Ion Torrentin PGM? Illumina MiSeq Ion Torrent PGM

7 Suuren kapasiteetin NGS-laitteet

8 Ion Torrent Proton eksomisekvensointi transkriptomit non-invasiivinen cfdnaanalytiikka (sikiöperäinen, kasvainperäinen) koko genomin sekvensointi

9 Ion Torrent, puolijohdetekniikka perustuu H + irtoamiseen polymeraasin liittäessä nukleotidin, mitataan ph-muutoksena

10 ph-muutos

11 NGS-vaiheiden kesto paljon tietoa yhdellä kerralla tulos jopa parissa vuorokaudessa hinta inhimillinen

12 Kirjaston tekeminen

13 Emulsio-PCR Emulsio Monistus Rikastus

14 Sekvensointi

15 Analysointi Peitto (coverage) kertoo = kuinka monta kertaa kukin emäs on sekvensoitu Herkkyys laskennallinen peiton mukaan

16 Laatukriteerit, sirun lataus hyvä %

17 Laatukriteerit, yhteenveto

18 Laatukriteerit, juosteiden lukupituus

19 Barcode-näyte-sarja

20

21

22 VariantCaller

23 VariantCaller, cosmic

24 IonReporter, filtteröinti

25 p.gly13val

26

27 NEJM, 2013

28 Mutaatiot ja niiden merkinnät c.1733_1735delatg p.asp579del c.1961t>c p.val654ala c.1799_1800deltginsaa p.val600glu

29 Väärät positiiviset homopolymeerit, >6 alukkeiden väärä sitoutuminen (katkenneet juosteet) kompleksiset variantit useita variantteja alhaisella frekvenssillä

30 21318 Ts-NGSsCA1 NGS syöpägeenipaneeli 1 kiinteiden kasvainten somaattisille muutoksille Type Name Covered Chromosome Num_Ampl Total_Bases _Bases Missed_Bases GENE PIK3CA chr GENE EGFR chr GENE KIT chr GENE KRAS chr GENE MET chr GENE NRAS chr GENE PDGFRA chr BRAF V600 chr GENOME_ REGION paneelin koko kb

31 21316 Ts-NGSsHS1 NGS hotspot syöpägeenipaneeli 1 kiinteiden kasvainten somaattisille muutoksille paneelin koko 5.69 kb Gene COSMIC Gene COSMIC Gene COSMIC ABL1 19 FGFR2 8 NRAS 35 AKT1 6 FGFR3 17 PDGFRA 26 ALK 8 FLT3 30 PIK3CA 93 APC 164 GNA11 5 PIK3CA_ENST ATM 24 GNAQ 6 PTEN 159 BRAF 77 GNAS 9 PTPN11 28 CDH1 7 GNAS_ENST RB1 18 CDKN2A 106 HNF1A 10 RET 17 CDKN2A_ENST HRAS 24 SMAD4 31 CDKN2A_ENST HRAS_ENST SMARCB1 11 CSF1R 8 IDH1 15 SMO 5 CTNNB1 73 IDH2 12 SRC 1 EGFR 123 JAK2 5 STK11 23 ERBB2 19 JAK3 6 TP ERBB4 13 KDR 11 TP53_ENST TP53_ENST0000 EZH2 7 KIT 139 EZH2_ENST KRAS TP53_ENST TP53_ENST FBXW7 13 MET 18 FBXW7_ENST MLH1 1 VHL 124 FBXW7_ENST MPL 10 FBXW7_NM_ _2 4 NOTCH1 20 Kaikki yhteensä 2855 FGFR1 2 NPM1 28

32 Lausuntomalli

33 Lausuntomalli, ei mutaatiota

34 Tunnettu mutaatio

35 Muu tunnettu mutaatio

36 Tuntematon mutaatio

37 Tulevaisuuden suunnitelmia kohdennetut paneelit kaupalliset community custom transkriptomit, RNA-pohjainen cfdna:n määrittäminen (non-invasiivinen diagnostiikka) sikiöperäinen kasvainperäinen alkiodiagnostiikka (PGD-NGS) eksomit, koko genomit

38 NGS:n haasteita näytteen haastavuus logistiikan toimivuus moniammatillista (mm. bioinformaatikkojen saatavuus) sovituissa toimitusajoissa pysyminen laitteiden, analyysiohjelmien toimiminen data pilvipalvelussa oman serverin hankkiminen raakadatan pitkäaikainen ja rajallinen säilöminen tuntemattomat variantit, merkintä, kliininen merkitys ja lausuminen ituratamutaatiot lausuntojen selkokielisyys lääkäreille potilaiden pääsy lausuntoihinsa (kanta)

39 Kiitos!

RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA

RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA Johanna Mattson dosentti ylilääkäri, vs. toimialajohtaja HYKS Syöpäkeskus 28.11.2016 1 RINTASYÖPÄ SUOMESSA 5008 uutta tapausta vuonna 2014 Paikallinen rintasyöpä

Lisätiedot

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS-tutkimukset lääkärin työkaluna Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS-tutkimukset lääkärin työkaluna 17.11.2016 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Mihin genetiikkaa tarvitaan? taudin patogeneesin ymmärtäminen diagnoosin varmentaminen/vahvistaminen

Lisätiedot

Keuhkosyövän molekyylipatologia

Keuhkosyövän molekyylipatologia Professori Sakari Knuutila Helsingin yliopisto Keuhkosyövän molekyylipatologia Keuhkosyövän tunnuspiirteenä ovat lukuisat muutokset genomin rakenteessa ja toiminnassa. Sama ilmiö liittyy kaikkiin pitkälle

Lisätiedot

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Juha-Pekka Pursiheimo Turun Yliopisto Turku Clinical Sequencing Laboratory (TCSL) Labquality Days 2016 11.02. 2016 n. 3,3 miljardia emäsparia kliinisesti

Lisätiedot

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä

Lisätiedot

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän

Lisätiedot

NIPT. Non-invasiivinen prenataalitutkimus

NIPT. Non-invasiivinen prenataalitutkimus NIPT Non-invasiivinen prenataalitutkimus Non-invasiivinen prenataalitutkimus, NIPT B -NIPT-D ATK 8598 Non-invasiivinen prenataalitutkimus B -NIPTlaa ATK 8599 Non-invasiivinen prenataalitutkimus, laaja

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Molekyylidiagnostiikka keuhkosyövän hoidossa Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Sidonnaisuudet Taloudelliset riippuvuudet: Konsultointi: - Tutkimusrahoitus: - Honorariat:

Lisätiedot

Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi

Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Annika Rökman sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Oma taustani FM genetiikka 1998 sairaalageneetikko 2004 FT Perinnöllisestä eturauhassyövästä 2004 Finaksen teknisenä arvioijana vuodesta

Lisätiedot

Mikä on ns. multiplex-pcr tutkimus?

Mikä on ns. multiplex-pcr tutkimus? Sidonnaisuudet kahden viimeisen vuoden ajalta Multiplex-PCR ym. uudet monianalyyttimenetelmät - Laboratorion näkökulma Dos., osastonylilääkäri Maija Lappalainen HUSLAB, Virologian ja immunologian osasto

Lisätiedot

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012

Lisätiedot

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY T043 Liite 1.05 / Appendix 1.05 Sivu / Page 1(5) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY FIMLAB MEDICAL LABORATORIES LTD Tunnus Code Yksikkö tai toimintoala

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Keuhkosyövän molekyylipatologinen diagnostiikka edellyttää perustietoja myös kliinikoilta

Keuhkosyövän molekyylipatologinen diagnostiikka edellyttää perustietoja myös kliinikoilta KATSAUS TEEMA Elisa Lappi-Blanco, Kaisa Salmenkivi, Soili Kytölä ja Juha Kononen Keuhkosyövän molekyylipatologinen diagnostiikka edellyttää perustietoja myös kliinikoilta Keuhkosyöpien histologisen luokittelun

Lisätiedot

KOHDENNETTU MISEQ- EKSONISEKVENSOINTI KÄYTTÄEN SEQCAP- GEENIKIRJASTOASETELMAA JA ALZHEIMERIN TAUTITAPAUKSIA

KOHDENNETTU MISEQ- EKSONISEKVENSOINTI KÄYTTÄEN SEQCAP- GEENIKIRJASTOASETELMAA JA ALZHEIMERIN TAUTITAPAUKSIA KOHDENNETTU MISEQ- EKSONISEKVENSOINTI KÄYTTÄEN SEQCAP- GEENIKIRJASTOASETELMAA JA ALZHEIMERIN TAUTITAPAUKSIA Tiina Karkiainen Opinnäytetyö Lääketieteen koulutusohjelma Itä-Suomen yliopisto Terveystieteiden

Lisätiedot

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5. Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.2016 Iina.Tuominen@tyks.fi Genetiikan tutkimukset sarkoomien diagnostiikassa

Lisätiedot

Keuhkosyövän molekulaarinen patologia. Sakari Knuutila HY, Haartman Instituutti

Keuhkosyövän molekulaarinen patologia. Sakari Knuutila HY, Haartman Instituutti Keuhkosyövän molekulaarinen patologia Sakari Knuutila HY, Haartman Instituutti Tänään Keuhkosyöpä: äärimmäisen komplisoituneen taudin kuvaaminen systeemibiologisella lähestymistavalla auttaa ymmärtämään,

Lisätiedot

Rintasyövän perinnöllisyys

Rintasyövän perinnöllisyys Lääketieteellisen genetiikan kurssi 17.9.2012 Rintasyövän perinnöllisyys Perinnöllinen syöpäalttius - esimerkkinä rintasyöpä Kristiina Aittomäki, dos. ylilääkäri Genetiikan vastuuyksikköryhmä/huslab/hus

Lisätiedot

Uuden vieritestin käyttöönotto avoterveydenhuollossa

Uuden vieritestin käyttöönotto avoterveydenhuollossa Uuden vieritestin käyttöönotto avoterveydenhuollossa HUSLAB Kliininen kemia ja hematologia 2009 kemisti Paula Pohja-Nylander Tavallisimmat vieritestit avoterveydenhuollossa Hemoglobiini Anemiadiagnostiikka

Lisätiedot

Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta

Lisätiedot

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa

Lisätiedot

Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori

Lisätiedot

Keuhkosyövän uudet lääkkeet

Keuhkosyövän uudet lääkkeet Keuhkosyövän uudet lääkkeet Jarkko Ahvonen Syöpätautien erikoislääkäri Tampereen yliopistollinen sairaala Sidonnaisuudet Asiantuntijapalkkio Boehringer Ingelheim, Bristol-Myers Squibb, Lilly, MSD, Roche

Lisätiedot

Polvipunktionäytteiden bakteeriperäisen DNA:n mittaaminen ja sen optimointi uuden sukupolven sekvensoinnin avulla

Polvipunktionäytteiden bakteeriperäisen DNA:n mittaaminen ja sen optimointi uuden sukupolven sekvensoinnin avulla Polvipunktionäytteiden bakteeriperäisen DNA:n mittaaminen ja sen optimointi uuden sukupolven sekvensoinnin avulla Elsa Öistämö Syventa vien opintojen kirjallinen tyo Tampereen yliopisto La a ketieteen

Lisätiedot

Prosessien hallinta. Lean-näkökulma laboratorion prosessien kehittämiseen ja hallintaan

Prosessien hallinta. Lean-näkökulma laboratorion prosessien kehittämiseen ja hallintaan Prosessien hallinta Lean-näkökulma laboratorion prosessien kehittämiseen ja hallintaan Tommi Jokiniemi Kehittämispäällikkö Viitekehykset Luennoitsija: Biofysiikan ja lääketieteellisen tekniikan DI 15v

Lisätiedot

Yleisimmät idiopaattiset interstitiaalipneumoniat ja tavalliset keuhkovauriot - avainasemassa moniammatillisuus

Yleisimmät idiopaattiset interstitiaalipneumoniat ja tavalliset keuhkovauriot - avainasemassa moniammatillisuus Yleisimmät idiopaattiset interstitiaalipneumoniat ja tavalliset keuhkovauriot - avainasemassa moniammatillisuus 12.11.2015 IAP Tampere Airi Jartti Elisa Lappi-Blanco Sidonnaisuudet Luentopalkkioita Oy

Lisätiedot

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien molekyylidiagnostiikkaa 30.8.2013 Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien WHO-luokitus on morfologinen Gradusten I-IV ryhmittelyn perustana on toiminut ennusteen huononeminen

Lisätiedot

Tupakastavieroitusklinikoiden. koko maahan? Annamari Rouhos Keuhkosairauksien erikoislääkäri HYKS Sydän- ja keuhkokeskus

Tupakastavieroitusklinikoiden. koko maahan? Annamari Rouhos Keuhkosairauksien erikoislääkäri HYKS Sydän- ja keuhkokeskus Tupakastavieroitusklinikoiden verkosto koko maahan? 4.4.2017 Annamari Rouhos Keuhkosairauksien erikoislääkäri HYKS Sydän- ja keuhkokeskus Sidonnaisuuteni kaupalliseen yritykseen (ky) viimeisten 2 v aikana

Lisätiedot

Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen

Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen eksoneissa 2, 3 ja 4) varmistaminen on tärkeää ennen Erbitux (setuksimabi) -hoidon aloittamista

Lisätiedot

Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:

Lisätiedot

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA Robert Winqvist SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PROFESSORILIITON SYYSSEMINAARI TUTKIMUSTA KAIKKIEN HYÖDYKSI

Lisätiedot

LÄNNEN SOKERI. Merja Laine 15.5.2012

LÄNNEN SOKERI. Merja Laine 15.5.2012 LÄNNEN SOKERI Merja Laine 15.5.2012 Sidonnaisuudet Työnantaja: Vantaan kaupunki Ammatinharjoittajana lääkärikeskus Mehiläinen Kuulun aikuisten lihavuuden käypä hoito -työryhmään. Kuulun diabeteksen käypä

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

HUSLABIN TULEVAISUUDEN ORGANISAATIO

HUSLABIN TULEVAISUUDEN ORGANISAATIO HUSLABIN TULEVAISUUDEN ORGANISAATIO SKKY ry:n ja Sairaalakemistit ry:n syyskoulutuspäiv ivät t 31.10.2013 Toimitusjohtaja Piia Aarnisalo, HUSLAB 31.10.2013 1 SUOMEN JOHTAVA KLIINISTEN LABORTORIOPALVELUIDEN

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

NYT MEILTÄ MYÖS LONZAN JA GREINERIN LAATUTUOTTEET MM. SOLUVILJELYYN! HYÖDYNNÄ MAHTAVAT CST-KAMPANJAT!

NYT MEILTÄ MYÖS LONZAN JA GREINERIN LAATUTUOTTEET MM. SOLUVILJELYYN! HYÖDYNNÄ MAHTAVAT CST-KAMPANJAT! Science whereyou are Tarjoukset voimassa 30.10.2014 asti kampanjakoodilla FIN301014FIN. Kampanjahinnat ilman arvonlisäveroa. NYT MEILTÄ MYÖS LONZAN JA GREINERIN LAATUTUOTTEET MM. SOLUVILJELYYN! HYÖDYNNÄ

Lisätiedot

Positiivisesta seulonnasta sopivien verien löytymiseen

Positiivisesta seulonnasta sopivien verien löytymiseen Positiivisesta seulonnasta sopivien verien löytymiseen Anu Korhonen, FM, SPR Veripalvelu Laboratoriolääketiede 2014 ja näyttely 1 1 1 1 1 Veren sopivuustutkimukset Ennen verensiirtoa punasoluvalmisteiden

Lisätiedot

Onko ovarioperäistä karsinoomaa olemassakaan? - Ralf Bützow - HUSLAB ja Naistensairaala/HYKS

Onko ovarioperäistä karsinoomaa olemassakaan? - Ralf Bützow - HUSLAB ja Naistensairaala/HYKS Onko ovarioperäistä karsinoomaa olemassakaan? - Ralf Bützow - HUSLAB ja Naistensairaala/HYKS Serous, low grade Serous, high grade Endometrioid Clear cell Mucinous Transitiocellular/ Malignant Brenner OVARIOKARSINOOMAN

Lisätiedot

keuhkosyövän uusista hoitotutkimuksista Jussi Koivunen, el dos OYS/Syöpätaudit

keuhkosyövän uusista hoitotutkimuksista Jussi Koivunen, el dos OYS/Syöpätaudit keuhkosyövän uusista hoitotutkimuksista Jussi Koivunen, el dos OYS/Syöpätaudit 30.8.2014 Sidonnaisuudet Taloudelliset riippuvuudet: Konsultointi: - Tutkimusrahoitus: - Osakkeet: - Honorariat: Eli Lilly,

Lisätiedot

FIMM Technology Services FIMM:n teknologiapalvelut 1

FIMM Technology Services FIMM:n teknologiapalvelut 1 FIMM Technology Services FIMM:n teknologiapalvelut 1 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based

Lisätiedot

Muuttuva diagnostiikka avain yksilöityyn hoitoon

Muuttuva diagnostiikka avain yksilöityyn hoitoon Muuttuva diagnostiikka avain yksilöityyn hoitoon Olli Carpén, Patologian professori, Turun yliopisto ja Patologian palvelualue, TYKS-SAPA liikelaitos ChemBio Finland 2013 EGENTLIGA HOSPITAL FINLANDS DISTRICT

Lisätiedot

Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa

Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa Timo Kanninen, Biocomputing Platforms Oy 2012 all rights reserved BC Platforms genomisen datan hallintaa Geneettisen

Lisätiedot

Genomitieto kliinikon apuna nyt ja tulevaisuudessa

Genomitieto kliinikon apuna nyt ja tulevaisuudessa Genomitieto kliinikon apuna nyt ja tulevaisuudessa Helena Kääriäinen Tutkimusprofessori 19.3.2014 Genomitieto / Helena Kääriäinen 1 Mistä kliinikosta puhumme? Kliinisistä geeneetikoista eli perinnöllisyyslääkäreistä?

Lisätiedot

NOPEAT KASETTI-PCR TESTIT

NOPEAT KASETTI-PCR TESTIT NOPEAT KASETTI-PCR TESTIT Raisa Loginov Dosentti, sairaalamikrobiologi HUSLAB / Kliininen mikrobiologia Mitä kaikkea tulee huomioida otettaessa käyttöön näitä testejä? Kliinisen mikrobiologian toimilupa

Lisätiedot

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa Tietoa työstä Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa LOPPURAPORTTI TYÖSUOJELURAHASTOLLE Sakari Knuutila

Lisätiedot

Laatunäkökulma tuberkuloosin immunodiagnostiikassa

Laatunäkökulma tuberkuloosin immunodiagnostiikassa Laatunäkökulma tuberkuloosin immunodiagnostiikassa Kliinisen mikrobiologian erikoislääkäri Dosentti Tamara Tuuminen Helsingin Yliopisto HUSLAB Vita Terveyspalvelut Laadun varmistus Pre-analytiikka: oikeat

Lisätiedot

Komplementtitutkimukset

Komplementtitutkimukset Komplementtitutkimukset Hanna Jarva HUSLAB ja Haartman-instituutti Bakteriologian ja immunologian osasto Komplementti osa luontaista immuunijärjestelmää koostuu yli 30 proteiinista aktivoituu kaskadimaisesti

Lisätiedot

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa TYÖSUOJELURAHASTO 21.2..2015 LOPPURAPORTTI: Työterveyslaitoksen osuus Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa

Lisätiedot

Iäkkään muistipotilaan masennuksen hoito

Iäkkään muistipotilaan masennuksen hoito Iäkkään muistipotilaan masennuksen hoito Sinikka Luutonen Psykiatrian dosentti, geriatrian erikoislääkäri Turun yliopisto ja VSSHP/Psykiatrian tulosalue Sidonnaisuudet toiminut luennoitsijana terveydenhuollon

Lisätiedot

Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan. Minna Äikäs. Metropolia Ammattikorkeakoulu. Bioanalyytikko (AMK)

Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan. Minna Äikäs. Metropolia Ammattikorkeakoulu. Bioanalyytikko (AMK) Minna Äikäs Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan Metropolia Ammattikorkeakoulu Bioanalyytikko (AMK) Koulutusohjelma Opinnäytetyö 23.4.2014 Tiivistelmä Tekijä

Lisätiedot

FIMM Technology Services FIMM:n teknologiapalvelut 1

FIMM Technology Services FIMM:n teknologiapalvelut 1 FIMM Technology Services FIMM:n teknologiapalvelut 1 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based

Lisätiedot

Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet

Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet Pia Österlund el, dosentti Kliininen opettaja HY/HYKS syöpätaudit 29 elokuuta 2014 Sidonnaisuudet Palkkioita ja/tai matkakorvauksia: Amgen, Bayer,

Lisätiedot

Noroviruksen epidemiologia maailmalla ja Suomessa

Noroviruksen epidemiologia maailmalla ja Suomessa Noroviruksen epidemiologia maailmalla ja Suomessa Haider Al-Hello Erikoistutkija, INFO/INVI 15.11.2016 1 Ripulitauteja aiheuttavat virukset Norovirukset Rotavirukset Adenovirukset (serotyypit 40 ja 41)

Lisätiedot

JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN

JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN Anne Vaittinen Maisterintutkielma Helsingin yliopisto Maataloustieteiden laitos HEBIOT Biotekniikka

Lisätiedot

Henkilökohtainen riski vs. yhteisön etu? Tutkimukset terveillä vapaaehtoisilla. Etiikan päivä 12.3.2015 Mika Scheinin Turun yliopisto ja Tyks

Henkilökohtainen riski vs. yhteisön etu? Tutkimukset terveillä vapaaehtoisilla. Etiikan päivä 12.3.2015 Mika Scheinin Turun yliopisto ja Tyks Henkilökohtainen riski vs. yhteisön etu? Tutkimukset terveillä vapaaehtoisilla Etiikan päivä 12.3.2015 Mika Scheinin Turun yliopisto ja Tyks Mika Scheinin 12.3.2015: sidonnaisuudet lääkeyrityksiin Yksityisen

Lisätiedot

Virtsan kemiallisen seulonnan kliininen käyttö. Dosentti Martti L.T. Lalla Osastonylilääkäri HUSLAB Kirurginen sairaala 4.2.2009

Virtsan kemiallisen seulonnan kliininen käyttö. Dosentti Martti L.T. Lalla Osastonylilääkäri HUSLAB Kirurginen sairaala 4.2.2009 Virtsan kemiallisen seulonnan kliininen käyttö Dosentti Martti L.T. Lalla Osastonylilääkäri HUSLAB Kirurginen sairaala Virtsa elimistön tietolähteenä Virtsa - ensimmäinen kehon aine, jonka tutkiminen yhdistettiin

Lisätiedot

Toiminnallisten kohtauspotilaiden psykiatrinen arviointi ja hoito. OYL, Dos Tero Taiminen Yleissairaalapsykiatrian yksikkö TYKS

Toiminnallisten kohtauspotilaiden psykiatrinen arviointi ja hoito. OYL, Dos Tero Taiminen Yleissairaalapsykiatrian yksikkö TYKS Toiminnallisten kohtauspotilaiden psykiatrinen arviointi ja hoito OYL, Dos Tero Taiminen Yleissairaalapsykiatrian yksikkö TYKS Työnantaja: VSSHP Sidonnaisuudet Ei omistuksia terveydenhuoltoalan yrityksissä

Lisätiedot

Harvinaissairauksien yksikkö. Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta. Taustaa. Alfa-tryptasemia. 21/03/16 /ms

Harvinaissairauksien yksikkö. Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta. Taustaa. Alfa-tryptasemia. 21/03/16 /ms Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta Taustaa EDS potilasyhdistys ja yksittäinen potilas ovat lähestyneet HYKS harvinaissairauksien yksikköä ja pyytäneet lausuntoa, minkälainen sairaus Ehlers-Danlos

Lisätiedot

Kokoelmat kotona vai maailmalla? - kirjastojen kokoelmapolitiikan muutos säilyttäjästä saatavuuden varmistajaksi

Kokoelmat kotona vai maailmalla? - kirjastojen kokoelmapolitiikan muutos säilyttäjästä saatavuuden varmistajaksi Jarmo Saarti Kokoelmista vapautetut aineistojen poistaminen kirjaston kokoelmista 1.11.2010 Kokoelmat kotona vai maailmalla? - kirjastojen kokoelmapolitiikan muutos säilyttäjästä saatavuuden varmistajaksi

Lisätiedot

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen

Lisätiedot

ALKIODIAGNOSTIIK KA ANN-MARIE NORDSTRÖM

ALKIODIAGNOSTIIK KA ANN-MARIE NORDSTRÖM ALKIODIAGNOSTIIK KA ANN-MARIE NORDSTRÖM 180114 Lapsettomuushoidot 80-luvulla Ensimmäiset IVF-lapset Suomessa 1984 Hoidon onnistuminen 80-luvulla - hormonistimulaatiomenetelmät vasta kehittymässä - siirrettiin

Lisätiedot

TUKI kyselyjen tulokset. Pientä tunnuslukujen tarkastelua TUKI-projektissa (diat 31-35)

TUKI kyselyjen tulokset. Pientä tunnuslukujen tarkastelua TUKI-projektissa (diat 31-35) TUKI kyselyjen tulokset TUKI-projektiin osallistuneiden osastojen (n=7) hoitotyöntekijöiden vastausten kooste 2010 tuloksia ja 2011 tuloksia (diat 2-30) Pientä tunnuslukujen tarkastelua TUKI-projektissa

Lisätiedot

Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.

Lisätiedot

HPV-epidemiologiasta ja diagnostiikasta

HPV-epidemiologiasta ja diagnostiikasta HPV-epidemiologiasta ja diagnostiikasta Eeva Auvinen dosentti, vs. laboraattori HUSLAB Kliininen mikrobiologia, virologia Labquality 15.10.2004 1 Papilloomavirukset Ihmisillä ja useilla muilla eläinlajeilla,

Lisätiedot

Biopankki: ideasta käytäntöön

Biopankki: ideasta käytäntöön Biopankki: ideasta käytäntöön Kimmo Pitkänen Kehittämispäällikkö Suomen molekyylilääketieteen instituutti FIMM European Biotech Week, Biomedicum 2.10.2013 FIMM - Institute for Molecular Medicine Finland

Lisätiedot

SAATTOHOITOPÄÄTÖS. Palliatiivisen hoidon seminaari 26.4.13 Diakonia-ammattikorkeakoulu Urpo Hautala

SAATTOHOITOPÄÄTÖS. Palliatiivisen hoidon seminaari 26.4.13 Diakonia-ammattikorkeakoulu Urpo Hautala SAATTOHOITOPÄÄTÖS Palliatiivisen hoidon seminaari 26.4.13 Diakonia-ammattikorkeakoulu Urpo Hautala Urpo Hautala Laitospalveluiden ylilääkäri Sastamalan seudun sosiaali- ja terveyspalvelut Yleislääketieteen

Lisätiedot

Sidonnaisuudet. Tuberkuloosi, toteaminen ja hoito. Milloin epäilen tuberkuloosia perusterveydenhuollossa 06.10.2015

Sidonnaisuudet. Tuberkuloosi, toteaminen ja hoito. Milloin epäilen tuberkuloosia perusterveydenhuollossa 06.10.2015 Sidonnaisuudet Tuberkuloosi, toteaminen ja hoito Tuula Vasankari Dos., el Pääsihteeri Filha ry Valtakunnallinen TB hoidon asiantuntijaryhmä, pj 8.10.2015 Filha WHO IUATLD TB-Net STM THL Ei lääketeollisuussidonnaisuuksia

Lisätiedot

VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen

Lisätiedot

LÄÄKÄRI HOITAJA - TYÖPARITYÖSKENTELYSTÄKÖ RATKAISU? Kehittämispäällikkö Eija Peltonen

LÄÄKÄRI HOITAJA - TYÖPARITYÖSKENTELYSTÄKÖ RATKAISU? Kehittämispäällikkö Eija Peltonen LÄÄKÄRI HOITAJA - TYÖPARITYÖSKENTELYSTÄKÖ RATKAISU? Kehittämispäällikkö Eija Peltonen Eija Peltonen 1 Vastaanoton menetystekijät 6. Maaliskuuta 2006 Hyvät vuorovaikutustaidot Ammattitaito Väestövastuu

Lisätiedot

Kokogenomityypitys uusi työkalu tartunnanjäljitykseen. Tartuntatautikurssi Laura Lindholm

Kokogenomityypitys uusi työkalu tartunnanjäljitykseen. Tartuntatautikurssi Laura Lindholm Kokogenomityypitys uusi työkalu tartunnanjäljitykseen Tartuntatautikurssi 7.4.2017 Laura Lindholm MRSA MRSA = Metisilliiniresistentti Staphylococcus aureus Resistentti lähes kaikille beetalaktaameille

Lisätiedot

Järjestelmäarkkitehtuuri (TK081702) Pilvipalvelut. Pilvipalvelut - lähtökohtia

Järjestelmäarkkitehtuuri (TK081702) Pilvipalvelut. Pilvipalvelut - lähtökohtia Järjestelmäarkkitehtuuri (TK081702) Pilvipalvelut Pilvipalvelut Nouseva toteutustekniikka ja trendi Kuluttajat edellä, yritykset perässä Paino sanalla Palvelu Yhtenäisyyksiä vuosikymmenten taakse, sovelletaan

Lisätiedot

Web-palvelut ja niihin kohdistuneiden poikkeavuuksien tunnistamisen. Harri Mäkelä

Web-palvelut ja niihin kohdistuneiden poikkeavuuksien tunnistamisen. Harri Mäkelä Web-palvelut ja niihin kohdistuneiden poikkeavuuksien tunnistamisen Harri Mäkelä Aiheet Yleiset asiat ja tutkimuskysymys Johdanto Web-palvelun tietoturvaan Sisällysluettelo Teoria Testausympäristö Mitä

Lisätiedot

Uutta melanoomasta. Pia Vihinen TYKS/Syöpäklinikka. Tutkimukset kun epäilet melanooman leviämistä

Uutta melanoomasta. Pia Vihinen TYKS/Syöpäklinikka. Tutkimukset kun epäilet melanooman leviämistä Uutta melanoomasta Pia Vihinen TYKS/Syöpäklinikka Tutkimukset kun epäilet melanooman leviämistä Vartalon TT tutkimus tai PET-TT Verikokeet; Hb, maksa-arvot, krea Korkea LDH huonon ennusteen merkki PAD:

Lisätiedot

Tupakoinnin lopettamisen tuki suun terveydenhuollossa

Tupakoinnin lopettamisen tuki suun terveydenhuollossa Tupakoinnin lopettamisen tuki suun terveydenhuollossa Tupakka ja terveys päivät 29.11.2016 EHL, HLT Anna Maria Heikkinen, yliopistonlehtori, HY, erikoishammaslääkäri, HUS Sidonnaisuudet: Pfizerin asiantuntijana

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

Synlab Kansainvälisen laboratoriotoimijan laajentuminen Suomeen. Heikki Aaltonen 31.10.2013

Synlab Kansainvälisen laboratoriotoimijan laajentuminen Suomeen. Heikki Aaltonen 31.10.2013 Synlab Kansainvälisen laboratoriotoimijan laajentuminen Suomeen Heikki Aaltonen 31.10.2013 31.10.2013 Synlab Euroopan suurin laboratoriotoimija Eurooppa Noin miljoona analyysia päivässä Noin 7 000 työntekijää

Lisätiedot

Tuberkuloosin immunodiagnostiset testit. Dosentti Tamara Tuuminen, kliinisen mikrobiologian erl HY, HUSLAB Labquality 02.11.2007

Tuberkuloosin immunodiagnostiset testit. Dosentti Tamara Tuuminen, kliinisen mikrobiologian erl HY, HUSLAB Labquality 02.11.2007 Tuberkuloosin immunodiagnostiset testit Dosentti Tamara Tuuminen, kliinisen mikrobiologian erl HY, HUSLAB Labquality 02.11.2007 HUSLAB:n testivalikoima ELISPOT= Ly-TbSpot Mittaa IFNγ tuottavien solujen

Lisätiedot

Immunohistokemia HPV-muutosten ja tavallisten gynekologisten adenokarsinoomien diagnostiikassa. Elisa Lappi-Blanco OYS, patologian osasto

Immunohistokemia HPV-muutosten ja tavallisten gynekologisten adenokarsinoomien diagnostiikassa. Elisa Lappi-Blanco OYS, patologian osasto Immunohistokemia HPV-muutosten ja tavallisten gynekologisten adenokarsinoomien diagnostiikassa Elisa Lappi-Blanco OYS, patologian osasto Gynekopatologian tavallisia ongelmia HPV-muutosten vaikeusasteen

Lisätiedot

VIDEOVÄLITTEINEN OPETUS

VIDEOVÄLITTEINEN OPETUS VIDEOVÄLITTEINEN OPETUS Anne Mohn, Tiina Tarr, VSSHP, TYKS Leena Salminen, Turun yliopisto, hoitotieteen laitos, Minna Syrjäläinen-Lindberg, Yrkeshögskolan Novia Teija Franck, Turun AMK Terveydenhuollon

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri

Lisätiedot

Mikrobiologisen näytteenoton laadunhallinta. Outi Lampinen HUSLAB Bakteriologian yksikkö

Mikrobiologisen näytteenoton laadunhallinta. Outi Lampinen HUSLAB Bakteriologian yksikkö Mikrobiologisen näytteenoton laadunhallinta Outi Lampinen HUSLAB Bakteriologian yksikkö 4.2.2009 Mitä on näytteenoton n laadunhallinta? Osa laboratoriotutkimusprosessin laadunhallintaa Näytteenottoprosessille

Lisätiedot

64 kanavainen EEG ja herätevasteet Kirsi Palmu, erikoistuva fyysikko HUSLAB, KNF

64 kanavainen EEG ja herätevasteet Kirsi Palmu, erikoistuva fyysikko HUSLAB, KNF 64 kanavainen EEG ja herätevasteet Kirsi Palmu, erikoistuva fyysikko HUSLAB, KNF Osa I: EEG Osa II: Herätevasteet Jorvin kokemus: suurempi kanavamäärä sopii rutiiniin! 64 kanavainen rutiini EEG tehty yli

Lisätiedot

TERVEYSPALVELUIDEN SAATAVUUS N keskiarvo

TERVEYSPALVELUIDEN SAATAVUUS N keskiarvo LIITE 6 1(2) Taulukko 2. Aloitusvaiheen tulosten keskiarvot ja keskihajonnat. TERVEYSPALVELUIDEN SAATAVUUS N keskiarvo keskihajonta Henkilökunnan riittävyys 32 2,99 6,75 Henkilökuntaa on riittävästi 32

Lisätiedot

Alere i. Molecular. In minutes. PAINA TÄTÄ NIIN NÄET SEURAAVAN SIVUN

Alere i. Molecular. In minutes. PAINA TÄTÄ NIIN NÄET SEURAAVAN SIVUN Alere i Molecular. In minutes. PAINA TÄTÄ NIIN NÄET N SIVUN Alere i yhdistää nopeuden ja tarkkuuden hyödyt. Enää ei tarvitse tehdä kompromisseja potilaiden testauksessa ja kliinisessä päätöksenteossa.

Lisätiedot

Kilpirauhasen kasvaimet NYKYLUOKITUS 21.11.2012

Kilpirauhasen kasvaimet NYKYLUOKITUS 21.11.2012 Kilpirauhasen kasvaimet NYKYLUOKITUS 21.11.2012 Johanna Arola Aikakauskirja Duodecim Patologian osasto Haartman-instituutti ja HUSLAB Sidonnaisuudet Kirjoituspalkkiot Kustannus OY Duodecim Aikakauskirja

Lisätiedot

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Markus Perola, LT, geneettisen epidemiologian tutkimusprofessori THL, KATO, GETY markus.perola@thl.fi Määritelmiä L3/13.9.2012

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012

Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012 Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012 Anna-Elina Lehesjoki, LKT Professori, tutkimusjohtaja Neurotieteen tutkimuskeskus, Helsingin yliopisto Lääketieteellisen genetiikan

Lisätiedot

Gliooman uusista hoitosuosituksista. Heikki Minn

Gliooman uusista hoitosuosituksista. Heikki Minn Gliooman uusista hoitosuosituksista Heikki Minn Onkologiapäivät, Turku 30.8.2013 Sidonnaisuudet Konsulttina ja/tai kliinisenä tutkijana seuraavissa lääketieteellistä toimintaa harjoittavissa yrityksissä

Lisätiedot

Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja

Lisätiedot

VASTAUSANALYYSI / HYVÄN VASTAUKSEN PIIRTEET

VASTAUSANALYYSI / HYVÄN VASTAUKSEN PIIRTEET LÄÄKETIETEELLISTEN ALOJEN VALINTAKOE 20.5.2015 VASTAUSANALYYSI / HYVÄN VASTAUKSEN PIIRTEET Vastausanalyysi julkaistaan välittömästi valintakokeen päätyttyä. Analyysin tavoitteena on antaa valintakokeeseen

Lisätiedot

Seminar 24.1.2014. Wet chemistry alliance Synthetic chemistry

Seminar 24.1.2014. Wet chemistry alliance Synthetic chemistry *not as active students 24.1.2014 Kaivosvesiasioiden verkostoitumistilaisuus UEF Farmasia Wet Chemistry Alliance Seminar 24.1.2014 Wet chemistry alliance Synthetic chemistry Prof. J. Vepsäläinen (UEF)

Lisätiedot

PCR syöpädiagnostiikassa ja seurannassa -tekniikka ja sovellutuksia. Veli Kairisto Kl. kemian ja lab.hematologian el. oyl., dos. Tyks-Sapa, Tykslab

PCR syöpädiagnostiikassa ja seurannassa -tekniikka ja sovellutuksia. Veli Kairisto Kl. kemian ja lab.hematologian el. oyl., dos. Tyks-Sapa, Tykslab PCR syöpädiagnostiikassa ja seurannassa -tekniikka ja sovellutuksia Veli Kairisto Kl. kemian ja lab.hematologian el. oyl., dos. Tyks-Sapa, Tykslab Polymeraasiketjureaktio (PCR) Reaaliaikainen kvantitatiivinen

Lisätiedot

Preanalytiikan poikkeamat laatuketjussa

Preanalytiikan poikkeamat laatuketjussa Preanalytiikan poikkeamat laatuketjussa apulaisylikemisti, dosentti HUSLAB LABORATORION LAATUKETJU Preanalyyttisen laboratoriovaiheen osaprosessit - Tilaaja-lääkäri -vaihe - Potilaan esivalmistelu - Näytteenotto

Lisätiedot

Kokemuksia Mistä sitä tietää kampanjasta 1.2.2008

Kokemuksia Mistä sitä tietää kampanjasta 1.2.2008 Kokemuksia Mistä sitä tietää kampanjasta 1.2.2008 Hiv-säätiö / Aids-tukikeskus Suunnittelija Marja Pakarinen marja.pakarinen@aidstukikeskus.fi p. 0207 465 772 Mistä sitä tietää -turvaseksikampanja Miksi

Lisätiedot

Glaukooman hoito Lapin sairaanhoitopiirissä 3.12.2009 Marko Ollila

Glaukooman hoito Lapin sairaanhoitopiirissä 3.12.2009 Marko Ollila Glaukooman hoito Lapin sairaanhoitopiirissä 3.12.2009 Marko Ollila Taustaa Oikeusasiamies Riitta-Leena Paunio 29.4.2004: Kunnalla on velvollisuus järjestää kroonisen glaukooman hoito ja sen seuraamiseksi

Lisätiedot

HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA

HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA B-DNAmut-tutkimusnimikkeellä tehdyt lähetteet Fimlab Laboratoriot Oy:n genetiikan laboratoriossa vuosina 2013 ja 2014 Olli Kemppainen Emilia

Lisätiedot

Uudet tekniikat infektio- diagnostiikassa

Uudet tekniikat infektio- diagnostiikassa Uudet tekniikat infektio- diagnostiikassa Labquality Days 5.2.2015 Kaisu Rantakokko-Jalava Tyks mikrobiologia ja genetiikka VSSHP Tyks-Sapa-liikelaitos Uusia tuulia kl. mikrobiologiassa MALDI-TOF bakteerien

Lisätiedot