NGS:n haasteet diagnostiikassa Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

Koko: px
Aloita esitys sivulta:

Download "NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio"

Transkriptio

1 NGS:n haasteet diagnostiikassa Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

2 Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly

3 NGS:n haasteita näytteen haastavuus logistiikan toimivuus moniammatillista (mm. bioinformaatikkojen saatavuus) sovituissa toimitusajoissa pysyminen laitteiden, analyysiohjelmien toimiminen data pilvipalvelussa oman serverin hankkiminen raakadatan pitkäaikainen ja rajallinen säilöminen tuntemattomat variantit, merkintä, kliininen merkitys ja lausuminen ituratamutaatiot lausuntojen selkokielisyys lääkäreille potilaiden pääsy lausuntoihinsa (kanta)

4 Next generation sequencing, NGS sekvensoidaan moninkertaisesti useita geenialueita useilta potilailta samanaikaisesti nopea analytiikka kohdennetut geenipaneelit, transkriptomit, eksomit, koko genomi

5 NGS-laitevertailua

6 Illuminan MiSeq vai Ion Torrentin PGM? Illumina MiSeq Ion Torrent PGM

7 Suuren kapasiteetin NGS-laitteet

8 Ion Torrent Proton eksomisekvensointi transkriptomit non-invasiivinen cfdnaanalytiikka (sikiöperäinen, kasvainperäinen) koko genomin sekvensointi

9 Ion Torrent, puolijohdetekniikka perustuu H + irtoamiseen polymeraasin liittäessä nukleotidin, mitataan ph-muutoksena

10 ph-muutos

11 NGS-vaiheiden kesto paljon tietoa yhdellä kerralla tulos jopa parissa vuorokaudessa hinta inhimillinen

12 Kirjaston tekeminen

13 Emulsio-PCR Emulsio Monistus Rikastus

14 Sekvensointi

15 Analysointi Peitto (coverage) kertoo = kuinka monta kertaa kukin emäs on sekvensoitu Herkkyys laskennallinen peiton mukaan

16 Laatukriteerit, sirun lataus hyvä %

17 Laatukriteerit, yhteenveto

18 Laatukriteerit, juosteiden lukupituus

19 Barcode-näyte-sarja

20

21

22 VariantCaller

23 VariantCaller, cosmic

24 IonReporter, filtteröinti

25 p.gly13val

26

27 NEJM, 2013

28 Mutaatiot ja niiden merkinnät c.1733_1735delatg p.asp579del c.1961t>c p.val654ala c.1799_1800deltginsaa p.val600glu

29 Väärät positiiviset homopolymeerit, >6 alukkeiden väärä sitoutuminen (katkenneet juosteet) kompleksiset variantit useita variantteja alhaisella frekvenssillä

30 21318 Ts-NGSsCA1 NGS syöpägeenipaneeli 1 kiinteiden kasvainten somaattisille muutoksille Type Name Covered Chromosome Num_Ampl Total_Bases _Bases Missed_Bases GENE PIK3CA chr GENE EGFR chr GENE KIT chr GENE KRAS chr GENE MET chr GENE NRAS chr GENE PDGFRA chr BRAF V600 chr GENOME_ REGION paneelin koko kb

31 21316 Ts-NGSsHS1 NGS hotspot syöpägeenipaneeli 1 kiinteiden kasvainten somaattisille muutoksille paneelin koko 5.69 kb Gene COSMIC Gene COSMIC Gene COSMIC ABL1 19 FGFR2 8 NRAS 35 AKT1 6 FGFR3 17 PDGFRA 26 ALK 8 FLT3 30 PIK3CA 93 APC 164 GNA11 5 PIK3CA_ENST ATM 24 GNAQ 6 PTEN 159 BRAF 77 GNAS 9 PTPN11 28 CDH1 7 GNAS_ENST RB1 18 CDKN2A 106 HNF1A 10 RET 17 CDKN2A_ENST HRAS 24 SMAD4 31 CDKN2A_ENST HRAS_ENST SMARCB1 11 CSF1R 8 IDH1 15 SMO 5 CTNNB1 73 IDH2 12 SRC 1 EGFR 123 JAK2 5 STK11 23 ERBB2 19 JAK3 6 TP ERBB4 13 KDR 11 TP53_ENST TP53_ENST0000 EZH2 7 KIT 139 EZH2_ENST KRAS TP53_ENST TP53_ENST FBXW7 13 MET 18 FBXW7_ENST MLH1 1 VHL 124 FBXW7_ENST MPL 10 FBXW7_NM_ _2 4 NOTCH1 20 Kaikki yhteensä 2855 FGFR1 2 NPM1 28

32 Lausuntomalli

33 Lausuntomalli, ei mutaatiota

34 Tunnettu mutaatio

35 Muu tunnettu mutaatio

36 Tuntematon mutaatio

37 Tulevaisuuden suunnitelmia kohdennetut paneelit kaupalliset community custom transkriptomit, RNA-pohjainen cfdna:n määrittäminen (non-invasiivinen diagnostiikka) sikiöperäinen kasvainperäinen alkiodiagnostiikka (PGD-NGS) eksomit, koko genomit

38 NGS:n haasteita näytteen haastavuus logistiikan toimivuus moniammatillista (mm. bioinformaatikkojen saatavuus) sovituissa toimitusajoissa pysyminen laitteiden, analyysiohjelmien toimiminen data pilvipalvelussa oman serverin hankkiminen raakadatan pitkäaikainen ja rajallinen säilöminen tuntemattomat variantit, merkintä, kliininen merkitys ja lausuminen ituratamutaatiot lausuntojen selkokielisyys lääkäreille potilaiden pääsy lausuntoihinsa (kanta)

39 Kiitos!

Keuhkosyövän molekyylipatologia

Keuhkosyövän molekyylipatologia Professori Sakari Knuutila Helsingin yliopisto Keuhkosyövän molekyylipatologia Keuhkosyövän tunnuspiirteenä ovat lukuisat muutokset genomin rakenteessa ja toiminnassa. Sama ilmiö liittyy kaikkiin pitkälle

Lisätiedot

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Juha-Pekka Pursiheimo Turun Yliopisto Turku Clinical Sequencing Laboratory (TCSL) Labquality Days 2016 11.02. 2016 n. 3,3 miljardia emäsparia kliinisesti

Lisätiedot

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä

Lisätiedot

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän

Lisätiedot

NIPT. Non-invasiivinen prenataalitutkimus

NIPT. Non-invasiivinen prenataalitutkimus NIPT Non-invasiivinen prenataalitutkimus Non-invasiivinen prenataalitutkimus, NIPT B -NIPT-D ATK 8598 Non-invasiivinen prenataalitutkimus B -NIPTlaa ATK 8599 Non-invasiivinen prenataalitutkimus, laaja

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Molekyylidiagnostiikka keuhkosyövän hoidossa Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Sidonnaisuudet Taloudelliset riippuvuudet: Konsultointi: - Tutkimusrahoitus: - Honorariat:

Lisätiedot

Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi

Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Annika Rökman sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Oma taustani FM genetiikka 1998 sairaalageneetikko 2004 FT Perinnöllisestä eturauhassyövästä 2004 Finaksen teknisenä arvioijana vuodesta

Lisätiedot

Mikä on ns. multiplex-pcr tutkimus?

Mikä on ns. multiplex-pcr tutkimus? Sidonnaisuudet kahden viimeisen vuoden ajalta Multiplex-PCR ym. uudet monianalyyttimenetelmät - Laboratorion näkökulma Dos., osastonylilääkäri Maija Lappalainen HUSLAB, Virologian ja immunologian osasto

Lisätiedot

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012

Lisätiedot

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY T043 Liite 1.05 / Appendix 1.05 Sivu / Page 1(5) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY FIMLAB MEDICAL LABORATORIES LTD Tunnus Code Yksikkö tai toimintoala

Lisätiedot

KOHDENNETTU MISEQ- EKSONISEKVENSOINTI KÄYTTÄEN SEQCAP- GEENIKIRJASTOASETELMAA JA ALZHEIMERIN TAUTITAPAUKSIA

KOHDENNETTU MISEQ- EKSONISEKVENSOINTI KÄYTTÄEN SEQCAP- GEENIKIRJASTOASETELMAA JA ALZHEIMERIN TAUTITAPAUKSIA KOHDENNETTU MISEQ- EKSONISEKVENSOINTI KÄYTTÄEN SEQCAP- GEENIKIRJASTOASETELMAA JA ALZHEIMERIN TAUTITAPAUKSIA Tiina Karkiainen Opinnäytetyö Lääketieteen koulutusohjelma Itä-Suomen yliopisto Terveystieteiden

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.

Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5. Sarkoomien syto- ja molekyyligenetiikkaa Iina Tuominen, FT Erikoistuva sairaalasolubiologi Tyks-Sapa-liikelaitos IAP:n kevätkokous 12.5.2016 Iina.Tuominen@tyks.fi Genetiikan tutkimukset sarkoomien diagnostiikassa

Lisätiedot

Rintasyövän perinnöllisyys

Rintasyövän perinnöllisyys Lääketieteellisen genetiikan kurssi 17.9.2012 Rintasyövän perinnöllisyys Perinnöllinen syöpäalttius - esimerkkinä rintasyöpä Kristiina Aittomäki, dos. ylilääkäri Genetiikan vastuuyksikköryhmä/huslab/hus

Lisätiedot

Uuden vieritestin käyttöönotto avoterveydenhuollossa

Uuden vieritestin käyttöönotto avoterveydenhuollossa Uuden vieritestin käyttöönotto avoterveydenhuollossa HUSLAB Kliininen kemia ja hematologia 2009 kemisti Paula Pohja-Nylander Tavallisimmat vieritestit avoterveydenhuollossa Hemoglobiini Anemiadiagnostiikka

Lisätiedot

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa

Lisätiedot

Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori

Lisätiedot

Keuhkosyövän uudet lääkkeet

Keuhkosyövän uudet lääkkeet Keuhkosyövän uudet lääkkeet Jarkko Ahvonen Syöpätautien erikoislääkäri Tampereen yliopistollinen sairaala Sidonnaisuudet Asiantuntijapalkkio Boehringer Ingelheim, Bristol-Myers Squibb, Lilly, MSD, Roche

Lisätiedot

Yleisimmät idiopaattiset interstitiaalipneumoniat ja tavalliset keuhkovauriot - avainasemassa moniammatillisuus

Yleisimmät idiopaattiset interstitiaalipneumoniat ja tavalliset keuhkovauriot - avainasemassa moniammatillisuus Yleisimmät idiopaattiset interstitiaalipneumoniat ja tavalliset keuhkovauriot - avainasemassa moniammatillisuus 12.11.2015 IAP Tampere Airi Jartti Elisa Lappi-Blanco Sidonnaisuudet Luentopalkkioita Oy

Lisätiedot

Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:

Lisätiedot

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA Robert Winqvist SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PROFESSORILIITON SYYSSEMINAARI TUTKIMUSTA KAIKKIEN HYÖDYKSI

Lisätiedot

Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen

Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen eksoneissa 2, 3 ja 4) varmistaminen on tärkeää ennen Erbitux (setuksimabi) -hoidon aloittamista

Lisätiedot

LÄNNEN SOKERI. Merja Laine 15.5.2012

LÄNNEN SOKERI. Merja Laine 15.5.2012 LÄNNEN SOKERI Merja Laine 15.5.2012 Sidonnaisuudet Työnantaja: Vantaan kaupunki Ammatinharjoittajana lääkärikeskus Mehiläinen Kuulun aikuisten lihavuuden käypä hoito -työryhmään. Kuulun diabeteksen käypä

Lisätiedot

Polvipunktionäytteiden bakteeriperäisen DNA:n mittaaminen ja sen optimointi uuden sukupolven sekvensoinnin avulla

Polvipunktionäytteiden bakteeriperäisen DNA:n mittaaminen ja sen optimointi uuden sukupolven sekvensoinnin avulla Polvipunktionäytteiden bakteeriperäisen DNA:n mittaaminen ja sen optimointi uuden sukupolven sekvensoinnin avulla Elsa Öistämö Syventa vien opintojen kirjallinen tyo Tampereen yliopisto La a ketieteen

Lisätiedot

Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

NYT MEILTÄ MYÖS LONZAN JA GREINERIN LAATUTUOTTEET MM. SOLUVILJELYYN! HYÖDYNNÄ MAHTAVAT CST-KAMPANJAT!

NYT MEILTÄ MYÖS LONZAN JA GREINERIN LAATUTUOTTEET MM. SOLUVILJELYYN! HYÖDYNNÄ MAHTAVAT CST-KAMPANJAT! Science whereyou are Tarjoukset voimassa 30.10.2014 asti kampanjakoodilla FIN301014FIN. Kampanjahinnat ilman arvonlisäveroa. NYT MEILTÄ MYÖS LONZAN JA GREINERIN LAATUTUOTTEET MM. SOLUVILJELYYN! HYÖDYNNÄ

Lisätiedot

HUSLABIN TULEVAISUUDEN ORGANISAATIO

HUSLABIN TULEVAISUUDEN ORGANISAATIO HUSLABIN TULEVAISUUDEN ORGANISAATIO SKKY ry:n ja Sairaalakemistit ry:n syyskoulutuspäiv ivät t 31.10.2013 Toimitusjohtaja Piia Aarnisalo, HUSLAB 31.10.2013 1 SUOMEN JOHTAVA KLIINISTEN LABORTORIOPALVELUIDEN

Lisätiedot

Prosessien hallinta. Lean-näkökulma laboratorion prosessien kehittämiseen ja hallintaan

Prosessien hallinta. Lean-näkökulma laboratorion prosessien kehittämiseen ja hallintaan Prosessien hallinta Lean-näkökulma laboratorion prosessien kehittämiseen ja hallintaan Tommi Jokiniemi Kehittämispäällikkö Viitekehykset Luennoitsija: Biofysiikan ja lääketieteellisen tekniikan DI 15v

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

FIMM Technology Services FIMM:n teknologiapalvelut 1

FIMM Technology Services FIMM:n teknologiapalvelut 1 FIMM Technology Services FIMM:n teknologiapalvelut 1 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based

Lisätiedot

Genomitieto kliinikon apuna nyt ja tulevaisuudessa

Genomitieto kliinikon apuna nyt ja tulevaisuudessa Genomitieto kliinikon apuna nyt ja tulevaisuudessa Helena Kääriäinen Tutkimusprofessori 19.3.2014 Genomitieto / Helena Kääriäinen 1 Mistä kliinikosta puhumme? Kliinisistä geeneetikoista eli perinnöllisyyslääkäreistä?

Lisätiedot

Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa

Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa Timo Kanninen, Biocomputing Platforms Oy 2012 all rights reserved BC Platforms genomisen datan hallintaa Geneettisen

Lisätiedot

Muuttuva diagnostiikka avain yksilöityyn hoitoon

Muuttuva diagnostiikka avain yksilöityyn hoitoon Muuttuva diagnostiikka avain yksilöityyn hoitoon Olli Carpén, Patologian professori, Turun yliopisto ja Patologian palvelualue, TYKS-SAPA liikelaitos ChemBio Finland 2013 EGENTLIGA HOSPITAL FINLANDS DISTRICT

Lisätiedot

JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN

JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN Anne Vaittinen Maisterintutkielma Helsingin yliopisto Maataloustieteiden laitos HEBIOT Biotekniikka

Lisätiedot

Positiivisesta seulonnasta sopivien verien löytymiseen

Positiivisesta seulonnasta sopivien verien löytymiseen Positiivisesta seulonnasta sopivien verien löytymiseen Anu Korhonen, FM, SPR Veripalvelu Laboratoriolääketiede 2014 ja näyttely 1 1 1 1 1 Veren sopivuustutkimukset Ennen verensiirtoa punasoluvalmisteiden

Lisätiedot

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa TYÖSUOJELURAHASTO 21.2..2015 LOPPURAPORTTI: Työterveyslaitoksen osuus Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit eipienisoluisissa keuhkosyövissä ja mesotelioomassa

Lisätiedot

Komplementtitutkimukset

Komplementtitutkimukset Komplementtitutkimukset Hanna Jarva HUSLAB ja Haartman-instituutti Bakteriologian ja immunologian osasto Komplementti osa luontaista immuunijärjestelmää koostuu yli 30 proteiinista aktivoituu kaskadimaisesti

Lisätiedot

Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan. Minna Äikäs. Metropolia Ammattikorkeakoulu. Bioanalyytikko (AMK)

Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan. Minna Äikäs. Metropolia Ammattikorkeakoulu. Bioanalyytikko (AMK) Minna Äikäs Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan Metropolia Ammattikorkeakoulu Bioanalyytikko (AMK) Koulutusohjelma Opinnäytetyö 23.4.2014 Tiivistelmä Tekijä

Lisätiedot

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa

Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa Tietoa työstä Tupakointiin ja asbestialtistukseen liittyvät diagnostiset ja hoidolliset biomarkkerit ei-pienisoluisissa keuhkosyövissä ja mesotelioomassa LOPPURAPORTTI TYÖSUOJELURAHASTOLLE Sakari Knuutila

Lisätiedot

Iäkkään muistipotilaan masennuksen hoito

Iäkkään muistipotilaan masennuksen hoito Iäkkään muistipotilaan masennuksen hoito Sinikka Luutonen Psykiatrian dosentti, geriatrian erikoislääkäri Turun yliopisto ja VSSHP/Psykiatrian tulosalue Sidonnaisuudet toiminut luennoitsijana terveydenhuollon

Lisätiedot

Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet

Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet Pia Österlund el, dosentti Kliininen opettaja HY/HYKS syöpätaudit 29 elokuuta 2014 Sidonnaisuudet Palkkioita ja/tai matkakorvauksia: Amgen, Bayer,

Lisätiedot

FIMM Technology Services FIMM:n teknologiapalvelut 1

FIMM Technology Services FIMM:n teknologiapalvelut 1 FIMM Technology Services FIMM:n teknologiapalvelut 1 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based

Lisätiedot

Harvinaissairauksien yksikkö. Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta. Taustaa. Alfa-tryptasemia. 21/03/16 /ms

Harvinaissairauksien yksikkö. Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta. Taustaa. Alfa-tryptasemia. 21/03/16 /ms Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta Taustaa EDS potilasyhdistys ja yksittäinen potilas ovat lähestyneet HYKS harvinaissairauksien yksikköä ja pyytäneet lausuntoa, minkälainen sairaus Ehlers-Danlos

Lisätiedot

Henkilökohtainen riski vs. yhteisön etu? Tutkimukset terveillä vapaaehtoisilla. Etiikan päivä 12.3.2015 Mika Scheinin Turun yliopisto ja Tyks

Henkilökohtainen riski vs. yhteisön etu? Tutkimukset terveillä vapaaehtoisilla. Etiikan päivä 12.3.2015 Mika Scheinin Turun yliopisto ja Tyks Henkilökohtainen riski vs. yhteisön etu? Tutkimukset terveillä vapaaehtoisilla Etiikan päivä 12.3.2015 Mika Scheinin Turun yliopisto ja Tyks Mika Scheinin 12.3.2015: sidonnaisuudet lääkeyrityksiin Yksityisen

Lisätiedot

Virtsan kemiallisen seulonnan kliininen käyttö. Dosentti Martti L.T. Lalla Osastonylilääkäri HUSLAB Kirurginen sairaala 4.2.2009

Virtsan kemiallisen seulonnan kliininen käyttö. Dosentti Martti L.T. Lalla Osastonylilääkäri HUSLAB Kirurginen sairaala 4.2.2009 Virtsan kemiallisen seulonnan kliininen käyttö Dosentti Martti L.T. Lalla Osastonylilääkäri HUSLAB Kirurginen sairaala Virtsa elimistön tietolähteenä Virtsa - ensimmäinen kehon aine, jonka tutkiminen yhdistettiin

Lisätiedot

Toiminnallisten kohtauspotilaiden psykiatrinen arviointi ja hoito. OYL, Dos Tero Taiminen Yleissairaalapsykiatrian yksikkö TYKS

Toiminnallisten kohtauspotilaiden psykiatrinen arviointi ja hoito. OYL, Dos Tero Taiminen Yleissairaalapsykiatrian yksikkö TYKS Toiminnallisten kohtauspotilaiden psykiatrinen arviointi ja hoito OYL, Dos Tero Taiminen Yleissairaalapsykiatrian yksikkö TYKS Työnantaja: VSSHP Sidonnaisuudet Ei omistuksia terveydenhuoltoalan yrityksissä

Lisätiedot

Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.

Lisätiedot

HPV-epidemiologiasta ja diagnostiikasta

HPV-epidemiologiasta ja diagnostiikasta HPV-epidemiologiasta ja diagnostiikasta Eeva Auvinen dosentti, vs. laboraattori HUSLAB Kliininen mikrobiologia, virologia Labquality 15.10.2004 1 Papilloomavirukset Ihmisillä ja useilla muilla eläinlajeilla,

Lisätiedot

TUKI kyselyjen tulokset. Pientä tunnuslukujen tarkastelua TUKI-projektissa (diat 31-35)

TUKI kyselyjen tulokset. Pientä tunnuslukujen tarkastelua TUKI-projektissa (diat 31-35) TUKI kyselyjen tulokset TUKI-projektiin osallistuneiden osastojen (n=7) hoitotyöntekijöiden vastausten kooste 2010 tuloksia ja 2011 tuloksia (diat 2-30) Pientä tunnuslukujen tarkastelua TUKI-projektissa

Lisätiedot

SAATTOHOITOPÄÄTÖS. Palliatiivisen hoidon seminaari 26.4.13 Diakonia-ammattikorkeakoulu Urpo Hautala

SAATTOHOITOPÄÄTÖS. Palliatiivisen hoidon seminaari 26.4.13 Diakonia-ammattikorkeakoulu Urpo Hautala SAATTOHOITOPÄÄTÖS Palliatiivisen hoidon seminaari 26.4.13 Diakonia-ammattikorkeakoulu Urpo Hautala Urpo Hautala Laitospalveluiden ylilääkäri Sastamalan seudun sosiaali- ja terveyspalvelut Yleislääketieteen

Lisätiedot

Sidonnaisuudet. Tuberkuloosi, toteaminen ja hoito. Milloin epäilen tuberkuloosia perusterveydenhuollossa 06.10.2015

Sidonnaisuudet. Tuberkuloosi, toteaminen ja hoito. Milloin epäilen tuberkuloosia perusterveydenhuollossa 06.10.2015 Sidonnaisuudet Tuberkuloosi, toteaminen ja hoito Tuula Vasankari Dos., el Pääsihteeri Filha ry Valtakunnallinen TB hoidon asiantuntijaryhmä, pj 8.10.2015 Filha WHO IUATLD TB-Net STM THL Ei lääketeollisuussidonnaisuuksia

Lisätiedot

Biopankki: ideasta käytäntöön

Biopankki: ideasta käytäntöön Biopankki: ideasta käytäntöön Kimmo Pitkänen Kehittämispäällikkö Suomen molekyylilääketieteen instituutti FIMM European Biotech Week, Biomedicum 2.10.2013 FIMM - Institute for Molecular Medicine Finland

Lisätiedot

Järjestelmäarkkitehtuuri (TK081702) Pilvipalvelut. Pilvipalvelut - lähtökohtia

Järjestelmäarkkitehtuuri (TK081702) Pilvipalvelut. Pilvipalvelut - lähtökohtia Järjestelmäarkkitehtuuri (TK081702) Pilvipalvelut Pilvipalvelut Nouseva toteutustekniikka ja trendi Kuluttajat edellä, yritykset perässä Paino sanalla Palvelu Yhtenäisyyksiä vuosikymmenten taakse, sovelletaan

Lisätiedot

LÄÄKÄRI HOITAJA - TYÖPARITYÖSKENTELYSTÄKÖ RATKAISU? Kehittämispäällikkö Eija Peltonen

LÄÄKÄRI HOITAJA - TYÖPARITYÖSKENTELYSTÄKÖ RATKAISU? Kehittämispäällikkö Eija Peltonen LÄÄKÄRI HOITAJA - TYÖPARITYÖSKENTELYSTÄKÖ RATKAISU? Kehittämispäällikkö Eija Peltonen Eija Peltonen 1 Vastaanoton menetystekijät 6. Maaliskuuta 2006 Hyvät vuorovaikutustaidot Ammattitaito Väestövastuu

Lisätiedot

Uutta melanoomasta. Pia Vihinen TYKS/Syöpäklinikka. Tutkimukset kun epäilet melanooman leviämistä

Uutta melanoomasta. Pia Vihinen TYKS/Syöpäklinikka. Tutkimukset kun epäilet melanooman leviämistä Uutta melanoomasta Pia Vihinen TYKS/Syöpäklinikka Tutkimukset kun epäilet melanooman leviämistä Vartalon TT tutkimus tai PET-TT Verikokeet; Hb, maksa-arvot, krea Korkea LDH huonon ennusteen merkki PAD:

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

Immunohistokemia HPV-muutosten ja tavallisten gynekologisten adenokarsinoomien diagnostiikassa. Elisa Lappi-Blanco OYS, patologian osasto

Immunohistokemia HPV-muutosten ja tavallisten gynekologisten adenokarsinoomien diagnostiikassa. Elisa Lappi-Blanco OYS, patologian osasto Immunohistokemia HPV-muutosten ja tavallisten gynekologisten adenokarsinoomien diagnostiikassa Elisa Lappi-Blanco OYS, patologian osasto Gynekopatologian tavallisia ongelmia HPV-muutosten vaikeusasteen

Lisätiedot

Tuberkuloosin immunodiagnostiset testit. Dosentti Tamara Tuuminen, kliinisen mikrobiologian erl HY, HUSLAB Labquality 02.11.2007

Tuberkuloosin immunodiagnostiset testit. Dosentti Tamara Tuuminen, kliinisen mikrobiologian erl HY, HUSLAB Labquality 02.11.2007 Tuberkuloosin immunodiagnostiset testit Dosentti Tamara Tuuminen, kliinisen mikrobiologian erl HY, HUSLAB Labquality 02.11.2007 HUSLAB:n testivalikoima ELISPOT= Ly-TbSpot Mittaa IFNγ tuottavien solujen

Lisätiedot

Synlab Kansainvälisen laboratoriotoimijan laajentuminen Suomeen. Heikki Aaltonen 31.10.2013

Synlab Kansainvälisen laboratoriotoimijan laajentuminen Suomeen. Heikki Aaltonen 31.10.2013 Synlab Kansainvälisen laboratoriotoimijan laajentuminen Suomeen Heikki Aaltonen 31.10.2013 31.10.2013 Synlab Euroopan suurin laboratoriotoimija Eurooppa Noin miljoona analyysia päivässä Noin 7 000 työntekijää

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri

Lisätiedot

Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012

Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012 Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012 Anna-Elina Lehesjoki, LKT Professori, tutkimusjohtaja Neurotieteen tutkimuskeskus, Helsingin yliopisto Lääketieteellisen genetiikan

Lisätiedot

Kilpirauhasen kasvaimet NYKYLUOKITUS 21.11.2012

Kilpirauhasen kasvaimet NYKYLUOKITUS 21.11.2012 Kilpirauhasen kasvaimet NYKYLUOKITUS 21.11.2012 Johanna Arola Aikakauskirja Duodecim Patologian osasto Haartman-instituutti ja HUSLAB Sidonnaisuudet Kirjoituspalkkiot Kustannus OY Duodecim Aikakauskirja

Lisätiedot

Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja

Lisätiedot

VASTAUSANALYYSI / HYVÄN VASTAUKSEN PIIRTEET

VASTAUSANALYYSI / HYVÄN VASTAUKSEN PIIRTEET LÄÄKETIETEELLISTEN ALOJEN VALINTAKOE 20.5.2015 VASTAUSANALYYSI / HYVÄN VASTAUKSEN PIIRTEET Vastausanalyysi julkaistaan välittömästi valintakokeen päätyttyä. Analyysin tavoitteena on antaa valintakokeeseen

Lisätiedot

Seminar 24.1.2014. Wet chemistry alliance Synthetic chemistry

Seminar 24.1.2014. Wet chemistry alliance Synthetic chemistry *not as active students 24.1.2014 Kaivosvesiasioiden verkostoitumistilaisuus UEF Farmasia Wet Chemistry Alliance Seminar 24.1.2014 Wet chemistry alliance Synthetic chemistry Prof. J. Vepsäläinen (UEF)

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

VIDEOVÄLITTEINEN OPETUS

VIDEOVÄLITTEINEN OPETUS VIDEOVÄLITTEINEN OPETUS Anne Mohn, Tiina Tarr, VSSHP, TYKS Leena Salminen, Turun yliopisto, hoitotieteen laitos, Minna Syrjäläinen-Lindberg, Yrkeshögskolan Novia Teija Franck, Turun AMK Terveydenhuollon

Lisätiedot

Kokemuksia Mistä sitä tietää kampanjasta 1.2.2008

Kokemuksia Mistä sitä tietää kampanjasta 1.2.2008 Kokemuksia Mistä sitä tietää kampanjasta 1.2.2008 Hiv-säätiö / Aids-tukikeskus Suunnittelija Marja Pakarinen marja.pakarinen@aidstukikeskus.fi p. 0207 465 772 Mistä sitä tietää -turvaseksikampanja Miksi

Lisätiedot

OPPIMATERIAALIA DNA:N SEKVENSOINNISTA

OPPIMATERIAALIA DNA:N SEKVENSOINNISTA Suvi Myllylä OPPIMATERIAALIA DNA:N SEKVENSOINNISTA Itseopiskelumateriaalin ja harjoitustyöohjeen tuottaminen DNA:n sekvensoinnista OPPIMATERIAALIA DNA:N SEKVENSOINNISTA Itseopiskelumateriaalin ja harjoitustyöohjeen

Lisätiedot

Virtaussytometrian perusteet

Virtaussytometrian perusteet Virtaussytometrian perusteet 11.2.2016 Sorella Ilveskero LT, erikoislääkäri Virtaussytometrian perusteet ja käyttö kliinisessä laboratoriossa virtaussytometrian periaate virtaussytometrinen immunofenotyypitys

Lisätiedot

Kokoelmat kotona vai maailmalla? - kirjastojen kokoelmapolitiikan muutos säilyttäjästä saatavuuden varmistajaksi

Kokoelmat kotona vai maailmalla? - kirjastojen kokoelmapolitiikan muutos säilyttäjästä saatavuuden varmistajaksi Jarmo Saarti Kokoelmista vapautetut aineistojen poistaminen kirjaston kokoelmista 1.11.2010 Kokoelmat kotona vai maailmalla? - kirjastojen kokoelmapolitiikan muutos säilyttäjästä saatavuuden varmistajaksi

Lisätiedot

Uudet tekniikat infektio- diagnostiikassa

Uudet tekniikat infektio- diagnostiikassa Uudet tekniikat infektio- diagnostiikassa Labquality Days 5.2.2015 Kaisu Rantakokko-Jalava Tyks mikrobiologia ja genetiikka VSSHP Tyks-Sapa-liikelaitos Uusia tuulia kl. mikrobiologiassa MALDI-TOF bakteerien

Lisätiedot

Glaukooman hoito Lapin sairaanhoitopiirissä 3.12.2009 Marko Ollila

Glaukooman hoito Lapin sairaanhoitopiirissä 3.12.2009 Marko Ollila Glaukooman hoito Lapin sairaanhoitopiirissä 3.12.2009 Marko Ollila Taustaa Oikeusasiamies Riitta-Leena Paunio 29.4.2004: Kunnalla on velvollisuus järjestää kroonisen glaukooman hoito ja sen seuraamiseksi

Lisätiedot

Alueellisen hoito-ohjeen implementointi Rohto-pajoissa parantaa antikoagulaatiohoidon kirjaamista ja potilasturvallisuutta

Alueellisen hoito-ohjeen implementointi Rohto-pajoissa parantaa antikoagulaatiohoidon kirjaamista ja potilasturvallisuutta Alueellisen hoito-ohjeen implementointi Rohto-pajoissa parantaa antikoagulaatiohoidon kirjaamista ja potilasturvallisuutta Puhakka J, Helsingin tk, tkl Suvanto I, Helsingin tk, oh Sipilä R, Rohto-keskus

Lisätiedot

Tietohallinto. Johanna Koivistoinen Tekstiviestipalvelut ja Itseilmoittautuminen. Arki sujuu helpommin, kun apu löytyy läheltä.

Tietohallinto. Johanna Koivistoinen Tekstiviestipalvelut ja Itseilmoittautuminen. Arki sujuu helpommin, kun apu löytyy läheltä. Tietohallinto Johanna Koivistoinen Tekstiviestipalvelut ja Itseilmoittautuminen Arki sujuu helpommin, kun apu löytyy läheltä. Historiaa.. Tietohallinto 2012 Tekstiviestipalveluita terveydenhuollossa Ajanvarauksen

Lisätiedot

Hyvä tasalaatuisuus laboratoriossa. ISLAB, Joensuun aluelaboratorio Marja Liehu 11.2.2016

Hyvä tasalaatuisuus laboratoriossa. ISLAB, Joensuun aluelaboratorio Marja Liehu 11.2.2016 Hyvä tasalaatuisuus laboratoriossa ISLAB, Joensuun aluelaboratorio Marja Liehu 11.2.2016 KUOPIO KYS Iisalmen aluesairaala Pieksämäen aluesairaala Varkauden aluesairaala Harjulan sairaala JOENSUU Pohjois-Karjalan

Lisätiedot

Helsingin kaupunki Esityslista 9/2013 1 (5) Sosiaali- ja terveyslautakunta Sotep/33 4.6.2013

Helsingin kaupunki Esityslista 9/2013 1 (5) Sosiaali- ja terveyslautakunta Sotep/33 4.6.2013 Helsingin kaupunki Esityslista 9/2013 1 (5) 33 Kohdunkaulan syövän seulontatutkimusten hankinta HUSLABliikelaitokselta Pöydälle 14.05.2013 HEL 2013-006323 T 02 08 02 01 Päätösehdotus Esittelijä Taustaa

Lisätiedot

Yrityselämän tarpeet ja nuorten valmiudet työelämään. Toimitusjohtaja Lauri Sipponen

Yrityselämän tarpeet ja nuorten valmiudet työelämään. Toimitusjohtaja Lauri Sipponen Yrityselämän tarpeet ja nuorten valmiudet työelämään Toimitusjohtaja Lauri Sipponen Lidlin synty Lidlin historia 70-luku Ensimmäinen Lidl-myymälä avataan 1973 Ludwigshafen-Mundenheimissa 80-luku Laajentuminen

Lisätiedot

HIV-pikatesti Jukka Suni osastonlääkäri HUSLAB / virologian osasto

HIV-pikatesti Jukka Suni osastonlääkäri HUSLAB / virologian osasto HIV-pikatesti Jukka Suni osastonlääkäri HUSLAB / virologian osasto WHO:n hyväksymiä HIV-pikatestejä Näitä käytetään USAssa FDA/USA: hyväksytyt HIVpikatestit OraQuick Advance - whole blood -oral fluid -plasma

Lisätiedot

Mitä jokaisen keuhkolääkärin tulee tietää Suomalaisesta IPFrekisteristä? Marjukka Myllärniemi, keuhkolääkäri, Dosentti, Akatemiatutkija

Mitä jokaisen keuhkolääkärin tulee tietää Suomalaisesta IPFrekisteristä? Marjukka Myllärniemi, keuhkolääkäri, Dosentti, Akatemiatutkija Mitä jokaisen keuhkolääkärin tulee tietää Suomalaisesta IPFrekisteristä? Marjukka Myllärniemi, keuhkolääkäri, Dosentti, Akatemiatutkija Marjukka Myllärniemi Sidonnaisuudet Luentopalkkio: Pfizer, Mundipharma,

Lisätiedot

Kysely lähetettiin postikyselynä 1 000 Työterveysasemalle osoitettuna vastaavalle työterveyslääkärille. Kyselyyn saatiin yhteensä 228 vastausta.

Kysely lähetettiin postikyselynä 1 000 Työterveysasemalle osoitettuna vastaavalle työterveyslääkärille. Kyselyyn saatiin yhteensä 228 vastausta. MIELENTERVEYS TYÖELÄMÄSSÄ -KYSELYN TULOKSET TYÖTERVEYSLÄÄKÄRIT Kysely lähetettiin postikyselynä 1 000 Työterveysasemalle osoitettuna vastaavalle työterveyslääkärille. Kyselyyn saatiin yhteensä 228 vastausta.

Lisätiedot

Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt.

Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt. Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt.fi Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari

Lisätiedot

Vastasyntyneiden aineenvaihduntaseula. 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka

Vastasyntyneiden aineenvaihduntaseula. 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka Vastasyntyneiden aineenvaihduntaseula 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka Esityksen tavoitteet Ymmärrät mistä tässä on kyse Seulontoja on erilaisia Näyte otetaan vauvasta Ketään ei

Lisätiedot

Terveyskeskusten ja NordLabin yhteistyö. Leila Risteli johtava lääkäri 26.3.2015

Terveyskeskusten ja NordLabin yhteistyö. Leila Risteli johtava lääkäri 26.3.2015 Terveyskeskusten ja NordLabin yhteistyö johtava lääkäri 26.3.2015 1 Laboratoriotutkimus on osa potilaan hoitoprosessia 2 Tavoitteenamme on taata kliinikkolääkärille laboratoriotutkimusten tulokset oikea-aikaisesti,

Lisätiedot

Laboratoriolääketiede ja näyttely 6. 7.10.2016

Laboratoriolääketiede ja näyttely 6. 7.10.2016 Laboratoriolääketiede ja näyttely 6. 7.10.2016 To 6.10. aamupäivä Verikeskuksen ja hoitoyksikön yhteistyö pj Katja Salmela 09.15 09.30 Verikeskuksen ja hoitoyksikön yhteistyö, Katja Salmela, LT, el, verikeskukset,

Lisätiedot

HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA

HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA HARVINAISTEN PERINNÖLLISTEN SAIRAUKSIEN LABORATORIODIAGNOSTIIKKA B-DNAmut-tutkimusnimikkeellä tehdyt lähetteet Fimlab Laboratoriot Oy:n genetiikan laboratoriossa vuosina 2013 ja 2014 Olli Kemppainen Emilia

Lisätiedot

HARVINAISSAIRAUKSIEN YKSIKKÖ VSSHP

HARVINAISSAIRAUKSIEN YKSIKKÖ VSSHP HARVINAISSAIRAUKSIEN YKSIKKÖ VSSHP Jussi Mertsola Prof, toimialuejohtaja Lasten ja nuorten klinikka, TYKS 7.10.2015 Harvinaiset sairaudet sairauaa on korkeintaan 1 / 2000 ihmistä kohden harvinaissairauksia

Lisätiedot

Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016

Lisätiedot

Miten terveydenhuolto selviytyy tietotekniikan haasteista? -genetiikan näkökulmasta. Arto Orpana, FT, dos. Ylikemisti HUSLAB Genetiikan laboratorio

Miten terveydenhuolto selviytyy tietotekniikan haasteista? -genetiikan näkökulmasta. Arto Orpana, FT, dos. Ylikemisti HUSLAB Genetiikan laboratorio Miten terveydenhuolto selviytyy tietotekniikan haasteista? -genetiikan näkökulmasta Arto Orpana, FT, dos. Ylikemisti HUSLAB Genetiikan laboratorio Miten tietotekniikka selviytyy terveydenhuollon haasteista?

Lisätiedot

Aurinkosähkön mahdollisuudet maatilalla. Lauri Hietala Solarvoima OY. www.solarvoima.fi. www.solarvoima.fi

Aurinkosähkön mahdollisuudet maatilalla. Lauri Hietala Solarvoima OY. www.solarvoima.fi. www.solarvoima.fi Aurinkosähkön mahdollisuudet maatilalla Lauri Hietala Solarvoima OY Toteuttaa avaimet käteen -periaatteella aurinkosähköratkaisuita kotiin, mökille, maatilalle ja teollisuuteen Omat asentajat Tuotteina

Lisätiedot

Laboratoriolääketiede ja näyttely 6. 7.10.2016

Laboratoriolääketiede ja näyttely 6. 7.10.2016 Laboratoriolääketiede ja näyttely 6. 7.10.2016 To 6.10. aamupäivä Verikeskuksen ja hoitoyksikön yhteistyö pj Katja Salmela 09.15 09.30 Verikeskuksen ja hoitoyksikön yhteistyö, Katja Salmela, LT, el, verikeskukset,

Lisätiedot

Minikampus Moniammatillinen opetuspoliklinikka. Opetushoitaja Eija Huovinen Jyväskylän yliopisto, Agora 8.12.2015

Minikampus Moniammatillinen opetuspoliklinikka. Opetushoitaja Eija Huovinen Jyväskylän yliopisto, Agora 8.12.2015 Minikampus Moniammatillinen opetuspoliklinikka Opetushoitaja Eija Huovinen Jyväskylän yliopisto, Agora 8.12.2015 KSSHP MONIAMMATILLINEN OPETUSPOLIKLINIKKA/ PIENTOIMENPITEET Jyväskylässä kirurgian kandien

Lisätiedot

Työikäisten harvinaisemmat muistisairaudet 12.10.2011. Anne Remes Neurologian dosentti, kliininen opettaja Oulun yliopisto

Työikäisten harvinaisemmat muistisairaudet 12.10.2011. Anne Remes Neurologian dosentti, kliininen opettaja Oulun yliopisto Työikäisten harvinaisemmat muistisairaudet 12.10.2011 Anne Remes Neurologian dosentti, kliininen opettaja Oulun yliopisto Luonteen muuttuminen Kognition muuttuminen FTD: Frontotemporaalinen dementia Muu

Lisätiedot

Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö

Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ituepidemia ja VTEC -tutkimukset elintarvikkeista Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ajankohtaista laboratoriorintamalla / 12.10.2011 EHEC-ITUEPIDEMIAN VAIHEITA: Vahva signaali epidemiasta

Lisätiedot

Gliooman uusista hoitosuosituksista. Heikki Minn

Gliooman uusista hoitosuosituksista. Heikki Minn Gliooman uusista hoitosuosituksista Heikki Minn Onkologiapäivät, Turku 30.8.2013 Sidonnaisuudet Konsulttina ja/tai kliinisenä tutkijana seuraavissa lääketieteellistä toimintaa harjoittavissa yrityksissä

Lisätiedot

Elinkeinoelämän keskusliitto ja Palvelualat Ry, kutsuvierastilaisuus Finlandia talo, 28.11.2009

Elinkeinoelämän keskusliitto ja Palvelualat Ry, kutsuvierastilaisuus Finlandia talo, 28.11.2009 Case Keminmaa Yksityiset palvelut julkisessa palveluntuotannossa Elinkeinoelämän keskusliitto ja Palvelualat Ry, kutsuvierastilaisuus Finlandia talo, 28.11.2009 Puhujat Keminmaan kunnan esittely ja taustaa

Lisätiedot