Tuotantoeläinten jalostus ja geenitekniikka

Save this PDF as:

Koko: px
Aloita esitys sivulta:

Download "Tuotantoeläinten jalostus ja geenitekniikka"


1 Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT

2 Tänään: Eläinjalostus eristyisesti tuotantoeläinjalostus Biotekniikka - Geenitekniikka jv1 Genomiikka Genomin rakenteen ja toiminnan kartoitus Genominen valinta

3 Dia 2 jv1 Juha Vilkki;

4 Eläinjalostus Tuotantoeläinjalostus Seuraeläimet Työeläimet Urheilu ja harraste

5 Mittaukset, Tuotannon tarkkailu Talous Biologia Ekologia Etiikka Paritusohjelma JALOSTUS- TAVOITE Keinosiemennys Alkionsiirto Jalostusarvostelu Sukulaistuminen, Sukupolven väli Riski

6 Pohjoismainen jalostustavoite Tuotantotalous, laatu, terveys- ja hyvinvointi (ympäristö) Lypsykarja Nordic Total Merit NTM Tuotos Hedelmällisyys Syntymäindeksi Poikimaindeksi Utareterveys Muut hoidot Runko Jalkarakenne Utarerakenne Lypsettävyys Luonne Kestävyys Kasvuindeksi (maito,rasva, valkuainen) (5 eri osa-aluetta) (vasikkan omin.) (emän ominaisuus) (terveystarkkailu, maidon soluluku) Siat Lihantuotanto-ominaisuudet K-indeksi Rehunkäyttökyky Kasvukyky Teuraominaisuudet Lihanlaatuominaisuudet Porsastuotanto-ominaisuudet H-indeksi Pahnuekoko Porsimaväli Porsaskuolleisuus Rakenneominaisuudet Jalat Liikuntapisteet Nisät

7 Pohjoismainen jalostustavoite Tuotantotalous, laatu, terveys- ja hyvinvointi (ympäristö) Lypsykarja Siat Nordic Total Merit NTM Eläinten jalostustavoite K-indeksi käsittää Tuotos (maito,rasva, valkuainen) monipuolisesti kaikki Hedelmällisyys (5 eri osa-aluetta) taloudellisesti tärkeät ominaisuudet: Syntymäindeksi Poikimaindeksi Utareterveys Muut hoidot Runko Jalkarakenne Utarerakenne Lypsettävyys Luonne Kestävyys Kasvuindeksi Pohjoismainen jalostusprofiili (vasikkan omin.) (emän ominaisuus) (terveystarkkailu, maidon soluluku) Tuotanto Tuotelaatu Eläinten hyvinvointi Ympäristökuormitus Lihantuotanto-ominaisuudet Rehunkäyttökyky Kasvukyky Teuraominaisuudet Lihanlaatuominaisuudet Porsastuotanto-ominaisuudet H-indeksi Pahnuekoko Porsimaväli Porsaskuolleisuus Rakenneominaisuudet Jalat Liikuntapisteet Nisät

8 Geenitekniikka ja eläinjalostus I 1. Muuntogeeniset eläimet Tuotantoeläimet - käytännössä vaikea toteuttaa (tuotanto-ominaisuuksien takana runsaasti geenejä) - kallis menetelmä - eettiset ongelmat: eläinten hyvinvointi, ympäristöriskit, terveys - lähinnä kala (kana), Tautimallit (esim. Sika/Alzheimer); Farmaseuttinen tuotanto 2. Geenikartoitus ja merkkiavusteinen valinta 3. Genominen valinta

9 Geenitekniikka ja eläinjalostus II 1. Muuntogeeniset eläimet 2. Geenikartoitus ja merkkiavusteinen valinta Joko: - geeni tunnettu Tai: - vaikuttavan geenimuodon todennäköisyys voidaan ennustaa ympäröivien geenimerkkien avulla - geeni ja geenimerkki kytkentäepätasapainossa Voidaan hyödyntää: 1. Nostamassa arvosteluvarmuutta jalostusarvostelussa 2. Voidaan välttää haitallisia (letaaleja) heterotsygotteja - geenitestit 3. Geenin tunnisteena roturisteytyksissä 3. Genominen valinta

10 Geenien kartoitus? Tavoitteena tunnistaa jalostettaviin ominaisuuksiin vaikuttava DNA-tason muuntelu, jota voitaisiin hyödyntää merkkiavusteisessa valinnassa ja ominaisuuksien biologian ymmärtämisessä Nautatutkimuksessa optimaaliset perherakenteet (keinosiemennys > isot puolisisar-perheet) ja sukupolvien tiedot kvantitatiivisista ominaisuuksista (jälkeläisarvostelu -> jalostusarvot) isoisä pojat jälkeläisarvostelu pojantyttäret

11 SCC m tk,hh m tk r%, v% m SCC v m tk,hh m, v% r% UT hh UT SCC v%, v, m, r tk r, r% UT hh v%,scc hh UT,SCC hh v% m UT, m SCC m, SCC v% SCC v% hh m, v tk r% SCC m, v SCC m, v tk Ayrshire-lehmien perimän kartoituksessa löytyneet alueet

12 Hienokartoituksella tuotetaan valintamerkkejä useita kromosomialueita hienokartoitettu (kansainvälisenä yhteistyönä) kytkeytyneiden DNA-merkkien tai geenimuutosten löytämiseksi MTT mukana patenttihakemuksissa: maidon valkuaispitoisuuteen vaikuttava muutos GHR-geenissä (Holland Genetics, LIC -> käyttöoikeus Suomessa), maitotuotoksiin vaikuttava markkeri PRLR-geenissä (FABA Jalostus), utaretulehdus-alttiuteen vaikuttavat markkerihaplotyypit kromosomeissa 9 ja 11 (MTT,DIAS,EAU)

13 Geenitekniikka ja eläinjalostus III 1. Muuntogeeniset eläimet 2. Geenikartoitus ja merkkiavusteinen valinta 3. Genominen valinta Genominen arvostelu Genominen valintaohjelma

14 SNP-merkit mahdollistavat: Tiheän genotyypityksen QTL geenikartoituksessa hyödynnetty lähinnä mikrosatelliitteja Tiheät kytkentäkartat: DNA:n emäsjärjestyksen yksittäisten nukleotidien vaihtelua (single nucleotide polymorphism, SNP). Naudan genomin kattavat SNP-kokoelmat kaupallisesti saatavilla (SNP mikrosirut: Affymetrix 25K, Illumina 50K) Ennennäkemätön mahdollisuus QTL vaikutusten tunnistamiseen

15 Käsitteet: Genomi ja SNP-merkki Naudan genomi 30 kromosomia, joka kromosomi on yksi pitkä DNA molekyyli DNA koostuu emäspareista A,T,C,G miljoonaa emäsparia Kirjoita koko koodi paperirullalle: Käytä konekirjoitustekstiä: Paperiliuskasta 6000 km pitkä Helsingistä Intiaan! Kuva:

16 Yksittäisen emäksen polymorfismi - SNP SNP-merkki kertoo onko juosteessa tietyllä paikalla tietty emäs A,G,T,C Koko genomi skannataan käyttäen ns. SNP geenimerkkejä Tarvitaan riittävä tiheys, nyt käytössä on SNP merkkiä kattava SNP setti Jalostusarvo +322 kg SNP=1 0 1 ATATGATACGTCTACATACGCGATACGCGAGAGCGGCATATGATACGTCTACATACGCGATACGGCGAGAGCGGCATTGATACGTCTACATACGCGATACGGCGAGAGCGGCATATGATACG

17 Esimerkki genomi... Koko genomi kirjoitettuna paperille oli 6000 km SNP merkkiä: SNP merkki keskimäärin 100 metrin välein emäsmerkin välein ATATACGATACGTCTCATACTGGA

18 Genominen arvostelu ja valinta

19 Jälkeläisarvostellut sonnit (~ ) Luotettavat arvostelut terveydestä tuotoksesta, ym Genotyypitykset joka sonnista 50,000 SNP merkkiä Genominen Jalostusarvostelu Vaihe I Genomisen mallin ratkaisut SNP vaikutukset (50,000 SNP)

20 Genominen Jalostusarvostelu Vaihe II Keinosiemennyssonnivasikat Sonninemäkandidaatit, yms. Genotyypitykset joka sonnista 50,000 SNP merkkiä Genotyypitykset 50,000 SNP merkkiä Genomisen mallin ratkaisut SNP vaikutukset ( 50,000 SNP) Genomiset jalostusarvot

21 Keinosiemennysjalostusohjelma NYT 4 isäsonnia Sonninemät parhaat sonnivasikkat Nuorsonnit Ikä 1 v testisiemennykset odotusaika 10 Valio sonnia Tyttärien tuotokset Ikä 5 vuotta!

22 Keinosiemennysjalostusohjelma NYT 4 isäsonnia Sonninemät parhaat sonnivasikkat Nuorsonnit Tullessaan Keinosiemennyssonnin isäksi testisiemennykset sonni on 6-7 vuotias Ikä 1 v odotusaika 10 Valio sonnia Tyttärien tuotokset Ikä 5 vuotta!

23 Esimerkki genomisesta valinnasta Sonninemät Parhaat Sonnivasikat: Genotyypitys 20 Valio sonnia Jälkeläisarvostelut Ikä 1-2 v

24 Genominen valintaohjelma 1. Lyhyt sukupolven väli Geneettinen edistyminen jopa kaksikertainen 2. Suurin hyöty saadaan vaikeasti mitattavissa ominaisuuksissa, kuten terveys- ja kestävyysominaisuuksissa 3. Parantaa jalostustoiminnan kustannustehokkuuta Alussa iso investointi kehitystyöhön Genomiset jalostusarvosteluyhtälöt ovat rotu/populaatio -kohtaisia! Tulevaisuudessa vähentää testaustarvetta

25 Genominen valinta on jo käytössä Kaupalliset SNP-mikrosirut ovat olleet saatavissa USA, Canada, Uusi-Seelanti, Alankomaat, Ranska, Saksa,Austraalia genotyypittäneet keinosiemennyssonnia Genomiset arvostelut virallisesti käytössä USAssa, Kandassa ja Hollannissa. Suomi, Ruotsi ja Tanska perustaneet yhteisen projektin genomisen valintaohjelman kehittämiseksi Viking Genetics (Tanska ja Ruotsi), Faba Palvelu ja Faba Jalostus, Svensk Mjölk MTT, Aarhus University, Uppsala lantbruksuniversitet Genotyypitetty n Holstein ja 1500 Pohjoismaista punaista sonnia

26 Yhteenveto Uusi genomianalyysi antaa mahdollisuuden jalostusarvoltaan parhaiden eläinten tunnistamiseen Tuotteiden laatu, tuotantotalous, eläinten hyvinvointi: kaikki elintarviketuotannon kannalta tärkeät jalostettavat ominaisuudet Koko genomin kattava tiheä genotyypitys (SNP-sirut) tarjoaa mahdollisuuden kaikkien geenivaikutusten mallintamiseen kerralla Suuri vaikutus koko eläinjalostusohjelmaan Pohjoismailla potentiaalisesti suurin mahdollisuus hyötyä (koska suurin etu saavutettavissa ns. ei-tuotanto-ominaisuuksiin) Genominen arvostelu on suurin bioteknikkavallankumous sitten keinosiemennyksen!

Jalostus on merkittävä tuotantopanos

Jalostus on merkittävä tuotantopanos Jalostus on merkittävä tuotantopanos Nuorsonnit poistuvat - genomisonnit tilalle Jalostusohjelma muuttuu Pirkko Taurén pirkko.tauren@faba.fi Jalostustyön vaiheet Seuranta (geneettinen edistyminen) ja muutokset


NAV-jalostusarvojen julkaisu - Laskenta-aineisto ja julkaisukriteerit

NAV-jalostusarvojen julkaisu - Laskenta-aineisto ja julkaisukriteerit NAV-jalostusarvojen julkaisu - Laskenta-aineisto ja julkaisukriteerit Esitellään million eri eläinryhmät saavat julkaisukelpoiset NAVjalostusarvot 3 ryhmää: Ryhmä 1 Kaikki ks-sonnit, joiden jalostusarvojen


Uutisia NAVin rutiiniarvostelu 13. elokuuta 2013

Uutisia NAVin rutiiniarvostelu 13. elokuuta 2013 Uutisia NAVin rutiiniarvostelu 13. elokuuta 2013 Uudet pohjoismaiset jalostusarvostelut on laskettu NTM-kokonaisjalostusarvolle, tuotos- ja rakenneominaisuuksille, hedelmällisyydelle, utareterveydelle,


Uutisia NAVin rutiiniarvostelu 14. elokuuta 2012

Uutisia NAVin rutiiniarvostelu 14. elokuuta 2012 Uutisia NAVin rutiiniarvostelu 14. elokuuta 2012 Uudet pohjoismaiset jalostusarvostelut on laskettu NTM-kokonaisjalostusarvolle, tuotos- ja rakenneominaisuuksille, hedelmällisyydelle, utareterveydelle,


Essi Nikula. Genominen valinta mukaan sonnivalintaan

Essi Nikula. Genominen valinta mukaan sonnivalintaan Essi Nikula Genominen valinta mukaan sonnivalintaan Opinnäytetyö Syksy 2009 Maa- ja metsätalouden yksikkö Maaseutuelinkeinojen Koulutusohjelma Kotieläintuotanto SEINÄJOEN AMMATTIKORKEAKOULU Opinnäytetyön


Uutisia NAVin rutiiniarvostelu 2. helmikuuta 2012

Uutisia NAVin rutiiniarvostelu 2. helmikuuta 2012 Uutisia NAVin rutiiniarvostelu 2. helmikuuta 2012 Uudet pohjoismaiset jalostusarvostelut on laskettu NTM-kokonaisjalostusarvolle, tuotos- ja rakenneominaisuuksille, hedelmällisyydelle, utareterveydelle,



GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus GENOMINEN VALINTA HEVOSJALOSTUKSESSA Markku Saastamoinen MTT Hevostutkimus Genominen valinta genomisessa valinnassa eläimen jalostusarvo selvitetään DNA:n sisältämän perintöaineksen tiedon avulla Genomi


INTERBULL - jalostusarvot

INTERBULL - jalostusarvot Elokuu 2017 INTERBULL - jalostusarvot Sisältö: Kansainväliset Interbull-jalostusarvot on julkaistu seuraaville roduille ja ominaisuuksille 8.8.2017: Jälkeläisarvostellut sonnit: Tuotos Rakenne Utareterveys


Miten? 20.3.2015. Sorkkien ja jalkojen terveys jalostettavina ominaisuuksina. Terveysjalostus on haastavaa. Terveyden merkitys.

Miten? 20.3.2015. Sorkkien ja jalkojen terveys jalostettavina ominaisuuksina. Terveysjalostus on haastavaa. Terveyden merkitys. Sorkkien ja jalkojen terveys jalostettavina ominaisuuksina Jukka Pösö Faba/NAV Terveysjalostus on haastavaa Terveys- ja hedelmällisyysominaisuuksien periytymisasteet ovat alhaisia Erot eläinten välillä


Uutisia - NAVin rutiiniarvostelu 2. toukokuuta 2013

Uutisia - NAVin rutiiniarvostelu 2. toukokuuta 2013 Uutisia - NAVin rutiiniarvostelu 2. toukokuuta 2013 Uudet pohjoismaiset jalostusarvostelut on laskettu NTM-kokonaisjalostusarvolle, tuotos- ja rakenneominaisuuksille, hedelmällisyydelle, utareterveydelle,


1. Muutoksia edelliseen (huhtikuu 2014) arvostelun jälkeen:

1. Muutoksia edelliseen (huhtikuu 2014) arvostelun jälkeen: Elokuu 2014 INTERBULL - jalostusarvot Sisältö: 1. Muutokset edelliseen arvosteluun verrattuna 2. Tuotos 3. Rakenne 4. Solut ja utareterveys 5. Kestävyys 6. Poikimaominaisuudet 7. Hedelmällisyys 8. Lypsettävyys


INTERBULL - jalostusarvot

INTERBULL - jalostusarvot Huhtikuu 2017 INTERBULL - jalostusarvot Sisältö: 1. Tuotos 2. Rakenne 3. Solut ja utareterveys 4. Kestävyys 5. Poikimaominaisuudet 6. Hedelmällisyys 7. Lypsettävyys ja luonne 8. NTM 9. Muutoksia edellisen


Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja


INTERBULL - jalostusarvot

INTERBULL - jalostusarvot Huhtikuu 2016 INTERBULL - jalostusarvot Sisältö: 1. Tuotos 2. Rakenne 3. Solut ja utareterveys 4. Kestävyys 5. Poikimaominaisuudet 6. Hedelmällisyys 7. Lypsettävyys ja luonne 8. NTM 9. Muutoksia edellisen


Lypsykarjan tuotosseurannan tulokset 2015

Lypsykarjan tuotosseurannan tulokset 2015 Lypsykarjan tuotosseurannan tulokset 2015 Sanna Nokka, ProAgria Keskusten Liitto Tulosseminaari 5.4.2016 Tuotosseurannan raakadata rikastuu tiedoksi Asiakas Tiedon käsittely Laskenta Tilastot, tutkimus,


Avainsanat: BI5 III Biotekniikan sovelluksia 7.Kasvin- ja eläinjalostuksella tehostetaan ravinnontuotantoa.

Avainsanat: BI5 III Biotekniikan sovelluksia 7.Kasvin- ja eläinjalostuksella tehostetaan ravinnontuotantoa. Avainsanat: kasvinjalostus eläinjalostus lajike risteytysjalostus itsepölytteinen ristipölytteinen puhdas linja heteroosi hybridilajike ylläpitojalostus geneettinen eroosio autopolyploidia allopolyploidia


MaitoManagement 2020. Risteytysopas

MaitoManagement 2020. Risteytysopas Risteytysopas Lypsyrotujen risteytys on lisääntynyt maailmalla. Suomessa perimältään heikkotasoisia lypsylehmiä siemennetään yleisesti liharotuisten sonnien siemenellä, mutta eri lypsyrotujen risteyttäminen


Geenitutkimusta: evoluutiosta kohti geenivarojen suojelua ja jalostusta

Geenitutkimusta: evoluutiosta kohti geenivarojen suojelua ja jalostusta Geenitutkimusta: evoluutiosta kohti geenivarojen suojelua ja jalostusta 19.10.2016 Metsätieteen päivä Outi Savolainen, Oulun yliopisto, Genetiikan ja fysiologian tutkimusyksikkö Käyttölisenssi: CC BY 4.0


INTERBULL - jalostusarvot

INTERBULL - jalostusarvot Elokuu 2015 INTERBULL - jalostusarvot Sisältö: 1. Tuotos 2. Rakenne 3. Solut ja utareterveys 4. Kestävyys 5. Poikimaominaisuudet 6. Hedelmällisyys 7. Lypsettävyys ja luonne 8. NTM 9. Muutoksia edellisen



OMINAISUUKSIEN MITTAAMINEN JALOSTUKSESSA OMINAISUUKSIEN MITTAAMINEN JALOSTUKSESSA MMT Markku Saastamoinen MTT Hevostalous Ypäjä Saksanpaimenkoiraliiton kasvattajapäivät Tampere 10.10.2010 hevosjalostus = menetelmät, joilla kehitetään hevoskantaa


INTERBULL - jalostusarvot

INTERBULL - jalostusarvot Huhtikuu 2015 INTERBULL - jalostusarvot Sisältö: 1. Tuotos 2. Rakenne 3. Solut ja utareterveys 4. Kestävyys 5. Poikimaominaisuudet 6. Hedelmällisyys 7. Lypsettävyys ja luonne 8. NTM 9. Muutoksia edellisen


Kansainväliset interbull-indeksit on julkaistu seuraaville ominaisuuksille :

Kansainväliset interbull-indeksit on julkaistu seuraaville ominaisuuksille : Elokuu 2013 INTERBULL - indeksit Kansainväliset interbull-indeksit on julkaistu seuraaville ominaisuuksille 13.8.2013: Ominaisuus(ryhmä): Tuotos Rakenne Utareterveys Kestävyys Poikimaominaisuudet Hedelmällisyys


1. Muutokset edelliseen (elokuu 2013) arvosteluun verrattuna:

1. Muutokset edelliseen (elokuu 2013) arvosteluun verrattuna: Joulukuu 2013 INTERBULL - indeksit Sisältö: 1. Muutokset edelliseen arvosteluun verrattuna 2. Tuotos 3. Rakenne 4. Solut ja utareterveys 5. Kestävyys 6. Poikimaominaisuudet 7. Hedelmällisyys 8. Lypsettävyys


Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt.

Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt. Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt.fi Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari


Kestävyyttä. +alv 24 %

Kestävyyttä. +alv 24 % Kestävyyttä 1800 +alv 24 % Herralan Asmo Kikin emä Puromäen Inka Alkioiden vanhempien tiedot löydät seuraavilta sivuilta. Alkiovaraukset ja lisätiedot Katarina Hägg, kahag@vikinggenetics.com tai puh. 040


Sianjalostus tänään. Timo Serenius, Figen Oy. Snellman Group

Sianjalostus tänään. Timo Serenius, Figen Oy. Snellman Group Sianjalostus tänään Timo Serenius, Figen Oy Timo Serenius 4.6.2015 Snellman Group Genetiikka on sianlihantuotannon ensimmäinen viestiosuus Jalostusta tehdään tulevaisuuteen suunta on oltava oikea Mitä


Uutisia NAVin rutiiniarvostelu 1. marraskuuta 2016

Uutisia NAVin rutiiniarvostelu 1. marraskuuta 2016 Uutisia NAVin rutiiniarvostelu 1. marraskuuta 2016 Uudet pohjoismaiset jalostusarvostelut on laskettu NTM-kokonaisjalostusarvolle, tuotos- ja rakenneominaisuuksille, hedelmällisyydelle, utareterveydelle,


Genomisessa eläinmallissa käytetään sekä genotyypitettyjen että genotyypittämättömien eläinten tietoja

Genomisessa eläinmallissa käytetään sekä genotyypitettyjen että genotyypittämättömien eläinten tietoja Genomisessa eläinmallissa käytetään sekä genotyypitettyjen että genotyypittämättömien eläinten tietoja Minna Koivula, Ismo Strandén ja Esa Mäntysaari Luonnonvarakeskus Luke, FI-31600 Jokioinen e-mail.


Lypsykarjan tuotosseurannan tulokset 2016

Lypsykarjan tuotosseurannan tulokset 2016 Lypsykarjan tuotosseurannan tulokset 2016 Kuva: Sanna Nokka Sanna Nokka, ProAgria Keskusten Liitto 29.3.2017 ProAgria Maito tulosseminaari 2017 9:45 Tuotosseuranta-tilojen tuotokset vuodelta 2016, johtava


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


} Vastinkromosomit. Jalostusta selkokielellä. Miten niin voidaan jalostaa?

} Vastinkromosomit. Jalostusta selkokielellä. Miten niin voidaan jalostaa? Jalostusta selkokielellä Vuokatin jalostuskurssi 2015 Pirkko Taurén Miten niin voidaan jalostaa? Eri yksilöiden välillä on eroja Sukulaiset muistuttavat enemmän toisiaan kuin yksilöt keskimäärin Geenit


Kestävä lehmä taloudellisia näkökulmia lypsylehmän tuotantoikään

Kestävä lehmä taloudellisia näkökulmia lypsylehmän tuotantoikään Kestävä lehmä taloudellisia näkökulmia lypsylehmän tuotantoikään Anna-Maija Heikkilä, MTT, Taloustutkimus Kestävä lehmä -teemapäivä, Äänekoski 20.4.2011 Sisältö Lypsylehmien poistot Harkinnanvaraiset vs.


rakennearvostelussa Suomen Hippos ry/jalostuspalvelut

rakennearvostelussa Suomen Hippos ry/jalostuspalvelut Lineaarinen profilointi hevosten rakennearvostelussa Suvi Mäkeläinen Suomen Hippos ry/jalostuspalvelut Esityksen sisältö Johdanto Perinteinen rakennearvostelu Lineaarisen profiloinnin periaate Lineaarisen


Lineaarinen rakennearvostelu ja rakenneindeksit. Jukka Pösö Faba Jalostus

Lineaarinen rakennearvostelu ja rakenneindeksit. Jukka Pösö Faba Jalostus Lineaarinen rakennearvostelu ja rakenneindeksit Jukka Pösö Faba Jalostus Lineaarinen rakennearvostelu arvostellaan rakennetta/liikkumista yksityiskohtaisesti esimerkkejä: korkeus jalka-asennot: vuohinen


Ruokinnan teemavuosi

Ruokinnan teemavuosi Ruokinnan teemavuosi Ruokinnan teemavuosi Lisää maitoeuroja Halutaan säilyttää hyvä maitomäärä ja sen tasaisuus Rehukustannukset kohoavat, mutta maidon hinta on hyvällä tasolla hyvä maitotuotos kannattaa


Jalostusarvojen laskenta genomisella eläinmallilla

Jalostusarvojen laskenta genomisella eläinmallilla Jalostusarvojen laskenta genomisella eläinmallilla Minna Koivula, Esa Mäntysaari ja Ismo Strandén MTT, Biotekniikka- ja elintarviketutkimus, Biometrinen genetiikka, 31600 Jokioinen e-mail. etunimi.sukunimi(at)mtt.fi


Tarjouspaketti. +alv 24 %

Tarjouspaketti. +alv 24 % Tarjouspaketti 1200 +alv 24 % Asmo Julianan emä Korkiakosken Elena Alkioiden vanhempien tiedot löydät seuraavilta sivuilta. Alkiovaraukset ja lisätiedot Katarina Hägg, kahag@vikinggenetics.com tai puh.



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


13/05/14. Emolehmien kestävyysominaisuudet. Tässä esityksessä. Mistä kestävyys? Emolehmäseminaari 2014 Ikaalinen 04.02.

13/05/14. Emolehmien kestävyysominaisuudet. Tässä esityksessä. Mistä kestävyys? Emolehmäseminaari 2014 Ikaalinen 04.02. Emolehmien kestävyysominaisuudet Emolehmäseminaari 2014 Ikaalinen 04.02.2014 Maiju Pesonen Tässä esityksessä Kestävyyden anatomia Kolme kotimaista aineistoa: ü Poiston syyt ü Poikimahelppous/ poikimavaikeus


Utareterveyttä. +alv 24 %

Utareterveyttä. +alv 24 % Utareterveyttä 1800 +alv 24 % VR Friiari Alkioiden vanhempien tiedot löydät seuraavilta sivuilta. Alkiovaraukset ja lisätiedot Katarina Hägg, kahag@vikinggenetics.com tai puh. 040 178 0326 VR Falconin


MAKERA TUTKIMUSHANKE 2012-2013. Teräväpiirto genomitiedon hyödyntäminen jalostusarvosteluissa. HD Genomiikka

MAKERA TUTKIMUSHANKE 2012-2013. Teräväpiirto genomitiedon hyödyntäminen jalostusarvosteluissa. HD Genomiikka MAKERA TUTKIMUSHANKE 2012-2013 Teräväpiirto genomitiedon hyödyntäminen jalostusarvosteluissa HD Genomiikka High Definition genome wide information in genetic evaluations LOPPURAPORTTI Geneettinen Tutkimus


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


Loistopaketti. +alv 24 %

Loistopaketti. +alv 24 % Loistopaketti 1500 +alv 24 % VR Visio Alkioiden vanhempien tiedot löydät seuraavilta sivuilta. Alkiovaraukset ja lisätiedot Katarina Hägg, kahag@vikinggenetics.com tai puh. 040 178 0326 Asmo Kuutamon emänemänemä


Hiehoprosessin tehostamisella säästöjä ja lisää maitoeuroja

Hiehoprosessin tehostamisella säästöjä ja lisää maitoeuroja Hiehoprosessin tehostamisella säästöjä ja lisää maitoeuroja Tulosseminaari 24.4.2013 Minna Norismaa Cow Signals adviser ProAgria huippuosaaja- Lypsylehmien ruokinta, hyvinvointi ja terveys ProAgria Pohjois-Karjala


Jalostuksen sähköinen oppimateriaali

Jalostuksen sähköinen oppimateriaali Elina Junikka & Taru Hietakangas Jalostuksen sähköinen oppimateriaali Opinnäytetyö Kevät 2015 SeAMK Elintarvike ja maatalous, Ilmajoki Maaseutuelinkeinojen koulutusohjelma 2(30) SEINÄJOEN AMMATTIKORKEAKOULU


Jalostettavien ominaisuuksien sekä residuaalisen syönnin taloudelliset arvot suomalaisessa maidontuotannossa

Jalostettavien ominaisuuksien sekä residuaalisen syönnin taloudelliset arvot suomalaisessa maidontuotannossa Jalostettavien ominaisuuksien sekä residuaalisen syönnin taloudelliset arvot suomalaisessa maidontuotannossa P. Hietala 1, M. Wolfová 2, J. Wolf 2, J. Kantanen 3 ja J. Juga 1 1. Maataloustieteiden laitos,


Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine


Periytyvyys ja sen matematiikka

Periytyvyys ja sen matematiikka Periytyvyys ja sen matematiikka 30.7.2001 Katariina Mäki MMM,tutkija Helsingin yliopisto, Kotieläintieteen laitos / kotieläinten jalostustiede katariina.maki@animal.helsinki.fi Jalostuksen tavoitteena


Tuotosseurannan tulokset 2014. Sanna Nokka, ProAgria Keskusten Liitto

Tuotosseurannan tulokset 2014. Sanna Nokka, ProAgria Keskusten Liitto Tuotosseurannan tulokset 2014 Sanna Nokka, ProAgria Keskusten Liitto Tuotosseuranta 2014 6 180 karjaa: 73 % kaikista, verrattuna ed. vuoteen -4,8%. Kokonaisuutena tilamäärä väheni 5,4 % ed. vuoteen verrattuna


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


Tuotosseurannan tulokset 2013

Tuotosseurannan tulokset 2013 Tuotosseurannan tulokset 2013 ProTuotos 2013 6 489 karjaa: 72 % kaikista, verrattuna ed. vuoteen -5,5%. Kokonaisuutena tilamäärä väheni 6,3 % ed. vuoteen verrattuna 228 954 lehmää: 81 % kaikista, lehmämäärän


Ruotsin meijeriyhdistys edistää maidontuotantoa ja maitotuotteiden kulutusta. www.svenskmjolk.se/english

Ruotsin meijeriyhdistys edistää maidontuotantoa ja maitotuotteiden kulutusta. www.svenskmjolk.se/english Ruotsin meijeriyhdistys edistää maidontuotantoa ja maitotuotteiden kulutusta www.svenskmjolk.se/english Ruotsin meijeriyhdistyksen asiantuntijatiedon ketju Ravitsemus & gastronomia Maidon laatu Ympäristöasiat



2/8/2011 VAROITUS TAVOITTEENA PERIMÄNMUKAINEN KOIRANJALOSTUS KVANTITATIIVINEN PERIYTYMINEN LUENNON SISÄLTÖ VAROITUS TAVOITTEENA PERIMÄNMUKAINEN KOIRANJALOSTUS Esitys on tehty vahvasti nautanäkökulmasta: Naudanjalostus on suurelta osin ollut hyvin järkiperäistä ja vailla tunteita, vain päämäärä on ollut tärkeä


KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli



SUOMALAISEN RATSUPONIN JALOSTUSOHJESÄÄNTÖ Suomen Hippos ry Evira vahvistanut 11.08.2015 SUOMALAISEN RATSUPONIN JALOSTUSOHJESÄÄNTÖ 1. Suomalainen ratsuponi (SRP) Suomalainen ratsuponi on SRP kantakirjaan ensirekisteröity ratsuponi, joka polveutuu


LSK-populaation sukulaisuusrakenteen tervehdyttäminen. Terhi Vahlsten, Faba osk. Katarina Hägg ja Seppo Niskanen, Viking Genetics

LSK-populaation sukulaisuusrakenteen tervehdyttäminen. Terhi Vahlsten, Faba osk. Katarina Hägg ja Seppo Niskanen, Viking Genetics LSK-populaation sukulaisuusrakenteen tervehdyttäminen Terhi Vahlsten, Faba osk. Katarina Hägg ja Seppo Niskanen, Viking Genetics Aiheita: LSK-populaation nykytila Suunnitelma Suunnitelman toteutus Suunnitelman


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat



JALOSTUSTUTKIMUKSEN SUUNTIA JA TULOKSIA EUROOPASTA. Markku Saastamoinen MTT Hevostutkimus JALOSTUSTUTKIMUKSEN SUUNTIA JA TULOKSIA EUROOPASTA Markku Saastamoinen MTT Hevostutkimus perinteisestä suorituskyvyn jalostustavoitteissa ja tutkimuksessa on painopistettä siirretty kestävyyteen, terveyteen,


Hedelmällisyys ja talous

Hedelmällisyys ja talous Hedelmällisyys tuottamaan 7.10.2014 Toholampi Hedelmällisyys ja talous Juhani Taponen Helsingin yliopisto Kliinisen tuotantoeläinlääketieteen osasto Kotieläinten lisääntymistiede Hedelmällisyys heikentynyt


Kalanviljelyyn uusia lajeja Tiedosta ratkaisuja kestäviin valintoihin

Kalanviljelyyn uusia lajeja Tiedosta ratkaisuja kestäviin valintoihin Kalanviljelyyn uusia lajeja Juha Koskela Loppuseminaari 5.3.013 RKTL Helsinki Kilpailukykyä uusien viljelylajien avulla Arvokkaampien lajien viljelyn kehittämisellä haetaan Parempaa kannattavuutta tuomalla


Vastutuskykyistä Genetiikkaa. Ainoa yritys, joka tarjoaa parempaa vastustuskykyä periyttävää genetiikkaa

Vastutuskykyistä Genetiikkaa. Ainoa yritys, joka tarjoaa parempaa vastustuskykyä periyttävää genetiikkaa Vastutuskykyistä Genetiikkaa Ainoa yritys, joka tarjoaa parempaa vastustuskykyä periyttävää genetiikkaa 1 Dr. Bonnie Mallard Yli 100 tieteellistä julkaisua Department of Pathobiology, University of Guelph


Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa


Rotuvalinta liharoturisteytyksissä. Jalostuskurssi 2014 Tahkoa tuottoa! 19.3.2014, Nilsiä, Tahkovuori Arto Huuskonen MTT/Kotieläintuotannon tutkimus

Rotuvalinta liharoturisteytyksissä. Jalostuskurssi 2014 Tahkoa tuottoa! 19.3.2014, Nilsiä, Tahkovuori Arto Huuskonen MTT/Kotieläintuotannon tutkimus Rotuvalinta liharoturisteytyksissä Jalostuskurssi 2014 Tahkoa tuottoa! 19.3.2014, Nilsiä, Tahkovuori Arto Huuskonen MTT/Kotieläintuotannon tutkimus 18.3.2014 MAILI -hanke (Kilpailukykyä ja ympäristötehokkuutta


Sonniluettelo Ayrshire kesä 2017 Jälkeläisarvostellut

Sonniluettelo Ayrshire kesä 2017 Jälkeläisarvostellut Sonniluettelo Ayrshire kesä 2017 Jälkeläisarvostellut Prime DE LA PLAINE PRIME 0200AY00716 REALITY x MODEM GLPI +2436 Rek #: AYCANM106061020 aaa: 342156 DMS: 234 Syntynyt: 12/12/2009 Kappakaseiini: AE


Mitä Semexin sonnien jälkeläiset lypsävät Suomessa?

Mitä Semexin sonnien jälkeläiset lypsävät Suomessa? Mitä Semexin sonnien jälkeläiset lypsävät Suomessa? Maija Mäntysaari Opinnäytetyö Ammattikorkeakoulututkinto SAVONIA-AMMATTIKORKEAKOULU OPINNÄYTETYÖ Tiivistelmä Koulutusala Luonnonvara- ja ympäristöala


Pohjoismaisten punaisten rotujen hedelmällisyysarvostelu genomisella eläinmallilla

Pohjoismaisten punaisten rotujen hedelmällisyysarvostelu genomisella eläinmallilla Pohjoismaisten punaisten rotujen hedelmällisyysarvostelu genomisella eläinmallilla Kaarina Matilainen 1), Ismo Strandén 1), Anna-Maria Tyrisevä 1) ja Esa Mäntysaari 1) 1) Luonnonvarakeskus (Luke), Vihreä


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does


Uudistuneet tuotosseurannan palvelut

Uudistuneet tuotosseurannan palvelut Uudistuneet tuotosseurannan palvelut Kunnon Jalostuskurssi! Katinkulta Vuokatti 24.3.2015 ProAgria Keskusten liitto Tuotosseurannan kehittämisprojekti projektipäällikkö Heli Wahlroos Tuotosseurannan tavoite


Nuorsonnien siemenannosten käytön ja tyttärien seuranta

Nuorsonnien siemenannosten käytön ja tyttärien seuranta Nuorsonnien siemenannosten käytön ja tyttärien seuranta Sanna Kosonen Opinnäytetyö Ammattikorkeakoulututkinto SAVONIA-AMMATTIKORKEAKOULU OPINNÄYTETYÖ Tiivistelmä Koulutusala Luonnonvara- ja ympäristöala


Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus

Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus Katri Kärkkäinen Matti Haapanen Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus Katri Kärkkäinen ja Matti Haapanen Metsäntutkimuslaitos Vantaan tutkimuskeskus


Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset


Angus. Esityksen kulku 27.2.2012. Angus rotupäivä Kuopio 24.2.2012 Maiju Pesonen

Angus. Esityksen kulku 27.2.2012. Angus rotupäivä Kuopio 24.2.2012 Maiju Pesonen Angus Angus rotupäivä Kuopio 24.2.2012 Maiju Pesonen Esityksen kulku Miksi angus on suosittu? Rodun ominaisuuksia Jalostustavoitteita Haasteita Entä miellä Suomessa? 1 Angus on käytetyin liharotu Pohjois-


Suomalaista sukua. +alv 24 %

Suomalaista sukua. +alv 24 % Suomalaista sukua 1800 +alv 24 % VR Ylpeys ET Alkioiden vanhempien tiedot löydät seuraavilta sivuilta. Alkiovaraukset ja lisätiedot Katarina Hägg, kahag@vikinggenetics.com tai puh. 040 178 0326 Asmo Kirsikan


GPA LPI PRO$ 1150 JH1F JH2F. TUOTOS G Karjoja G Tyttäriä 64% arv.varm GPA 17*AUG. Maito kg 648. Rasva kg 36 TERVEYS JA HEDELMÄLLISYYS

GPA LPI PRO$ 1150 JH1F JH2F. TUOTOS G Karjoja G Tyttäriä 64% arv.varm GPA 17*AUG. Maito kg 648. Rasva kg 36 TERVEYS JA HEDELMÄLLISYYS Semex Finland Oy Jersey sonnit Syksy 2017 Balin AHLEM BALIN 0200JE01014 FRONTRUNNER x ACTION x IATOLA GPA LPI +1605 PRO$ 1150 JH1F JH2F Rek #: JEUSAM72520700 aaa: 234165 DMS: 126 Syntynyt: 12/24/2013 Kappakaseiini:


Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin


Rakennusinvestointi: -tuottavat lehmät vai susi jo syntyissään?

Rakennusinvestointi: -tuottavat lehmät vai susi jo syntyissään? Rakennusinvestointi: -tuottavat lehmät vai susi jo syntyissään? Terveydenhuoltoeläinlääkäri Virpi Kurkela ProAgria Oulu Navettainvestoinnin Tavoite Toimiva, tuottava tila Vähemmän työtä/eläin Enemmän laadukasta


Miten yhdistää ruoantuotanto ja eläinten hyvinvointi? Eläinten hyvinvointikeskus EHK, Luonnonvarakeskus Luke

Miten yhdistää ruoantuotanto ja eläinten hyvinvointi? Eläinten hyvinvointikeskus EHK, Luonnonvarakeskus Luke Miten yhdistää ruoantuotanto ja eläinten hyvinvointi? Eläinten hyvinvointikeskus EHK, Luonnonvarakeskus Luke Satu Raussi, FT, johtava asiantuntija Tiina Kauppinen, FT, erityisasiantuntija www.eläintieto.fi


Liharoturisteytykset lypsykarjatilalla

Liharoturisteytykset lypsykarjatilalla Liharoturisteytykset lypsykarjatilalla AgriFuture - Katse tulevaisuuteen tapahtuma 29.10.2014, Iisalmi Arto Huuskonen MTT/Kotieläintuotannon tutkimus 29.10.201 MAILI -hanke (Kilpailukykyä ja ympäristötehokkuutta


APH.YaguarET HfN 4282 FIN 000000004282 Kantakirjatodistus sivu 1/2 www.faba.fi

APH.YaguarET HfN 4282 FIN 000000004282 Kantakirjatodistus sivu 1/2 www.faba.fi APHYaguarET HfN 4282 FIN 000000004282 Kantakirjatodistus sivu 1/2 wwwfabafi Karjatiedot Karjatunnus Tulopäivä- ja tapa Omistaja Tila Kunta Osoite 140477 08032012 syntymä Moisander Juha Anttila Orimattila


Kehitä karjaasi alkioilla, huuhtele parhaat eläimesi. Peurunka Päivi Anttila

Kehitä karjaasi alkioilla, huuhtele parhaat eläimesi. Peurunka Päivi Anttila Kehitä karjaasi alkioilla, huuhtele parhaat eläimesi Peurunka 9.11.2016 Päivi Anttila Miksi alkioita Uutta hyvää eläinainesta Uutta genetiikkaa omaan karjaan Helppo tapa hankkia eläinainesta ulkomailta


Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi

Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi 19.05.2014 DNA:n sekvensointi DNA:n pilkotaan lyhyiksi mallipalasiksi, templaateiksi, joiden emäsjärjestys selvitetään.


Maitotalouden tila ja tulevaisuus Suomessa

Maitotalouden tila ja tulevaisuus Suomessa Meijeritieteellinen Seura ry:n vuosiseminaari teemana Maitotalouden tila ja tulevaisuus Suomessa Tieteiden talo Kirkkokatu 6, Helsinki 11.11.2015 in memoriam Meijeriopin professori (1964-1989) Matti Antila


Liharoturisteytykset lypsykarjatilalla

Liharoturisteytykset lypsykarjatilalla Liharoturisteytykset lypsykarjatilalla Maitoseminaari KoneAgriassa 11.10.2013, Jyväskylä Arto Huuskonen MTT/Kotieläintuotannon tutkimus 14.10.201 MAILI -hanke (Kilpailukykyä ja ympäristötehokkuutta pohjoissavolaisille


5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin


Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori


Eläinten hyvinvointi - mistä oikein puhutaan?

Eläinten hyvinvointi - mistä oikein puhutaan? Eläinten hyvinvointi - mistä oikein puhutaan? Anna Valros Eläinten hyvinvointitieteen professori Eläinlääketieteellinen tiedekunta Helsingin yliopisto Hyvinvointi on eläimen kokemus sen omasta psyykkisestä


GPA LPI PRO$ 1334 JH1F JH2F. TUOTOS G Karjoja G Tyttäriä 62% arv.varm GPA 16*DEC. Maito kg 696. Rasva kg 44 TERVEYS JA HEDELMÄLLISYYS

GPA LPI PRO$ 1334 JH1F JH2F. TUOTOS G Karjoja G Tyttäriä 62% arv.varm GPA 16*DEC. Maito kg 696. Rasva kg 44 TERVEYS JA HEDELMÄLLISYYS Sonniluettelo Jersey kevät 2017 Balin AHLEM BALIN 0200JE01014 FRONTRUNNER x ACTION GPA LPI +1685 PRO$ 1334 JH1F JH2F Rek #: JEUSAM72520700 aaa: 234165 DMS: 126 Syntynyt: 12/24/2013 Kappakaseiini: BB Beettakaseiini:



LIHAKARJAN RAKENNEARVOSTELU LIHAKARJAN RAKENNEARVOSTELU Suomessa lihakarjaa rakennearvostelevat Faban emolehmätarkkailuun erikoistuneet jalostusasiantuntijat. He arvostelevat kaikkia Suomessa olevia liharotuja. Rakennearvostelu perustuu


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista


GPA LPI PRO$ 1200 JH1F JH2F. TUOTOS G Karjoja G Tyttäriä 63% arv.varm GPA 17*APR. Maito kg 591. Rasva kg 36 TERVEYS JA HEDELMÄLLISYYS

GPA LPI PRO$ 1200 JH1F JH2F. TUOTOS G Karjoja G Tyttäriä 63% arv.varm GPA 17*APR. Maito kg 591. Rasva kg 36 TERVEYS JA HEDELMÄLLISYYS Sonniluettelo Jersey kesä 2017 Balin AHLEM BALIN 0200JE01014 FRONTRUNNER x ACTION GPA LPI +1627 PRO$ 1200 JH1F JH2F Rek #: JEUSAM72520700 aaa: 234165 DMS: 126 Syntynyt: 12/24/2013 Kappakaseiini: BB Beettakaseiini:


Simmental rotutavoitteita ja -ominaisuuksia. Katri Strohecker Finn Beef Ay

Simmental rotutavoitteita ja -ominaisuuksia. Katri Strohecker Finn Beef Ay Simmental rotutavoitteita ja -ominaisuuksia Katri Strohecker Finn Beef Ay Simmental Nuori liharotu Suomessa; ensimmäiset tuotu 1990 Alkuperä Sveitsissä; Simme-joen laakso Simmentaleja n. 40-60 miljoonaa


Lihakarjan jalostusta mualimalla. Katri Strohecker Finn Beef Ay

Lihakarjan jalostusta mualimalla. Katri Strohecker Finn Beef Ay Lihakarjan jalostusta mualimalla Katri Strohecker Finn Beef Ay Jalostajan tavoite! Jalostajan tärkein tavoite on parantaa eläinaineksen geneettistä (perinnöllistä) tasoa siten, että koko naudanlihatuotantosektori


ProAgria Keskusten Liitto, Sanna Nokka ja Tuija Huhtamäki

ProAgria Keskusten Liitto, Sanna Nokka ja Tuija Huhtamäki ProAgria Keskusten Liitto, Sanna Nokka ja Tuija Huhtamäki Yhteistä työsarkaa Maitomäärän pysyminen ja tasaisuus Navettainvestointien onnistuminen Uudiseläimet, ruokinta, kokonaisuuden johtaminen Nurmiviljelyn


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla 1. Avainsanat 2. Solut lisääntyvät jakautumalla 3. Dna eli deoksiribonukleiinihappo sisältää perimän


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


Aberdeen Angus. Texas Mount K002 TUONTISONNIESITTELYT

Aberdeen Angus. Texas Mount K002 TUONTISONNIESITTELYT Aberdeen Angus Texas Mount K002 Texas Mount on mielenkiintoinen australialainen huippusonni, jonka suku on täynnä meille osittain uusia kärkinimiä USAsta. Sonnin arvostelut ovat Australiassa erinomaiset:


Kasvit, eläimet, terveys - miten käytän luontoa apunani -

Kasvit, eläimet, terveys - miten käytän luontoa apunani - Kasvit, eläimet, terveys - miten käytän luontoa apunani - Tiina Harrinkari MMM, agr Maisematie 643, 39120 Mahnala Sposti: tiina.harrinkari @ netti.fi p. 040 700 1597 Luennon aihealueet 1. Syy: miksi ruokinta


Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa

Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa Timo Kanninen, Biocomputing Platforms Oy 2012 all rights reserved BC Platforms genomisen datan hallintaa Geneettisen
