Bioteknologian perustyökaluja

Save this PDF as:

Koko: px
Aloita esitys sivulta:

Download "Bioteknologian perustyökaluja"


1 Bioteknologian perustyökaluja

2 DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin avulla komplementaariseksi DNAksi (cdna) = ei introneita!

3 Katkaisuentsyymit (restriktioentsyymit) Bakteerien luontainen puolustuskeino. Pilkkovat DNAn halutusta kohdasta. Samalla entsyymillä katkaistut DNAt voidaan liittää helposti yhteen. Liittäjäentsyymit (ligaasit) Liittävät katkaistut juosteet yhteen. Yhdistävät myös eri alkuperää (eri lajeista) olevaa DNAta.


5 Polymeraasiketjureaktio (PCR) Tutkimuksia varten DNAta tarvitaan usein paljon PCR on DNAn monistuskone. Hyödynnetään mm. DNAn emäsjärjestyksen selvittämisessä eli sekvensoinnissa ja yksilöiden tunnistuksessa. DNA:n juosteet erkanevat kun lämpötilaa nostetaan mukaan alukkeita (pieniä pätkiä kyseisestä DNAsta), DNApolymeraasi ja nukleotideja. polymeraasi kasaa uudet juosteet alukkeiden välille kun lämpötilaa lasketaan alukkeiden väli on nelinkertaisena. sama toistetaan DNAn pätkää silmin erottuva määrä


7 Elektroforeesi Nukleiinihapot DNA ja RNA lievästi negatiivisesti varautuneita = kulkevat sähkökentässä kohti positiivista napaa. Menoa voidaan hidastaa laittamalla liikkumisalustaksi geeli. Mitä pidempi DNAn pätkä, sitä hitaammin se liikkuu.


9 Sekvenssointi Sekvenssointi = DNAn emäsjärjestyksen määrittäminen. Perinteinen Sanger-sekvenssointi yhä käytössä: 1. Monistetaan tutkittavaa DNAta PCR:llä. 2. Lisätään mukaan normaalien nukleotidien sekaan rikottuja nukleotideja. Näiden kohdalta DNA-polymeraasi ei kykene jatkamaan juosteen rakentamista. 3. Esim. lisätään rikottuja ja värimerkittyjä adeniininukleotideja saadaan erimittaisia DNA-pätkiä jotka kaikki päättyvät adeniiniin. 4. Ajetaan pätkät elektroforeesissa. 5. Nykyisin automatisoitu: eri väreillä merkityt juosteet kulkevat lasikapillareissa, ja kamera kuvaa niiden järjestyksen.

10 DNA-sirujen käyttö Tutkitaan sairausgeenien aktiivisuutta (geeniekspressiota). 1. Kiinnitetään sirulle (lasinen tai muovinen levy) tunnettuja sairauksiin johtavia geenejä (DNAta). 2. Eristetään tutkittavista soluista l-rnata 3. Muutetaan l-rnat käänteiskopioijaentsyymin avulla cdnaksi (ei introneita). 4. Yritetään saada cdna hybridisoitumaan (pariutumaan) sirulla olevan DNAn kanssa. 5. Jos näin käy, tutkittavissa soluissa olevat sairauteen johtavat geenit toimivat (tuottavat l- RNAta) yksilö on sairas tai sairastumassa.

11 Geenien sijainti kytkentäkartoituksella Meioosin vähennysjaossa kromosomien käsivarret menevät ristiin ja kromosomit vaihtavat palasia = kiasma (ilmiö = tekijäinvaihdunta). Kiasman todennäköisyys on suhteessa geenien väliseen etäisyyteen. Tunnettujen merkkigeenien periytyminen yhdessä tutkittavan geenin kanssa kertoo näiden välisen etäisyyden = saadaan selville geenin sijainti kromosomissa. Kun paikka on saatu selville, voidaan alue sekvenssoida erot sekvenssissä voivat paljastaa esim. sairauteen johtaneen mutaation (vertaa sirppisoluanemia).

12 Ihmisen raitavärjätyt kromosomit

13 Geenien ja emäsparien määrät kromosomeissa

14 Tehtävä 2 Etsi seuraavasta yksijuosteisesta nukleiinihappomolekyylistä kahden katkaisuentsyymin tunnistus- ja katkaisukohdat. Entsyymit ovat EcoRI (g/aattc) ja TaqI (t/cga); niiden tunnistuskohdat on annettu suluissa ja katkaisukohta on merkitty vinoviivalla. 5`gtttacagagcccttaggatcgacagatgttctatatcagaagggacattcaagaatggaaagaattccccggattacgtcctgctg gtgaaaacagctgttactttaattcgatcttatacctctgtgtggaccccctactgcatcaagctaactagcaa -3` Minkä mittaiset dna-pätkät katkaisuentsyymeillä tuotetaan (kirjoita pätkien pituudet ao. koeputkiin geelikuvan viereen)? Piirrä pätkät oikeille kohdilleen oheiseen geelikuvaan.

15 Vastaus tehtävään 2 5 gtttacagagcccttaggatcgacagatgttctatatcagaagggacattcaagaatggaaagaattccccggattacgtcctgctggtgaaaacagctgttactttaattcgatcttatacctctgtgtggaccccctact- gcatcaagctaactagcaa 3 Koeputkien vasemmalle puolelle tulee allekkain: EcoRI TaqI EcoRI& TaqI Vastaavat pätkät piirretään geelikuvaan noin 8 mm pystyviivoina (kts. asteikko geelikuvan yllä) omaa katkaisuentsyymiä (oikean laidan kolme päällekkäistä suorakaidetta) vastaavalle kohdalle riviin. Suorakaiteiden oikealle puolelle merkitään katkaisuentsyymien nimet: Ylimmän EcoRI, keskimmäisen suorakaiteen oikealle puolelle TaqI ja alimman suorakaiteen+pipetti oikealle puolelle EcoRI & TaqI


GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä

Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä Ekologiset ympäristöongelmat 10. Geeniteknologia Dna:n ja rna:n käsittely Eristäminen Puhdistaminen Lähetti-rna:t voidaan muuntaa niiden emäsjärjestystä vastaavaksi ns. komplementaariseksi dna:ksi (c-dna)


Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli


PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


Biologia ylioppilaskoe

Biologia ylioppilaskoe Biologia ylioppilaskoe 12 tehtävää, joista kahdeksaan (8) vastataan Tehtävät vaikeutuvat loppua kohden, jokeritehtävät merkitty +:lla Molempiin jokereihin saa vastata ja ne lasketaan mukaan kahdeksaan


Genetiikan perusteiden harjoitustyöt

Genetiikan perusteiden harjoitustyöt Genetiikan perusteiden harjoitustyöt Molekyylien kloonaus ja siihen liittyvät taidot ja temput, osa 1 Restriktioentsyymit, elektroforeesi Moniste sivulta 24-: Geenien kloonaus CELL 491- Isolating, cloning,


Francis Crick ja James D. Watson

Francis Crick ja James D. Watson Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel-palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän


Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.


DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla 1. Avainsanat 2. Solut lisääntyvät jakautumalla 3. Dna eli deoksiribonukleiinihappo sisältää perimän


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina.

b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina. Bi5 kertaustehtäviä, mallivastauksia 1. Selosta lyhyesti, missä sijaitsevat seuraavat solun osat: a) tumajyvänen b) keskusjyvänen (sentrioli, sentrosomi), c) soluneste, d) mitokondrio, e) solulimakalvosto


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Mitä tarkoitetaan biopolymeerilla? Mihin kolmeen ryhmään biopolymeerit voidaan jakaa? (1,5 p) Biopolymeerit ovat luonnossa esiintyviä / elävien solujen muodostamia polymeerejä / makromolekyylejä.


Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,


Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia

Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Genomi-ilmentyminen Genom expression (uttryckning) DNA RNA 7.12.2017 Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Osaamistavoitteet Lärandemål Luennon jälkeen ymmärrät pääperiaatteet


9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun


II Genetiikka 4.(3) Nukleiinihapot

II Genetiikka 4.(3) Nukleiinihapot II Genetiikka 4.(3) Nukleiinihapot Geenitekniikka - menetelmiä, joiden avulla dna:ta ja rna:ta voidaan eristää, muokata ja siirtää muihin soluihin tai eliöihin kromosomit koostuvat dna-rihmasta ja siihen



Genomin ylläpito TIINA IMMONEN MEDICUM BIOKEMIA JA KEHITYSBIOLOGIA Genomin ylläpito 5.12.2017 TIINA IMMONEN MEDICUM BIOKEMIA JA KEHITYSBIOLOGIA Luennon sisältö Tuman kromosomien rakenne ja pakkautuminen Pakkautumisen säätely: histonien modifikaatiot DNA:n kahdentuminen


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja



BIOLOGIAN OSIO (45 p.) BIOLÄÄKETIETEEN KOULUTUSOHJELMA PÄÄSYKOE 17.5.2017 BIOLOGIAN OSIO (45 p.) HYVÄN VASTAUKSEN PIIRTEET I) Esseetehtävät (2 kpl) a) Selitä perustellen, miten kuvaan merkittyihin kohtiin osuvat mutaatiot voivat


Molekyylibiologian perusmenetelmät

Molekyylibiologian perusmenetelmät 2 3 Molekyylibiologian perusmenetelmät 740151P Biokemian menetelmät I 26.9.2017 Juha Kerätär / BMTK Päivän aiheet Mitä on molekyylibiologia? Mitä ovat keskeiset molekyylibiologian menetelmät ja mihin ne


Molekyylibiologian perusmenetelmät P Biokemian menetelmät I Juha Kerätär / BMTK

Molekyylibiologian perusmenetelmät P Biokemian menetelmät I Juha Kerätär / BMTK Molekyylibiologian perusmenetelmät 740151P Biokemian menetelmät I 26.9.2017 Juha Kerätär / BMTK Päivän aiheet Mitä on molekyylibiologia? Mitä ovat keskeiset molekyylibiologian menetelmät ja mihin ne perustuvat?


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista


Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi)

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) CHEM-A1310 Biotieteen perusteet Heli Viskari 2017 DNA-harjoitustöiden aikataulu, valitse yksi näistä


Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan?

Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Antipodidiversiteetin generointi Robert Koch (TB) 1905 Niels K. Jerne


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein


Hyvä käyttäjä! Ystävällisin terveisin. Toimitus

Hyvä käyttäjä! Ystävällisin terveisin. Toimitus Hyvä käyttäjä! Tämä pdf-tiedosto on ladattu Tieteen Kuvalehden verkkosivuilta ( Tiedosto on tarkoitettu henkilökohtaiseen käyttöön, eikä sitä saa luovuttaa kolmannelle osapuolelle.


Kukan kehitystä säätelevien geenien molekyylikloonaus

Kukan kehitystä säätelevien geenien molekyylikloonaus Sanna Viitanen Kukan kehitystä säätelevien geenien molekyylikloonaus Opinnäytetyö Metropolia Ammattikorkeakoulu Terveys- ja hoitoala Bioanalytiikka Opinnäytetyö 15.5.2014 Tiivistelmä Tekijä(t) Otsikko


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset)

Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset) Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset) Hajottajia (lahottajat ja mädättäjät), patogeeneja (taudinaiheuttajia), tuottajia (yhteyttävät),


DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =


Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus


DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen

DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen DNA-testit sukututkimuksessa 28.11.2017 Keravan kirjasto Paula Päivinen Solu tuma kromosomit 23 paria DNA Tumassa olevat kromosomit periytyvät jälkeläisille puoliksi isältä ja äidiltä Y-kromosomi periytyy


Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa



SÄTEILYN TERVEYSVAIKUTUKSET SÄTEILYN TERVEYSVAIKUTUKSET 25 Säteily- ja ydinturvallisuus -kirjasarjan toimituskunta: Sisko Salomaa, Wendla Paile, Tarja K. Ikäheimonen, Roy Pöllänen, Anne Weltner, Olavi Pukkila, Jorma Sandberg, Heidi


Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93.

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93. 1 I) Ovatko väittämät oikein (O) vai väärin (V)? Jos väite on mielestäsi väärin, perustele se lyhyesti väittämän alla oleville riveille. O/V 1.2. Downin oireyhtymä johtuu pistemutaatista fenyylialaniinin


Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does


Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio



UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA LIITU-päivä 4.5.2006 FT Helena Rintala Kansanterveyslaitos, Ympäristöterveyden osasto Mihin sisäympäristön mikrobien mittauksia tarvitaan? Rakennusten


Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen



VASTAUSANALYYSI / HYVÄN VASTAUKSEN PIIRTEET LÄÄKETIETEELLISTEN ALOJEN VALINTAKOE 20.5.2015 VASTAUSANALYYSI / HYVÄN VASTAUKSEN PIIRTEET Vastausanalyysi julkaistaan välittömästi valintakokeen päätyttyä. Analyysin tavoitteena on antaa valintakokeeseen


VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.


Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30 Tampereen yliopisto Bioteknologian tutkinto-ohjelma Valintakoe 21.5.2015 Henkilötunnus - Sukunimi Etunimet Tehtävä 3 Pisteet / 30 3. a) Alla on lyhyt jakso dsdna:ta, joka koodaa muutaman aminohappotähteen


DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Nimi sosiaaliturvatunnus

Nimi sosiaaliturvatunnus Valintakoe 2013 / Biokemia Nimi sosiaaliturvatunnus 1. Selitä: (3,0 p) a) Mitä ovat eksonit ja intronit ja miten ne eroavat toisistaan? b) Mitä eläinsolulle tapahtuu, jos se laitetaan sen sisällä olevaa


a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. Valitse listasta kunkin yhdisteen yleiskielessä käytettävä ei-systemaattinen nimi. (pisteet yht. 5p) a) C-vitamiini b) glukoosi c) etikkahappo d) salisyylihappo e) beta-karoteeni a. b. c. d. e. ksylitoli



DNA:N TOISTOJAKSOJEN MÄÄRITTÄMINEN JA YKSILÖNTUNNISTUS PCR:N AVULLA. Työohjeen testaus DNA:N TOISTOJAKSOJEN MÄÄRITTÄMINEN JA YKSILÖNTUNNISTUS PCR:N AVULLA Työohjeen testaus Tarja Tuovinen Kehittämistehtävä Toukokuu 2010 Solu- ja molekyylibiologian erikoistumisopinnot Tampereen ammattikorkeakoulu


Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi


Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus:

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus: Esseekysymyksistä 1 ja 2 voi saada enintään 5 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 4 pistettä. Lisäksi vastaaja saa enintään yhden pisteen, mikäli


LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä






KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 BIOLÄÄKETIETEEN Henkilötunnus: - KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 Kirjoita selvästi nimesi ja muut henkilötietosi niille varattuun


MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta)

MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta) Tehtävä Pisteet a) Mitkä ovat solussa DNA:n, mitkä RNA:n tehtäviä? Miksi mielestäsi DNA on valikoitunut kaikkien solullisten organismien perintöainekseksi? max 5 DNA: perinnöllisen tiedon säilyttäminen


Laskentaa DNA- ja RNA-molekyyleillä. Olli Niemitalo, 7.12.2011

Laskentaa DNA- ja RNA-molekyyleillä. Olli Niemitalo, 7.12.2011 Laskentaa DNA- ja RNA-molekyyleillä Olli Niemitalo, 7.12.2011 1 Sisällys 1 Johdanto... 2 1.1 DNA ja RNA... 2 1.2 Boolen algebra... 3 1.3 Binääriluvut... 4 1.4 Turingin kone... 4 1.5 Tilakone... 5 1.6 Laskettavuusteoria...


Mikrosirut ja niiden data-analyysi

Mikrosirut ja niiden data-analyysi Mikrosirut ja niiden data-analyysi S-114.2510 Laskennallinen systeemibiologia 11. Luento: To 24.4.2008 Oppimistavoitteet Mikä on mikrosiru ja miten niitä tehdään Millaisia mikrosiruja on olemassa Kuinka


Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Perinnöllinen informaatio sijaitsee dna:ssa eli deoksiribonukleiinihapossa





DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit


Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic





Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa

Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa Kati Rajanen & Mira Tyni Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa Metropolia Ammattikorkeakoulu Bioanalyytikko Bioanalytiikan koulutusohjelma Opinnäytetyö 6.4.03 Tiivistelmä Tekijä(t) Otsikko


Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset EU:ssa ei ole yleisesti hyväksyttyä elintarvikepetosten määritelmää. Yleinen ohjeistus löytyy elintarvikelainsäädäntöä


Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto.

Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto. Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto Nukleiinihapot! kertausta matkan varrella, vähemmän kuitenkin


Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet


Ylioppilastutkintolautakunta S tudentexamensnämnden

Ylioppilastutkintolautakunta S tudentexamensnämnden Ylioppilastutkintolautakunta S tudentexamensnämnden BIOLOGIAN KOE 16.9.2013 HYVÄN VASTAUKSEN PIIRTEITÄ Alla oleva vastausten piirteiden ja sisältöjen luonnehdinta ei sido ylioppilastutkintolautakunnan


Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Seoksen komponentit voidaan erotella toisistaan kromatografisilla menetelmillä. Mihin kromatografiset menetelmät perustuvat? (2p) Menetelmät perustuvat seoksen osasten erilaiseen sitoutumiseen paikallaan



KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,



COXSACKIEVIRUS A9 KANTOJEN MUUNTUMINEN Opinnäytetyö (AMK) Bio ja elintarviketekniikka Biotekniikka 2011 Tiina Kelanne COXSACKIEVIRUS A9 KANTOJEN MUUNTUMINEN VP1- ja 3D-geenien sekvensointi rekombinaatioiden tunnistamiseksi OPINNÄYTETYÖ (AMK)


Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta KOE 8 Ravitsemustiede Sekä A- että B-osasta tulee saada vähintään 7 pistettä. Mikäli A-osan pistemäärä on vähemmän kuin 7 pistettä, B-osa jätetään arvostelematta. Lisäksi A-osasta on saatava yhteensä vähintään


Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset


3 Eliökunnan luokittelu

3 Eliökunnan luokittelu 3 Eliökunnan luokittelu YO Biologian tehtävien vastausohjeista osa on luettelomaisia ja vain osa on laadittu siten, että ohjeen mukainen mallivastaus riittää täysiin pisteisiin esimerkiksi ylioppilaskokeessa.


Biologian kokeellisuuteen liittyvä pienimuotoinen tutkimus tai projekti. Kurssia ei suositella itsenäisesti suoritettavaksi.

Biologian kokeellisuuteen liittyvä pienimuotoinen tutkimus tai projekti. Kurssia ei suositella itsenäisesti suoritettavaksi. Pakolliset kurssit 1. Elämä ja evoluutio (BI01) Kurssilla perehdytään elämän edellytyksiin ja kaikille eliöille tunnusomaisiin piirteisiin. Kurssilla tutustutaan myös biologian tapaan hankkia ja kuvata


Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa

Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa KOTIELÄINJALOSTUKSEN TIEDOTE No 82 Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa Sampo Sirkkomaa ja Matti Ojala Kotieläinten jalostustieteen laitos Helsinki 1988 Julkaistjat: Kotieläinten


Anatomia ja fysiologia 1 Peruselintoiminnat

Anatomia ja fysiologia 1 Peruselintoiminnat Anatomia ja fysiologia 1 Peruselintoiminnat Solu Laura Partanen Yleistä Elimistö koostuu soluista ja soluväliaineesta Makroskooppinen mikroskooppinen Mm. liikkumiskyky, reagointi ärsykkeisiin, aineenvaihdunta


Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki


Uutta pikadiagnostiikkaan

Uutta pikadiagnostiikkaan Uutta pikadiagnostiikkaan Joanna Peltola Sairaalamikrobiologi NordLab Rovaniemi Käsitteitä Perinteiset mikrobiologiset menetelmät Viljely Biokemiallinen tunnistus Kiekkoherkkyysmääritys Pikatestit Immunografiset


Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti


VASTAUSANALYYSI. 22 p. 12 p. 4 p. 11 p. 5 p. 5 p. 6 p. 9 p. 10 p. 12 p. 15 p. 9 p. 7 p. 8 p. 10 p. 11 p Yhteensä 156 p

VASTAUSANALYYSI. 22 p. 12 p. 4 p. 11 p. 5 p. 5 p. 6 p. 9 p. 10 p. 12 p. 15 p. 9 p. 7 p. 8 p. 10 p. 11 p Yhteensä 156 p 1 LÄÄKETIETEELLISTEN ALOJEN VALINTAKOE 24.5.2013 VASTAUSANALYYSI Vastausanalyysi julkaistaan välittömästi valintakokeen päätyttyä. Vastausanalyysin tavoitteena on antaa valintakokeeseen osallistuville


Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine


Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent

Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent 12 Geenitutkimuksista Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; Huhtikuussa 2008 Tätä työtä


a) dominoivaan: esiintyy joka sukupolvessa, sairaille vanhemmille voi syntyä terveitä lapsia

a) dominoivaan: esiintyy joka sukupolvessa, sairaille vanhemmille voi syntyä terveitä lapsia 1. Sukupuut Seuraavat ihmisen sukupuut edustavat periytymistä, jossa ominaisuuden määrää yksi alleeli. Päättele sukupuista A-F, mitä periytymistapaa kukin niistä voi edustaa. Vastaa taulukkoon kirjaimin





T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...


Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira

Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa Annikki Welling Kemian laboratoriopalvelut Evira Sisältö Elintarvikepetokset Menetelmiä elintarvikepetosten tunnistamiseksi DNA menetelmät DNA viivakoodaus



JUSSA-PEKKA VIRTANEN DNA-LASKENTA JUSSA-PEKKA VIRTANEN DNA-LASKENTA Kandidaatintyö Tarkastaja: Hanna Silén Ohjaajat: Hanna Silén Olli Yli-Harja Työ jätetty tarkastettavaksi 15. joulukuuta 2013 I TIIVISTELMÄ TAMPEREEN TEKNILLINEN YLIOPISTO
