Save this PDF as:

Koko: px
Aloita esitys sivulta:




2 Suomen Ympäristösairauskeskus perustettiin viime vuonna ajantasaisen ympäristösairaustiedon asiantuntijakeskukseksi.

3 Tavoitteena on ajantasaisen, kokonaisvaltaisen tiedon lisääminen ympäristösairauksista. -> Ymmärrys ympäristösairauksien syntymekanismeista hoitokeinoista ja erityispiirteistä auttaa ennaltaehkäisemään ympäristösairastuneiden määrän kasvua oikeansuuntaisella ympäristö- ja terveyspolitiikalla.

4 Ympäristösairauksien laaja määritelmä: Monen ns. perinteisen sairauden takana on eri elinjärjestelmiä haittaavia ympäristöaltisteita. Esimerkiksi: Sydän- ja verisuonisairaudet: useissa laajoissa tutkimuksissa on löydetty yhteydet pienhiukkasaltistuksille. Myös polyaromaattiset hiilivedyt, aldehydit ja useat raskasmetallit sekä diesel partikkelit vaikuttavat erilaisilla mekanismeilla sydän- ja verisuonisairauksien syntyyn. Alkaa olla tutkimusviitteitä siitä, että monet autoimmuunisairaudet liittyvät osittain ympäristöaltisteisiin.

5 Ympäristösairauksien suppea määritelmä: Näitä ovat ns. uudet ympäristösairaudet, kuten MCS (monikemikaalioireyhtymä), SBS (sairasrakennusoireyhtymä), ja ES (sähköherkkyys). Sairauksien puhkeamista edeltää selkeä altistuminen vahvoille ympäristötekijöille. Vakavasti ympäristösairastuneiden joukossa on yhä enemmän lapsia ja nuoria.

6 Altistuminen voi olla joko kerta-altistuksena voimakasta, esimerkiksi sotakemikaaleissa ja säteilyonnettomuuksissa. Yleisempää on pitkäaikainen, matala-asteinen altistuminen, esimerkiksi huonekalujen- ja vaatteiden palonsuoja-ja pintakäsittelyaineille, rakennusmateriaalien pehmenninaineille, mm. säilykkeistä liukenevalle bisfenoli A:lle,raskasmetalleille, kännyköiden mikroaaltosäteilylle jne. Altistuminen ympäristömyrkyille voi vaikuttaa myös epigeneettisesti; monen sairauden taustalta on tunnistettu epigeneettisiä muutoksia.

7 Epigenetiikassa geenien toiminta muuttuu, ilman että DNA:n emäsjärjestyksessä tapahtuu muutoksia, esimerkiksi genomissa hiljaisena tai aktiivisena olevia geenejä voi ympäristötekijöiden seurauksena aktivoitua tai sammua. Osan epigeneettisistä muutoksista on todettu eläinkokeissa siirtyvän sukupolvelta toiselle. Tällaisia muutoksia ovat aiheuttaneet mm. jotkin ftalaatit, polttoaineet ja torjuntaaineet. Geenien ohjautumisen periytyvä muutos näkyi eläinkokeissa altistumattomilla jälkeläisillä esimerkiksi autoimmuunisairauksien puhkeamisina.

8 Voimakkaasti kasvava epigeneettinen tutkimus ja epigeneettisten mekanismien tuntemus lisää ymmärrystä ihmisen ja ympäristön välisestä vuorovaikutuksesta. Nykyisin tunnetaan jo monen ympäristöaltisteen kohdegeeni ja sen ohjautumisessa tapahtuneen muutoksen mekanismi. Esimerkiksi Harvardin yliopiston ympäristöepigenetiikan laitoksella on havaittu useimpien ympäristöperäisten epigeneettisten muutosten välittyvän oksidatiivisen stressin välityksellä, mikä aiheuttaa mitokondriovaurioita. Mitokondriovaurioita on todettu monen sairauden taustalta, mm. sydän- ja verisuonisairaudet ja keskushermoston rappeumasairaudet.

9 Käytöshäiriöt, autismi ja erilaiset hermostoperäiset kehityshäiriöt ovat yleistyvä ongelma. Yli kymmenes syntyvistä lapsista kärsii jostakin neurobehavioraalisesta kehityshäiriöstä. Kasvua ei voida selittää pelkästään geneettisillä tekijöillä. Markkinoilla olevista kemikaaleista karttuu usein tietoa vasta niiden laajan ja pitkäaikaisen käytön jälkeen. Jo 1000 kemikaalia on eläinkokeissa antanut viitteitä keskushermoston neurotoksisuudesta ja niistä yhä suurempi osa siirtyy luokkaan, jossa pysyvät keskushermoston kehityshäiriöt on todennettu ihmisillä ja epidemiologisissa tutkimuksissa. (Grandjean and Landrigan 2014)

10 Uusien tutkimusten mukaan sisäilman kemikaalipäästöjä tulisi terveyshaittojen selvittämiseksi mitata spesifisti, sillä kokonaismäärien mittaamisella ei saada esille olennaisia terveysvaikutuksia. Esimerkeiksi terveyshaittojen kanssa korreloivista kemikaaleista nousivat mm. 1,1,1-trikloorietaani, ksyleeni, butanoli, ketoni, 2- pentyylifuraani, 1-okta-3-oli, 3-metyylifuraani, formaldehydi ja Texanol-pehmennin. (Sahlberg ym. 2013, Guo 2013, Takigawa 2012)

11 Korrelaatio mykotoksiinialtistuksen ja kroonisen väsymysoireyhtymän välillä. (Brewer ym. 2013) Viitteitä on sisäilman mikrobien yhteydestä synnynnäisen immuniteetin toimintahäiriöihin. Synnynnäiseen immuniteettiin kuuluvien monosyyttien reseptoritoiminta ja välittäjäaineet olivat muuntuneita altistuneilla. (Punsmann ym. 2013) Mikrobitoksiinien vaikutusmekanismeihin on saatu tarkennusta. Esimerkiksi satratoksiini H:n on havaittu aiheuttavan jo matalilla altistuksilla aivoveriestemallin hajoamista sekä keskushermoston solujen vaurioitumista. (Karunasena ym. 2010)

12 Sähköherkkyyden taustalta on vastikään löydetty verikokein todennettavia markkereita laajassa tutkimuksessa, jossa oli kolme eri ryhmää, MCS potilaat, sähköherkät ja terveet verrokit. MCS potilailta aiemmissa löydetyt veriarvomuutokset pystyttiin toistamaan, mutta lisäksi ES potilailta löytyi näistä osin poikkeavat veriarvot, joissa oli myös yhtäläisyyksiä MCS potilaiden kanssa. (De Luca ym. 2014) MCS potilailta on löydetty verikokeissa mm. krooniseen tulehdukseen viittaava tulehdusprofiili. Tukee aiempia verikoelöydöksiä ja vahvistaa olemassa olevaa käsitystä ympäristösairauksien tautimekanismista. (Dantoft ym. 2013)

13 Parkinsonin taudin tutkimuksissa on löydetty viitteitä tiettyjen torjunta-aineiden ja mikrobien aineenvaihduntatuote 1-okte-3- olin yhteydestä dopamiinivälitteisten neuronien rappeumaan. (mm. Inamdara ym.2013) Pitkäaikaisaltistuminen ja kemikaalien yhteisvaikutukset arkisessa elämässä ovat merkittävä tekijä. Elimistöstä nopeasti poistuvista kemikaaleista on hankalampi saada näkyviin pitkän aikavälin terveyshaittoja. Kemikaalien yhteisvaikutuksista on vaikea saada riittävästi tietoa ja täten niitä ei myöskään osata kattavasti ja ennaltaehkäisevästi huomioida kemikaaliturvallisuudessa.

14 Tutkimusviitteet:

Minun valinnoillani voi olla vaikutusta lapsiini, lastenlapsiini ja vieläkin kauemmas.

Minun valinnoillani voi olla vaikutusta lapsiini, lastenlapsiini ja vieläkin kauemmas. Epigenetiikka linkittää ympäristön ja sairaudet Hankittu epigeneettinen vaurio voi periytyä yli sukupolvien, osoittavat jo useat tutkimukset. Ihmiskunnan tautikentän muutoksen selittäjää kannattaa etsiä


Home vaikuttaa hermostoon

Home vaikuttaa hermostoon Sisäilmaongelmat huolettavat tutkijoita Home vaikuttaa hermostoon Pilaantunut sisäilma voi vaikuttaa kognitiivisiin kykyihin ja aiheuttaa motorisia ongelmia, osoittavat tuoreet tutkimukset. Sisäilman haittatekijöiden


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


Lataa Hengitystiet kuntoon ravitsemushoidolla - Kaarlo Jaakkola. Lataa

Lataa Hengitystiet kuntoon ravitsemushoidolla - Kaarlo Jaakkola. Lataa Lataa Hengitystiet kuntoon ravitsemushoidolla - Kaarlo Jaakkola Lataa Kirjailija: Kaarlo Jaakkola ISBN: 9789526861401 Sivumäärä: 396 Formaatti: PDF Tiedoston koko: 14.80 Mb Kärsitkö hengitysteiden sairauksista,


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does


Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1 1) Tunnista molekyylit (1 piste) ja täytä seuraava taulukko (2 pistettä) a) b) c) d) a) Syklinen AMP (camp) (0.25) b) Beta-karoteeni (0.25 p) c) Sakkaroosi (0.25 p) d) -D-Glukopyranoosi (0.25 p) 2 Taulukko.


Opiskelijoiden nimet, s-postit ja palautus pvm. Kemikaalin tai aineen nimi. CAS N:o. Kemikaalin ja aineen olomuoto Valitse: Kiinteä / nestemäinen

Opiskelijoiden nimet, s-postit ja palautus pvm. Kemikaalin tai aineen nimi. CAS N:o. Kemikaalin ja aineen olomuoto Valitse: Kiinteä / nestemäinen Harjoitus 2: Vastauspohja. Valitun kemikaalin tiedonhaut ja alustava riskinarviointi. Ohje 09.03.2016. Laat. Petri Peltonen. Harjoitus tehdään k2016 kurssilla parityönä. Opiskelijoiden nimet, s-postit


Näin elämme tänään kuinka voimme huomenna?

Näin elämme tänään kuinka voimme huomenna? Näin elämme tänään kuinka voimme huomenna? Yrittäjälääkäri Ville Pöntynen 22.1.2015 Lupauksen toiminta-ajatukset Hoidamme ja ennaltaehkäisemme sairauksia sekä työ- ja toimintakyvyn laskua lääketieteen,



SISÄILMAONGELMIEN TERVEYSVAIKUTUKSET SISÄILMAONGELMIEN TERVEYSVAIKUTUKSET Hannele Oikarinen työterveyslääkäri, yleislääketieteen ja työterveyshuollon erikoislääkäri 20.3.2017 Todettujen sisäilmaongelmien terveyshaitat Pölyisyys Allergiaoireet,


Sisäilmaongelmaisen rakennuksen diagnosointi. FM Eetu Suominen Turun yliopisto, Biokemian laitos Labquality Days 2017

Sisäilmaongelmaisen rakennuksen diagnosointi. FM Eetu Suominen Turun yliopisto, Biokemian laitos Labquality Days 2017 Sisäilmaongelmaisen rakennuksen diagnosointi FM Eetu Suominen Turun yliopisto, Biokemian laitos Labquality Days 2017 Johdantoa Asunnon ja muiden oleskelutilojen terveellisyyteen vaikuttavat sekä kemialliset


Autoimmuunitaudit: osa 1

Autoimmuunitaudit: osa 1 Autoimmuunitaudit: osa 1 Autoimmuunitaute tunnetaan yli 80. Ne ovat kroonisia sairauksia, joiden syntymekanismia eli patogeneesiä ei useimmissa tapauksissa ymmärretä. Tautien esiintyvyys vaihtelee maanosien,


Mikrobitoksiinien hengitystievaikutukset Sisäilmastoseminaari

Mikrobitoksiinien hengitystievaikutukset Sisäilmastoseminaari Mikrobitoksiinien hengitystievaikutukset Sisäilmastoseminaari 15.3.2017 Kati Huttunen Tämähän lähti siitä että etittiin juttuja Kirjallisuuskatsaus mykotoksiinien yhteydestä terveyshaittoihin Aineiston


Luonnonmarjat ja kansanterveys. Raija Tahvonen MTT/BEL

Luonnonmarjat ja kansanterveys. Raija Tahvonen MTT/BEL Luonnonmarjat ja kansanterveys Raija Tahvonen MTT/BEL 15.8.2013 Jos poimit marjat itse, saat Liikuntaa Luonnossa liikkumisen hyvät vaikutukset aivoille Marjasi tuoreena Varman tiedot, mistä marjat ovat


Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki



KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,


Tietämys ympäristöterveysriskeistä voidaan siirtää lääketieteen hoitokäytäntöihin

Tietämys ympäristöterveysriskeistä voidaan siirtää lääketieteen hoitokäytäntöihin Antonio Maria Pasciuto Antonio Maria Pasciuto on italialainen sisätautilääkäri ja kliinisen ympäristölääketieteen asiantuntija. Hän on Euroopan ympäristölääketieteen akatemian (Europaem) johtokunnan jäsen



SÄTEILYN GENEETTISET VAIKUTUKSET 8 SÄTEILYN GENEETTISET VAIKUTUKSET Sisko Salomaa SISÄLLYSLUETTELO 8.1 Ihmisen perinnölliset sairaudet... 122 8.2 Perinnöllisten sairauksien taustailmaantuvuus... 125 8.3 Perinnöllisen riskin arviointi...





Narkolepsia ja mitä tiedämme sen syistä

Narkolepsia ja mitä tiedämme sen syistä Työterveyslaitos Narkolepsia ja mitä tiedämme sen syistä Christer Hublin Neurologian dosentti ja erikoislääkäri Unilääketieteen erityispätevyys (SLL) Sleep Medicine Specialist (ESRS/NOSMAC) Esityksen sisältö


Elimistö puolustautuu

Elimistö puolustautuu Elimistö puolustautuu Tautimikrobit (= patogeenit): Bakteerit (esim. kolera), virukset (esim. influenssa), alkueliöt (esim. malaria), eräät sienet (esim. silsa) Aiheuttavat infektiotaudin Mistä taudinaiheuttajat


SISÄILMAOIREIDEN TUNNISTAMINEN. Tuula Putus, Turun yliopisto / IndoorAid

SISÄILMAOIREIDEN TUNNISTAMINEN. Tuula Putus, Turun yliopisto / IndoorAid SISÄILMAOIREIDEN TUNNISTAMINEN Tuula Putus, Turun yliopisto / IndoorAid Mikä on tavanomaista ja mikä tavanomaisesta poikkeavaa? MÄÄRITELMÄN MUKAAN sisäilmaoireilua on oireilu, joka ilmenee tietyssä rakennuksessa


Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Lausunto : Ympäristöherkkyydelle oma diagnoosinumero tautiluokitukseen

Lausunto : Ympäristöherkkyydelle oma diagnoosinumero tautiluokitukseen Homepakolaiset ry Lausunto : Ympäristöherkkyydelle oma diagnoosinumero tautiluokitukseen Ympäristöherkkyydet johtuvat jonkin / joidenkin ympäristön myrkyllisten altisteiden laukaisemasta sairaudesta, jolloin


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


Hormonihäiriköiden yhteisvaikutusten tutkimus ja hormonihäiriköiden määrittelyn vaikeus sääntelyssä

Hormonihäiriköiden yhteisvaikutusten tutkimus ja hormonihäiriköiden määrittelyn vaikeus sääntelyssä Hormonihäiriköiden yhteisvaikutusten tutkimus ja hormonihäiriköiden määrittelyn vaikeus sääntelyssä MITEN HORMONIHÄIRIKÖT KURIIN? Eduskunnan ympäristövaliokunnan avoin kokous 15.3.2017 Hannu Kiviranta


Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Psyykkisten rakenteiden kehitys

Psyykkisten rakenteiden kehitys Psyykkisten rakenteiden kehitys Bio-psykososiaalinen näkemys: Ihmisen psyykkinen kasvu ja kehitys riippuu bioloogisista, psykoloogisista ja sosiaalisista tekijöistä Lapsen psyykkisen kehityksen kannalta


Lataa Viisas vatsa - Emeran Mayer. Lataa

Lataa Viisas vatsa - Emeran Mayer. Lataa Lataa Viisas vatsa - Emeran Mayer Lataa Kirjailija: Emeran Mayer ISBN: 9789523003101 Sivumäärä: 308 Formaatti: PDF Tiedoston koko: 34.35 Mb Kuinka suolisto ja aivot toimivat yhdessä? Terve suolisto, tasapainoinen


Narkolepsian immunologiaa ja Pandemrixiin liittyvät tutkimkset

Narkolepsian immunologiaa ja Pandemrixiin liittyvät tutkimkset Narkolepsian immunologiaa ja Pandemrixiin liittyvät tutkimkset Outi Vaarala, Immuunivasteyksikön päällikkö, THL Narkolepsian kulku - autoimmuunihypoteesiin perustuva malli Hypokretiinia Tuottavat neuronit


Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015 Katekoli-O-metyylitransferaasi ja kipu Oleg Kambur Kipu Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 1 Katekoli-O-metyylitransferaasi (COMT) proteiini tuotetaan


Kosteus- ja homevaurioiden yhteys terveyteen ja ympäristöherkkyyteen. Juha Pekkanen, prof Helsingin Yliopisto Terveyden ja Hyvinvoinnin laitos

Kosteus- ja homevaurioiden yhteys terveyteen ja ympäristöherkkyyteen. Juha Pekkanen, prof Helsingin Yliopisto Terveyden ja Hyvinvoinnin laitos Kosteus- ja homevaurioiden yhteys terveyteen ja ympäristöherkkyyteen Juha Pekkanen, prof Helsingin Yliopisto Terveyden ja Hyvinvoinnin laitos Sidonnaisuudet kahden viimeisen vuoden ajalta LKT, prof Tutkimus


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa.

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa. 1 1/2011 Parkinsonin taudin perinnöllisyys Geenien ja ympäristötekijöiden vuorovaikutus sairastumisen taustalla Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla


tulehduksellisten suolistosairauksien yhteydessä

tulehduksellisten suolistosairauksien yhteydessä ADACOLUMN -HOITO tulehduksellisten suolistosairauksien yhteydessä www.adacolumn.net SISÄLTÖ Maha-suolikanava...4 Haavainen paksusuolitulehdus...6 Crohnin tauti...8 Elimistön puolustusjärjestelmä ja IBD...10



Psykoositietoisuustapahtuma Psykoositietoisuustapahtuma apulaisylilääkäri Pekka Salmela Tampereen Psykiatria- ja päihdekeskus 19.9.2017 Metso Psykoosit Psykooseilla eli mielisairauksilla tarkoitetaan mielenterveyshäiriöiden ryhmää,


Kemikaali(yli)herkkyys Tuoksu(yli)herkkyys. Matti Hannuksela TTL 14.10.2011

Kemikaali(yli)herkkyys Tuoksu(yli)herkkyys. Matti Hannuksela TTL 14.10.2011 Kemikaali(yli)herkkyys Tuoksu(yli)herkkyys Matti Hannuksela TTL 14.10.2011 Ympäristösairauksien kirjo Idiopathic environmental illnesses (IEI) Kemikaaliyliherkkyys, Multiple chemical sensitivity (MCS)


Otsonointi sisäympäristöissä tiivistelmä kirjallisuuskatsauksesta

Otsonointi sisäympäristöissä tiivistelmä kirjallisuuskatsauksesta Otsonointi sisäympäristöissä tiivistelmä kirjallisuuskatsauksesta Hanna Leppänen, Matti Peltonen, Martin Täubel, Hannu Komulainen ja Anne Hyvärinen Terveyden ja hyvinvoinnin laitos 24.3.2016 Otsonointi



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


Riskienhallinnalla terveyttä ja hyvinvointia

Riskienhallinnalla terveyttä ja hyvinvointia Riskienhallinnalla terveyttä ja hyvinvointia -ohjelma (RISKY) RAJAUS: elin- ja työympäristö, YMPÄRISTÖTERVEYS MOTIVAATIO: suuri osa ympäristötekijöiden aiheuttamista sairauksista on ehkäistävissä Tavoitteet


Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,


Ulkoilmansaasteiden aiheuttamat sairaudet ja annos-vastesuhteet

Ulkoilmansaasteiden aiheuttamat sairaudet ja annos-vastesuhteet Ulkoilmansaasteiden aiheuttamat sairaudet ja annos-vastesuhteet Ilmansaasteiden terveysvaikutukset (ISTE) Heli Lehtomäki LinkedIn https://fi.linkedin.com/in/helilehtomaki Esityksen rakenne 1. Työn lähtökohdat


Bakteerialtistuminen maatiloilla ja ei-maatiloilla asuvilla lapsilla - yhteys atopiaan ja astmaan

Bakteerialtistuminen maatiloilla ja ei-maatiloilla asuvilla lapsilla - yhteys atopiaan ja astmaan Bakteerialtistuminen maatiloilla ja ei-maatiloilla asuvilla lapsilla - yhteys atopiaan ja astmaan Maria Valkonen, Inge Wouters, Martin Täubel, Helena Rintala, Ritva Vasara, Dick Heederik, Jon Genuneit,


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian



BIOLÄÄKETIETEEN LÄPIMURROT BIOLÄÄKETIETEEN LÄPIMURROT Jussi Huttunen Tampere 20.4.2016 LÄÄKETIETEEN MEGATRENDIT Väestö vanhenee ja sairauskirjo muuttuu Teknologia kehittyy - HOITOTEKNOLOGIA - tietoteknologia Hoito yksilöllistyy


Vastasyntyneiden aineenvaihduntaseula. 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka

Vastasyntyneiden aineenvaihduntaseula. 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka Vastasyntyneiden aineenvaihduntaseula 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka Esityksen tavoitteet Ymmärrät mistä tässä on kyse Seulontoja on erilaisia Näyte otetaan vauvasta Ketään ei



VUOROVAIKUTUS JA LAPSUUSIÄN TUNNE- ELÄMÄN KEHITYS VUOROVAIKUTUS JA LAPSUUSIÄN TUNNE- ELÄMÄN KEHITYS 6.11.2017 1 VUOROVAIKUTUS VOI OLLA Suojaavana tekijänä tunne-elämän suotuisalle kehitykselle myös korjaavaa, hoitavaa (sekä hoito- ja terapiasuhteet että



3D-TULOSTAMINEN: PÄÄSTÖT JA 3D-TULOSTAMINEN: PÄÄSTÖT JA TERVEYSVAIKUTUKSET ANTTI VÄISÄNEN Mitä päästöjä 3D-tulostusprosesseissa syntyy? Haihtuvat orgaaniset yhdisteet Eli VOC-yhdisteet (Volatile Organic Compounds) Erittäin laaja


Miksi liikenteen päästöjä pitää. Kari KK Venho 220909

Miksi liikenteen päästöjä pitää. Kari KK Venho 220909 Miksi liikenteen päästöjä pitää hillitä Kari KK Venho 220909 Miksi liikenteen päästöjä pitää hillitä Kari KK Venho 220909 Mikä on ilmansaasteiden merkitys? Ilmansaasteiden tiedetään lisäävän astman ja


Terve parodontium H VRK IKÄINEN PLAKKI. Dos. Päivi Mäntylä. Parodontiitti: suomalainen kansansairaus HAMPAIDEN KIINNITYS- KUDOSSAIRAUDET

Terve parodontium H VRK IKÄINEN PLAKKI. Dos. Päivi Mäntylä. Parodontiitti: suomalainen kansansairaus HAMPAIDEN KIINNITYS- KUDOSSAIRAUDET Parodontiitti: suomalainen kansansairaus Dos. Päivi Mäntylä 5000 suomalaista HAMPAIDEN KIINNITYS- KUDOSSAIRAUDET TERVEYS 2000- TUTKIMUS Kahdella kolmesta > 30 v. suomalaisesta on parodontiittiin viittaavia


Sisäilma-asioiden hoitaminen Tampereen kaupungin palvelurakennuksissa OPAS TILOJEN KÄYTTÄJÄLLE 2016

Sisäilma-asioiden hoitaminen Tampereen kaupungin palvelurakennuksissa OPAS TILOJEN KÄYTTÄJÄLLE 2016 Sisäilma-asioiden hoitaminen Tampereen kaupungin palvelurakennuksissa OPAS TILOJEN KÄYTTÄJÄLLE 2016 1 Sisäilma on hyvää, jos käyttäjät ovat siihen tyytyväisiä tai siinä ei ole epäpuhtauksia, jotka voivat


TARTUNTATAUDIT Ellen, Olli, Maria & Elina

TARTUNTATAUDIT Ellen, Olli, Maria & Elina TARTUNTATAUDIT Ellen, Olli, Maria & Elina ELIMISTÖN PUOLUSTUSKYKY Immuniteetti eli vastutuskyky on elimistön kyky suojautua tarttuvilta taudeilta Jos tauteja aiheuttavat mikrobit uhkaavat elimistöä, käynnistyy



CORTIMENT (budesonidi) 26.11.2013, versio 1.0 RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO CORTIMENT (budesonidi) 26.11.2013, versio 1.0 RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO VI.2 Julkisen yhteenvedon osiot VI.2.1 Tietoa sairauden esiintyvyydestä Haavainen paksusuolentulehdus (UC)


Cosentyx-valmisteen (sekukinumabi) riskienhallintasuunnitelman yhteenveto

Cosentyx-valmisteen (sekukinumabi) riskienhallintasuunnitelman yhteenveto EMA/775515/2014 Cosentyx-valmisteen (sekukinumabi) riskienhallintasuunnitelman yhteenveto Tämä on Cosentyx-valmisteen riskienhallintasuunnitelman yhteenveto, jossa esitetään toimenpiteet, joilla varmistetaan,


Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen käyttöön liittyviä haasteita Juhani Eskola 310505 7.6.2005 1 Valitut painopistealueet Kansantautien ja terveyden geenitausta Mikrobit ja



GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus GENOMINEN VALINTA HEVOSJALOSTUKSESSA Markku Saastamoinen MTT Hevostutkimus Genominen valinta genomisessa valinnassa eläimen jalostusarvo selvitetään DNA:n sisältämän perintöaineksen tiedon avulla Genomi


Koiran periytyvä persoonallisuus

Koiran periytyvä persoonallisuus Koiran periytyvä persoonallisuus Katriina Tiira, FT, Koirangeenit tutkimusryhmä, HY & Folkhälsan, Eläinten hyvinvoinnin tutkimuskeskus Periytyykö käyttäytyminen? Kaikki yksilön kokemukset kohtuajasta eteenpäin=


Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet?

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Harvinaiset-seminaari TYKS 29.9.2011 Jaakko Ignatius TYKS, Perinnöllisyyspoliklinikka Miksi Harvinaiset-seminaarissa puhutaan





Liite III. Muutokset valmisteyhteenvedon ja pakkausselosteiden asianmukaisiin kohtiin

Liite III. Muutokset valmisteyhteenvedon ja pakkausselosteiden asianmukaisiin kohtiin Liite III Muutokset valmisteyhteenvedon ja pakkausselosteiden asianmukaisiin kohtiin Huomautus: Seuraavat muutokset valmisteyhteenvedon ja pakkausselosteen tiettyihin kohtiin tehdään sovittelumenettelyn


NCL australiankarjakoirilla

NCL australiankarjakoirilla NCL australiankarjakoirilla Yleistä NCL-ryhmään kuuluvat sairaudet ovat kuolemaan johtavia, yleensä resessiivisesti periytyviä sairauksia. Niissä mutaatiosta johtuva geenivirhe aiheuttaa sen, että hermosoluihin


-Sisäilmasta vakavasti sairastuneita, joiden vaikea löytää sisätiloja, joissa ei oireile

-Sisäilmasta vakavasti sairastuneita, joiden vaikea löytää sisätiloja, joissa ei oireile Homepakolaiset ry -Sisäilmasta vakavasti sairastuneita, joiden vaikea löytää sisätiloja, joissa ei oireile -Suomessa sisäilmasta sairastuneena todella vaikeaa elää, koska tätä sairautta ei ole virallisesti


Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine


Positiivisten asioiden korostaminen. Hilla Levo, dosentti, KNK-erikoislääkäri

Positiivisten asioiden korostaminen. Hilla Levo, dosentti, KNK-erikoislääkäri Positiivisten asioiden korostaminen Hilla Levo, dosentti, KNK-erikoislääkäri Krooninen sairaus - Pitkäaikainen sairaus = muuttunut terveydentila, mikä ei korjaannu yksinkertaisella kirurgisella toimenpiteellä


Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere

Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere Perinnöllisyys harvinaisten lihastautien aiheuttajana Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere 17.11.2011 Mistä lihastauti aiheutuu? Suurin osa on perinnöllisiä Osassa perimä altistaa


Sisäilmaongelma tulehdusta elimistössä vai tulehtunut työilmapiiri. LT Riitta-Liisa Patovirta Keuhkosairauksien ja allergologian erikoislääkäri KYS

Sisäilmaongelma tulehdusta elimistössä vai tulehtunut työilmapiiri. LT Riitta-Liisa Patovirta Keuhkosairauksien ja allergologian erikoislääkäri KYS Sisäilmaongelma tulehdusta elimistössä vai tulehtunut työilmapiiri LT Riitta-Liisa Patovirta Keuhkosairauksien ja allergologian erikoislääkäri KYS 1 Ei osakkeita Sidonnaisuudet: Yksittäisiä luentopalkkioita:


Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016



HAJUAISTI HAJUN MERKITYS IHMISEN TERVEYDELLE HAJUAISTI HAJUN MERKITYS IHMISEN TERVEYDELLE Markku Partinen, LKT, neurol. dos. Rinnekodin tutkimuskeskus Ihmisen elämän ja ihmislajin jatkumisen edellytykset Happi Puhdas ilma hengittää Nestetasapaino


Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä. Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS

Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä. Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS Suomen Lihastautirekisteri osana kansainvälistä yhteistyötä Jaana Lähdetie Erikoislääkäri, Suomen Lihastautirekisterin vastuuhenkilö TYKS Taustaa Miksi uudet tutkimustulokset lihastautien perimmäisistä


Adacolumn -hoito tulehduksellisten suolistosairauksien yhteydessä

Adacolumn -hoito tulehduksellisten suolistosairauksien yhteydessä Adacolumn -hoito tulehduksellisten suolistosairauksien yhteydessä Hellävarainen vallankumous IBD-tautien hoidossa Sisältö Maha-suolikanava...4 Haavainen paksusuolitulehdus...6 Crohnin tauti...8 Elimistön


Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä?

Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Antti Latvala Sosiaalilääketieteen päivät 28.11.2012 Esityksen teemat Miksi ja miten huomioida geneettisten


Sisäilmaongelmien selvittäminen mikrobiston ja uusien mittausten rooli

Sisäilmaongelmien selvittäminen mikrobiston ja uusien mittausten rooli Sisäilmaongelmien selvittäminen mikrobiston ja uusien mittausten rooli Anne Hyvärinen, tutkimusprofessori, yksikön päällikkö Ympäristöterveysyksikkö 1.11.2017 YTP2017 Hyvärinen 1 Kosteusvauriorakennukset:


Farmaseuttinen etiikka

Farmaseuttinen etiikka Farmaseuttinen etiikka Medikalisaatio ja terveysarvot Luento 7. Farmasian tdk. 21.11. Markus Neuvonen markus.neuvonen@helsinki.fi http://blogs.helsinki.fi/amoneuvo Arvot tieteessä Terveysarvot Medikalisaatio


Epidemiologia riskien arvioinnissa

Epidemiologia riskien arvioinnissa Epidemiologia riskien arvioinnissa Markku Nurminen Työterveyslaitos Epidemiologian ja biostatistiikan osasto Riskinarvioinnin vaihe Epidemiologinen strategia Riskin tunnistaminen Kuvaileva epidemiologia


Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten


Syövän lääkehoito. Salla Kalsi

Syövän lääkehoito. Salla Kalsi Syövän lääkehoito Salla Kalsi Syöpä Yleisnimitys maligneille (pahanlaatuisille) kasvaimille Karsinogeeninen = syöpää aiheuttava Syövän taustalla voi olla Ympäristötekijät, elintavat, perimä, eräät virus-


Ympäristöterveyden tulevat haasteet. Juha Pekkanen, prof Helsingin yliopisto

Ympäristöterveyden tulevat haasteet. Juha Pekkanen, prof Helsingin yliopisto Ympäristöterveyden tulevat haasteet Juha Pekkanen, prof Helsingin yliopisto Ympäristöterveyden historiaa Pistelähteet Suuret nälkävuodet Vesi- ja viemärilaitokset Ympäristön suojelu Hygienian nousu Lääke,


Sairausdiagnoosit ja työkyvyttömyys. Kirsi Karvala LT, yleislääketieteen ja työterveyshuollon erikoislääkäri

Sairausdiagnoosit ja työkyvyttömyys. Kirsi Karvala LT, yleislääketieteen ja työterveyshuollon erikoislääkäri Hyvinvointia työstä Sairausdiagnoosit ja työkyvyttömyys Kirsi Karvala LT, yleislääketieteen ja työterveyshuollon erikoislääkäri 2 Sidonnaisuudet LT, yleislääketieteen ja työterveyshuollon erikoislääkäri,


Kipupotilas psykiatrin vastaanotolla. Ulla Saxén Ylilääkäri Satshp, yleissairaalapsykiatrian yksikkö 26.05.2016

Kipupotilas psykiatrin vastaanotolla. Ulla Saxén Ylilääkäri Satshp, yleissairaalapsykiatrian yksikkö 26.05.2016 Kipupotilas psykiatrin vastaanotolla Ulla Saxén Ylilääkäri Satshp, yleissairaalapsykiatrian yksikkö 26.05.2016 ICD-10 tautiluokituksessa kipuoire esiintyy vain muutaman psykiatrisen diagnoosin kuvauksessa


Lääkkeet muistisairauksissa

Lääkkeet muistisairauksissa Lääkkeet muistisairauksissa Muistihoitajat 27.4.2016 Vanheneminen muuttaa lääkkeiden farmakokinetiikkaa Lääkeaineen vaiheet elimistössä: Imeytyminen: syljen eritys vähenee, mahalaukun ph nousee, maha-suolikanavan






BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA MITÄ ROKOTUKSIA? Muistatko mitä rokotuksia olet saanut ja minkä viimeiseksi? Miten huolehdit koulun jälkeen rokotuksistasi? Mikrobit uhkaavat elimistöä Mikrobit voivat olla bakteereita,


Melusaaste. suurimpia ympäristömelun aiheuttajia mm. liikenne, rakentaminen, teollisuus, erilaiset vapaaajantoiminnot

Melusaaste. suurimpia ympäristömelun aiheuttajia mm. liikenne, rakentaminen, teollisuus, erilaiset vapaaajantoiminnot Ympäristön terveys Melusaaste melu on häiritseväksi koettua tai terveydelle haitallista ääntä äänenvoimakkuus ilmaistaan logaritmisen suureen avulla, jonka mittayksikkönä on desibeli (db) 120 db melu rikkoo


Ofev-valmisteen (nintedanibi) riskienhallintasuunnitelman yhteenveto

Ofev-valmisteen (nintedanibi) riskienhallintasuunnitelman yhteenveto EMA/738120/2014 Ofev-valmisteen (nintedanibi) riskienhallintasuunnitelman yhteenveto Tämä on Ofev-valmisteen riskienhallintasuunnitelman yhteenveto, jossa esitetään toimenpiteet, joilla varmistetaan, että





Lataa Miesvoimaa! Opas testosteronitason parantamiseen - Jyri Mäkinen. Lataa

Lataa Miesvoimaa! Opas testosteronitason parantamiseen - Jyri Mäkinen. Lataa Lataa Miesvoimaa! Opas testosteronitason parantamiseen - Jyri Mäkinen Lataa Kirjailija: Jyri Mäkinen ISBN: 9789529362691 Formaatti: PDF Tiedoston koko: 34.82 Mb Miesten keskimääräinen testosteronitaso

Lisätiedot euron ongelma yksi ratkaisu Suomesta? Sijoitus Invest 2015, Helsinki 11.11.2015 Pekka Simula, toimitusjohtaja, Herantis Pharma Oyj euron ongelma yksi ratkaisu Suomesta? Sijoitus Invest 2015, Helsinki 11.11.2015 Pekka Simula, toimitusjohtaja, Herantis Pharma Oyj euron ongelma yksi ratkaisu Suomesta? Sijoitus Invest 2015, Helsinki 11.11.2015 Pekka Simula, toimitusjohtaja, Herantis Pharma Oyj 1 Tärkeää tietoa Herantis Pharma Oy ( Yhtiö ) on laatinut


Luontaislääketieteen käsitteet Ihmiskuva eri hoitokulttuureissa Terveys-sairaus käsitteet Oikeus hoitoon

Luontaislääketieteen käsitteet Ihmiskuva eri hoitokulttuureissa Terveys-sairaus käsitteet Oikeus hoitoon LUONTAISTERAPIA-ALAN KOULUTUKSEN TAVOITTEET JAOPINNOT 35,5 op 1 Yleiset tavoitteet: Koulutettava tuntee terapeuttina toimimisen vastuun, velvoitteet ja oikeudet, sekä osaa toimia eettisesti ja moraalisesti


Farmakologian perusteet ja neurofarmakologia (Farmis) Pekka Rauhala 2017

Farmakologian perusteet ja neurofarmakologia (Farmis) Pekka Rauhala 2017 Farmakologian perusteet ja neurofarmakologia (Farmis) Pekka Rauhala 2017 5 op 6 PBL tapausta Farmis Farmakodynamiikka ja Farmakokinetiikka Autonomisen hermoston farmakologia Neurologisten sairauksien hoidossa



PIKAOPAS KUN PISTÄT NPLATE-ANNOKSESI ITSE PIKAOPAS KUN PISTÄT NPLATE-ANNOKSESI ITSE Pikaopas on tarkoitettu potilaille, jotka aikovat pistää Nplateannoksensa itse kotona. Tämän Kotipistoshoidon koulutuspaketin materiaali auttaa sinua saamaan varmuuden



Helvi Käsnänen SILMÄHOITAJAPÄIVÄT Helvi Käsnänen SILMÄHOITAJAPÄIVÄT 19-20.09.2008 Sisätauti-kirurginen sairaanhoitaja 24 vuotta silmätautien klinikassa: osasto, pkl, ls Tutkimushoitajana 03/03 alkaen Selvittää erilaisten solutason tapahtumien,kuten


Hyvä käyttäjä! Ystävällisin terveisin. Toimitus

Hyvä käyttäjä! Ystävällisin terveisin. Toimitus Hyvä käyttäjä! Tämä pdf-tiedosto on ladattu Tieteen Kuvalehden verkkosivuilta (www.tieteenkuvalehti.com). Tiedosto on tarkoitettu henkilökohtaiseen käyttöön, eikä sitä saa luovuttaa kolmannelle osapuolelle.


Mikrobien ja kemikaalien riskinarviointi vesilaitoksissa Päivi Meriläinen Terveyden ja hyvinvoinnin laitos Arvioinnin ja mallituksen yksikkö, Kuopio

Mikrobien ja kemikaalien riskinarviointi vesilaitoksissa Päivi Meriläinen Terveyden ja hyvinvoinnin laitos Arvioinnin ja mallituksen yksikkö, Kuopio Mikrobien ja kemikaalien riskinarviointi vesilaitoksissa Päivi Meriläinen Terveyden ja hyvinvoinnin laitos Arvioinnin ja mallituksen yksikkö, Kuopio Sisältö Talousveden riskit Kvantitatiivinen mikrobiologinen


Harvinaissairauksien yksikkö. Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta. Taustaa. Alfa-tryptasemia. 21/03/16 /ms

Harvinaissairauksien yksikkö. Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta. Taustaa. Alfa-tryptasemia. 21/03/16 /ms Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta Taustaa EDS potilasyhdistys ja yksittäinen potilas ovat lähestyneet HYKS harvinaissairauksien yksikköä ja pyytäneet lausuntoa, minkälainen sairaus Ehlers-Danlos


Pienryhmä 3 immuunipuolustus, ratkaisut

Pienryhmä 3 immuunipuolustus, ratkaisut Pienryhmä 3 immuunipuolustus, ratkaisut 1. Biologian yo 2013 mukailtu. Merkitse onko väittämä oikein vai väärin, Korjaa väärien väittämien virheet ja perustele korjauksesi. a. Syöjäsolut vastaavat elimistön


Anne Kekkonen Sisäilmatutkija Suomen Sisäilmakeskus Oy

Anne Kekkonen Sisäilmatutkija Suomen Sisäilmakeskus Oy Anne Kekkonen Sisäilmatutkija Suomen Sisäilmakeskus Oy Olen koulutukseltani luonnontieteiden kandidaatti ja pätevöitynyt työterveyshuollon asiantuntijaksi. Toimenkuvaani kuuluu sisäilma- ja työhygieeniset


Lataa Kardiologian sanasto. Lataa

Lataa Kardiologian sanasto. Lataa Lataa Kardiologian sanasto Lataa ISBN: 9789518470536 Sivumäärä: 192 Formaatti: PDF Tiedoston koko: 22.43 Mb Kardiologian Sanasto on tarkoitettu käytännön lääkäreiden ja muun terveydenhuoltohenkilökunnan


8. Ympäristöperäisten utaretulehdusbakteerien aiheuttamien ongelmien hallinta. Laura Kulkas Valio Oy

8. Ympäristöperäisten utaretulehdusbakteerien aiheuttamien ongelmien hallinta. Laura Kulkas Valio Oy 8. Ympäristöperäisten utaretulehdusbakteerien aiheuttamien ongelmien hallinta Laura Kulkas Valio Oy Ympäristöperäiset utaretulehdusbakteerit Streptococcus uberis (Streptococcus dysgalactiae) Escherichia


Hyvä päivä, hyvä yö? Helena Aatsinki, työterveyshuollon erikoislääkäri, unilääketieteen erityispätevyys, psykoterapeutti

Hyvä päivä, hyvä yö? Helena Aatsinki, työterveyshuollon erikoislääkäri, unilääketieteen erityispätevyys, psykoterapeutti Hyvä päivä, hyvä yö? Helena Aatsinki, työterveyshuollon erikoislääkäri, unilääketieteen erityispätevyys, psykoterapeutti Sivu 1 Unihäiriöt Unettomuushäiriöt Unenaikaiset hengityshäiriöt Keskushermostoperäinen



OMAISLUOVUTUS OHJE MUNUAISLUOVUTTAJALLE. OMAISLUOVUTUS OHJE MUNUAISLUOVUTTAJALLE. Terve ihminen voi luovuttaa toisen munuaisensa omaiselleen ja läheiselle henkilölle. Luovutus perustuu aina vapaaehtoisuuteen ja voimakkaaseen haluun auttaa munuaissairasta
