Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys

Save this PDF as:
 WORD  PNG  TXT  JPG

Koko: px
Aloita esitys sivulta:

Download "Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys"

Transkriptio

1 Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Markus Perola, LT, geneettisen epidemiologian tutkimusprofessori THL, KATO, GETY Määritelmiä L3/ Kansantaudit: sateenvarjodiagnooseja? Todellisuus? 3 4 Monitekijäiset taudit (kompleksit) Monitekijäisen periytymisen ominaisuuksia Tauteja (ominaisuuksia), joihin vaikuttavat ympäristö ja perimä yhdessä ja erikseen Mendelinaaniset periytymissäännöt harvoin pätevät terve sairas Aggregates, does not segregate esiintyy suvuittain ei noudata mendeliaanisia malleja sukulaisriski liittyy: sairastuneiden määrään sairastuneiden ikään taudin vaikeusasteeseen 5 6 1

2 Kaksostutkimukset Heritabiliteetti eli periytyvyys Pituuskasvu Huuli-suulakihalkio Suulakihalkio IDDM N IDDM Sepelvaltimotauti Verenpainetauti Karies Parodontiitti Skitsofrenia MZ DZ Suhdeluku, joka muodostetaan esim kaksosdatasta Yksinkertaisimmilaan 2(cMZ-cDZ) kuvaa sitä osuutta, minkä perimä selittää kokonaisvaihtelusta jonkun fenotyypin, esim taudin tai riskitekijän suhteen Ilmoitetaan yleensä 0-1 tai 0%-100% >50% iso merkittävä populaatio- ja jopa otosspesifi heritabiliteettia voi suurentaa ei ole yksilöllinen riski tai osuus 7 on hyödyllinen kun arvioidaan yleisesti onko perimällä vaikutusta 8 Miten tavallisten tautien genetiikkaa tutkitaan? Miksi on tärkeää löytää tautiin vaikuttavia geenimuotoja? Geenien tunnistus avaa tien: lääkekehitykselle hoidon kehittämiselle (preventio, hoitolinjat) traditionaalinen riskitekijähoito kovin vaikeaa... tautimekanismin paremmalle ymmärtämiselle Vastaukset herättävät uusia kysymyksiä 10 Vaikeuttavia tekijöitä Kompleksien tautien genetiikan tutkimus hidasta fenokopio sairas perheenjäsen, jolla tauti eri syistä kuin muilla vajaa penetranssi kaikki altistvan geenimuodon kantajat eivät sairastu lokusheterogeenisuus eri geeni oireiden taustalla pleiotropia sama geeni saa aikaan eri ominaisuuksia 11 Glazier et al, Science,

3 Miksi? - biologinen kompleksisuus Miksi? Lähtokohtaisesti riittämätön tutkimusasetelma Vähän oikeita positiivisia maternaalinen genotyyppi paternaalinen genotyyppi yksilön genotyyppi ympäristö prenatal postnatal kasvuikä aikuisikä sairastumisriski Matala lähtötodennäköisyys + Matala voima + Matalat rajat tilastolliselle merkittävyydelle Paljon vääriä positiivisia Suurin osa kirjallisuudessa raportoiduista assosiaatiosta vääriä DMII esimerkkinä Juuri nyt genetiikassa tapahtuu paljon! Vaikutus Iso HNF1A PNDM other MODY TNDM Other rare syndromes mt3243 LMNA Löydetyt geenit selittävät vain osan perinnöllisestä osuudesta Onkohan näitä? Tuskin kaikille taudeille PPARG TCF7L2 Pieni Nykygenetiikan keinojen tavoitytamattomissa! Harvinainen LARS2 ACDC CAPN10 HNF4A LMNA INS KCNJ11 Yleinen Alleelin yleisyys Teknologian riemuvoitto yksi variantti (10 0 SNP; 10 3 genotyyppiä) Yhden geenin tarkka läpikäynti (10 2 SNPiä; genotyyppiä) Alueen kattava tutkimus (10 4 SNPiä; 10 8 genotyyppiä) genome-wide association (GWA) (10 6 SNPiä; genotyyppiä) Genomin resekvensointi (10 8 SNPiä / genotyyppiä)

4 State of the Art Published Genome-Wide Associations through 12/2010, 1212 published GWA at p<5x10-8 for 210 traits NHGRI GWA Catalog Next Generation Sequencing Genome-Wide Association Study - - GWAS Exome Full Genome Photo: Reuters 21 Photo: Evan Hurd Photo: Reuters

5 Huom! Tavallisen taudin ei tarvitse olla monitekijäinen tai kompleksi (vaikka suurin osa on)! Mikä on, mikä ei? Pääosin emme tiedä, (esim laktoosi-intoleranssi, tiedetään). Täytyy sen geenin jotenkin vaikuttaa taustalla kuitenkin aina normaali meioottinen jakautuminen ja lokusten mendeliaaninen periytyminen 25 Genetiikan merkitys kansantaudeille Saivartelemalla voitaisiin arvella, että perimä vaikuttaa kaikkiin kansantauteihin tai ei mihinkään niistä Perimä on yksi riskitekijä muiden joukossa, joka vaikuttaa joko suoraan tai yleisemmin ns. välivaiheen fenotyyppien kautta lisäämällä tai vähentämällä riskiä On harvinaisia yleisten tautien muotoja, joille perimän merkitys on hyvin merkittävä 26 We ve Been Picking the Low-hanging fruits Kärsivällisyyttä Mendeliaanisten tautien mekanismien selvittäminen siten että siitä on hyötyä potilaille on kestänyt vuosikymmeniä (Marfans, Fragile X, etc.) Tähän astiset menetelmät ja mallit melkoisen yksinkertaisia...mitäs seuraavaksi? Geenitestien käsite ja merkitys muuttuu nopeasti Erilaisten geenitestien käytännön merkitys on dramaattisen erilainen ja riippuvainen ihmisen elämänvaiheesta Sosiaaliset ja taloudelliset seuraamukset varsin erilaisia ja riippuvaisia terveydenhuoltojärjestelmästä Väestön ymmärrys testien merkityksestä korreloi yleiseen koulutustasoon 29 Geenitiedon haasteet 1. Biolaskenta -Perimän laajuisen tiedon ymmärtäminen 2. Väestön koulutus - Geeniviestin selittäminen 3. Eettiset, juridiset ja sosiaaliset seuraamukset - Geenitiedon soveltaminen 30 5

6 Vie kotiin - viesti 1 Nuorella iällä alkanut, vaikea taudinmuoto saattaa viestiä perinnöllisestä komponentista kysy anamneesi, sukutieto on osa kunnollista amaneesinottoa ja jokapäiväistä diagnostiikkaa! Selkeän perinnöllisen alttiuden toteaminen ei vaadi monimutkaisia molekyyligeneettisiä tutkimusmenetelmiä Vie kotiin - viesti 2 Geenit selittävät yleensä vain osan tautiin johtavasta riskitekijäkaskadista kohtalouskon lietsomista tulee välttää vaan motivoida preventiota ja itsehoitoa pääsääntöisesti normaali hoito Vie kotiin - viesti 3 Seuratkaa kirjallisuutta, ala kehittyy valtavaa vauhtia! FV Leiden esimerkkinä, ollut jo vuosia kliinisessä käytössä, todella merkittävä riskitekijä Stokaistisia prosesseja SLL, Duodecim ilahduttavan up-to-date Olkaa kriittisiä Paljon, paljon hypeä + ymmärtämättömyyttä Pankaa luennoitsijat koville! Genetiikka liikkuu pois lääketieteellisen genetiikan laitoksista muihin klinikkoihin Genetiikan laitos ei voi käydä läpi koko tautikirjoa kliinikon tulee tietää oman alueensa genetiikka ja sen relevanssi muiden riskitekijöiden suhteen

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Markus Perola, LT, geneettisen epidemiologian tutkimusprofessori THL, KATO, GETY markus.perola@thl.fi Määritelmiä L3/13.9.2012

Lisätiedot

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä

Lisätiedot

Genomitieto kliinikon apuna nyt ja tulevaisuudessa

Genomitieto kliinikon apuna nyt ja tulevaisuudessa Genomitieto kliinikon apuna nyt ja tulevaisuudessa Helena Kääriäinen Tutkimusprofessori 19.3.2014 Genomitieto / Helena Kääriäinen 1 Mistä kliinikosta puhumme? Kliinisistä geeneetikoista eli perinnöllisyyslääkäreistä?

Lisätiedot

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa.

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa. 1 1/2011 Parkinsonin taudin perinnöllisyys Geenien ja ympäristötekijöiden vuorovaikutus sairastumisen taustalla Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla

Lisätiedot

Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere

Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere Perinnöllisyys harvinaisten lihastautien aiheuttajana Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere 17.11.2011 Mistä lihastauti aiheutuu? Suurin osa on perinnöllisiä Osassa perimä altistaa

Lisätiedot

Voidaanko geenitiedolla lisätä kansanterveyttä?

Voidaanko geenitiedolla lisätä kansanterveyttä? Voidaanko geenitiedolla lisätä kansanterveyttä? Duodecimin vuosipäivä 14.11.2014 Veikko Salomaa, LKT, tutkimusprofessori 21.11.2014 Esityksen nimi / Tekijä 1 Sidonnaisuudet Ei ole 21.11.2014 Esityksen

Lisätiedot

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä Matti Pirinen Suomen molekyylilääketieteen instituutti (FIMM) Helsingin Yliopisto 17.2.2015 Tilastollisen päättelyn kurssi Kumpula Sisältö

Lisätiedot

Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:

Lisätiedot

Rintasyövän perinnöllisyys

Rintasyövän perinnöllisyys Lääketieteellisen genetiikan kurssi 17.9.2012 Rintasyövän perinnöllisyys Perinnöllinen syöpäalttius - esimerkkinä rintasyöpä Kristiina Aittomäki, dos. ylilääkäri Genetiikan vastuuyksikköryhmä/huslab/hus

Lisätiedot

GEENIT JA KORONAARITAUDIN RISKI

GEENIT JA KORONAARITAUDIN RISKI GEENIT JA KORONAARITAUDIN RISKI LT Kirsi Auro 17/10/2013 1 Aiheet Sydän- ja verisuonitautien preventiosta Suomessa Geneettiset riskilaskut Loppupäätelmät Sydän- ja verisuonitautien riskitekijöitä Sukupuoli

Lisätiedot

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet?

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Harvinaiset-seminaari TYKS 29.9.2011 Jaakko Ignatius TYKS, Perinnöllisyyspoliklinikka Miksi Harvinaiset-seminaarissa puhutaan

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

S Laskennallinen systeemibiologia

S Laskennallinen systeemibiologia S-114.2510 Laskennallinen systeemibiologia 3. Harjoitus 1. Koska tilanne on Hardy-Weinbergin tasapainossa luonnonvalintaa lukuunottamatta, saadaan alleeleista muodostuvien eri tsygoottien genotyyppifrekvenssit

Lisätiedot

April 21, 2015. FIMM - Institute for Molecular Medicine Finland www.fimm.fi

April 21, 2015. FIMM - Institute for Molecular Medicine Finland www.fimm.fi April 21, 2015 FIMM - Institute for Molecular Medicine Finland Tutkimus Soveltaminen Miten ihmiset suhtautuvat geenitietoonsa KardioKompassi tutkimuksesta opittua Mari Kaunisto, FIMM 16.4.2015 Sitran teettämä

Lisätiedot

Tavallisten tautien genetiikkaa

Tavallisten tautien genetiikkaa Perinnölliset taudit Tavallisten tautien genetiikkaa Yhden geenin sairaudet Monitekijäiset sairaudet Irma Järvelä Lääketieteellisen genetiikan osasto Helsingin yliopisto 2012 Ilmiasu Säätelevä geeni Alttiusgeeni

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Terveyteen liittyvät geenitestit

Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Jokaisella meistä on vanhemmiltamme perittynä oma yksilöllinen geenivalikoimamme. Tämä geneettinen rakenteemme yhdessä erilaisten ympäristön

Lisätiedot

GEENIT SKITSOFRENIAN AIHEUTTAJANA. Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9.

GEENIT SKITSOFRENIAN AIHEUTTAJANA. Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9. GEENIT SKITSOFRENIAN AIHEUTTAJANA Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9.2009 SKITSOFRENIAN ETIOLOGIAA Hermoston kehityksen häiriö Poikkeava neurotransmissio

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen käyttöön liittyviä haasteita Juhani Eskola 310505 7.6.2005 1 Valitut painopistealueet Kansantautien ja terveyden geenitausta Mikrobit ja

Lisätiedot

Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä?

Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Antti Latvala Sosiaalilääketieteen päivät 28.11.2012 Esityksen teemat Miksi ja miten huomioida geneettisten

Lisätiedot

Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi

Lisätiedot

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän

Lisätiedot

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does

Lisätiedot

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä

Lisätiedot

KEESHONDIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,

Lisätiedot

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 12 X-kromosominen periytyminen TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 FOLKHÄLSANS GENETISKA KLINIK PB 211, (Topeliusgatan 20) 00251 Helsingfors tel (09)

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

Sairastuneiden ja omaisten kanssa keskusteleminen

Sairastuneiden ja omaisten kanssa keskusteleminen Infosheet 38 Sairastuneiden ja omaisten kanssa keskusteleminen Ymmärrettävä tieto Antamalla ihmisille tilaisuuden esittää kysymyksensä voit räätälöidä heidän tarpeisiinsa sopivaa tietoa. Jokaiseen keskusteluun

Lisätiedot

SELVITYS SIITÄ MITEN ERÄÄT PERINNÖLLISET SAIRAUDET (KUTEN GPRA JA FUCOSIDOSIS) PERIYTYVÄT ENGLANNINSPRINGERSPANIELEISSA

SELVITYS SIITÄ MITEN ERÄÄT PERINNÖLLISET SAIRAUDET (KUTEN GPRA JA FUCOSIDOSIS) PERIYTYVÄT ENGLANNINSPRINGERSPANIELEISSA SELVITYS SIITÄ MITEN ERÄÄT PERINNÖLLISET SAIRAUDET (KUTEN GPRA JA FUCOSIDOSIS) PERIYTYVÄT ENGLANNINSPRINGERSPANIELEISSA Kaikki koiran perimät geenit sisältyvät 39 erilliseen kromosomipariin. Geenejä arvellaan

Lisätiedot

Geenikartoitusmenetelmät. Kytkentäanalyysin teoriaa. Suurimman uskottavuuden menetelmä ML (maximum likelihood) Uskottavuusfunktio: koko aineisto

Geenikartoitusmenetelmät. Kytkentäanalyysin teoriaa. Suurimman uskottavuuden menetelmä ML (maximum likelihood) Uskottavuusfunktio: koko aineisto Kytkentäanalyysin teoriaa Pyritään selvittämään tiettyyn ominaisuuteen vaikuttavien eenien paikka enomissa Perustavoite: löytää markkerilokus jonka alleelit ja tutkittava ominaisuus (esim. sairaus) periytyvät

Lisätiedot

Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta

Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta Hammaslääketiede Perinnöllisten tautien diagnostiikka ja perinnöllisyysneuvonta Ryhmäopetus 22.11.2012 Irma Järvelä Ihmisen kromosomisto: 46 kromosomiparia, joista kaksi sukupuolen määräävää: Naiset 46,

Lisätiedot

Monogeeniset sairaudet. Monogeeninen periytyminen. Perinnöllisten tautien prevalenssi. Monitekijäiset sairaudet. Dominantti vs.

Monogeeniset sairaudet. Monogeeninen periytyminen. Perinnöllisten tautien prevalenssi. Monitekijäiset sairaudet. Dominantti vs. Monogeeniset sairaudet Monogeeninen Pirkka-Pekka Laurila, LL Lääketieteellisen genetiikan osasto, HY Finnish Institute for Molecular Medicine, FIMM Mutaatio yhdessä geenissä riittävä aiheuttamaan sairauden

Lisätiedot

Farmakogeneettiset testit apuna lääkehoidon arvioinnissa

Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit Farmakogenetiikalla tarkoitetaan geneettisiä variaatioita, jotka vaikuttavat lääkeainevasteeseen. Geneettisen tiedon hyödyntäminen

Lisätiedot

Narkolepsian immunologiaa ja Pandemrixiin liittyvät tutkimkset

Narkolepsian immunologiaa ja Pandemrixiin liittyvät tutkimkset Narkolepsian immunologiaa ja Pandemrixiin liittyvät tutkimkset Outi Vaarala, Immuunivasteyksikön päällikkö, THL Narkolepsian kulku - autoimmuunihypoteesiin perustuva malli Hypokretiinia Tuottavat neuronit

Lisätiedot

Uusi rekisteripohjainen diabetesluokitus kohti täsmähoitoa

Uusi rekisteripohjainen diabetesluokitus kohti täsmähoitoa Uusi rekisteripohjainen diabetesluokitus kohti täsmähoitoa 26.9.2016 Annemari Käräjämäki Sidonnaisuudet kahden viimeisen vuoden ajalta LL, yleislääketieteen erikoislääkäri Työantajat Vaasan keskussairaala,

Lisätiedot

III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 15. Populaatiogenetiikka ja evoluutio 1. Avainsanat 2. Evoluutio muuttaa geenipoolia 3. Mihin valinta kohdistuu? 4. Yksilön muuntelua

Lisätiedot

Selkäydinneste vai geenitutkimus?

Selkäydinneste vai geenitutkimus? Selkäydinneste vai geenitutkimus? 19.5.2016 Anne Remes, professori, ylilääkäri, Itä-Suomen yliopisto, KYS, Neurokeskus Nuorehko muistipotilas, positiivinen sukuhistoria Päästäänkö diagnostiikassa tarkastelemaan

Lisätiedot

Seulontatutkimusten perusperiaatteet

Seulontatutkimusten perusperiaatteet Seulontatutkimusten perusperiaatteet Ilona Autti-Rämö, dos Finohta / Sikiöseulontojen yhtenäistäminen / Ilona Autti-Rämö 1 Seulontatutkimuksen yleiset periaatteet Tutkitaan sovittu ryhmä oireettomia henkilöitä,

Lisätiedot

Harvinaisten sairauksien tutkimisen eettiset pulmat

Harvinaisten sairauksien tutkimisen eettiset pulmat Harvinaisten sairauksien tutkimisen eettiset pulmat Helena Kääriäinen Tutkimusprofessori, THL Varapj, TUKIJA Harvinaiset sairaudet Ovat nimensä mukaan harvinaisia EU:ssa tauti lasketaan harvinaiseksi,

Lisätiedot

Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori

Lisätiedot

Vastasyntyneiden aineenvaihduntaseula. 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka

Vastasyntyneiden aineenvaihduntaseula. 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka Vastasyntyneiden aineenvaihduntaseula 24.9.2015 Risto.Lapatto@Hus.Fi HY ja HYKS Lastenklinikka Esityksen tavoitteet Ymmärrät mistä tässä on kyse Seulontoja on erilaisia Näyte otetaan vauvasta Ketään ei

Lisätiedot

Symbioosi 2 TEHTÄVÄT

Symbioosi 2 TEHTÄVÄT Luku 13 Symbioosi 2 TEHTÄVÄT 1. Yhdistä kaavioon oikealle paikalle a. P-polvi b. F 1 -polvi c. F 2 -polvi d. sukusolut e. genotyyppi 2. Miten seuraavat käsitteet eroavat toisistaan? a. Fenotyyppi ja genotyyppi

Lisätiedot

Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016

Lisätiedot

Nivelreuman serologiset testit: mitä ne kertovat? LT, apulaisylilääkäri Anna-Maija Haapala TAYS Laboratoriokeskus

Nivelreuman serologiset testit: mitä ne kertovat? LT, apulaisylilääkäri Anna-Maija Haapala TAYS Laboratoriokeskus Nivelreuman serologiset testit: mitä ne kertovat? LT, apulaisylilääkäri Anna-Maija Haapala TAYS Laboratoriokeskus Sisältö 1. Nivelreuma: etiologia, esiintyvyys, diagnostiikka 2. Nivelreuman serologiset

Lisätiedot

Perinnöllinen välimerenkuume

Perinnöllinen välimerenkuume www.printo.it/pediatric-rheumatology/fi/intro Perinnöllinen välimerenkuume 2. DIAGNOOSI JA HOITO 2.1 Miten tauti todetaan? Yleensä taudin määrittelyssä edetään seuraavasti: Kliininen epäily: Perinnöllistä

Lisätiedot

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien

Lisätiedot

Geenit ja ympäristötekijät koulutustason ja alkoholiongelmien taustalla

Geenit ja ympäristötekijät koulutustason ja alkoholiongelmien taustalla Geenit ja ympäristötekijät koulutustason ja alkoholiongelmien taustalla Antti Latvala Helsingin yliopisto, Kansanterveystieteen osasto THL, Mielenterveys ja päihdepalvelut osasto antti.latvala@helsinki.fi

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

vauriotyypit Figure 5-17.mhc.restriktio 9/24/14 Autoimmuniteetti Kudosvaurion mekanismit Petteri Arstila Haartman-instituutti Patogeeniset mekanismit

vauriotyypit Figure 5-17.mhc.restriktio 9/24/14 Autoimmuniteetti Kudosvaurion mekanismit Petteri Arstila Haartman-instituutti Patogeeniset mekanismit vauriotyypit Kudosvaurion mekanismit Autoimmuniteetti Petteri Arstila Haartman-instituutti Antigeenin tunnistus HLA:ssa pitää sisällään autoimmuniteetin riskin: jokaisella on autoreaktiivisia lymfosyyttejä

Lisätiedot

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays

Lisätiedot

C. difficile-diagnostiikan vaikutus epidemiologiaan, potilaan hoitoon ja eristyskäytäntöihin. Miksi lasten C. difficileä ei hoideta? 16.3.

C. difficile-diagnostiikan vaikutus epidemiologiaan, potilaan hoitoon ja eristyskäytäntöihin. Miksi lasten C. difficileä ei hoideta? 16.3. C. difficile-diagnostiikan vaikutus epidemiologiaan, potilaan hoitoon ja eristyskäytäntöihin. Miksi lasten C. difficileä ei hoideta? 16.3.2016 Eero Mattila HUS Infektioklinikka CDI = C. difficile infektio

Lisätiedot

Kehitysvamma autismin liitännäisenä vai päinvastoin? Maria Arvio

Kehitysvamma autismin liitännäisenä vai päinvastoin? Maria Arvio Kehitysvamma autismin liitännäisenä vai päinvastoin? Maria Arvio Mitä yhteistä autismilla (A) ja kehitysvammalla (KV)? Elinikäiset tilat Oireita, ei sairauksia Diagnoosi tehdään sovittujen kriteereiden

Lisätiedot

NLRP12-geeniin liittyvä toistuva kuume

NLRP12-geeniin liittyvä toistuva kuume www.printo.it/pediatric-rheumatology/fi/intro NLRP12-geeniin liittyvä toistuva kuume 1. MIKÄ ON NLRP12-GEENIIN LIITTYVÄ TOISTUVA KUUME? 1.1 Mikä se on? NLRP12-geeniin liittyvä toistuva kuume on perinnöllinen

Lisätiedot

Keuhkoahtaumatauti 2007

Keuhkoahtaumatauti 2007 Keuhkoahtaumatauti 2007 Maailmanlaajuisesti jopa 16 miljoonaa ihmistä sairastaa keuhkoahtaumatautia. Kansainvälisten tutkimusten mukaan 56 85 prosenttia tautitapauksista saattaa olla diagnosoimatta (Kinnula,

Lisätiedot

SÄTEILYN GENEETTISET VAIKUTUKSET

SÄTEILYN GENEETTISET VAIKUTUKSET 8 SÄTEILYN GENEETTISET VAIKUTUKSET Sisko Salomaa SISÄLLYSLUETTELO 8.1 Ihmisen perinnölliset sairaudet... 122 8.2 Perinnöllisten sairauksien taustailmaantuvuus... 125 8.3 Perinnöllisen riskin arviointi...

Lisätiedot

Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja

Lisätiedot

Muistisairaudet saamelaisväestössä

Muistisairaudet saamelaisväestössä Muistisairaudet saamelaisväestössä Anne Remes Professori, ylilääkäri Kliininen laitos, neurologia Itä-Suomen yliopisto, KYS Esityksen sisältö Muistisairauksista yleensä esiintyvyys tutkiminen tärkeimmät

Lisätiedot

LAAJAN SUOSTUMUKSEN ONGELMIA. Tuija Takala Dosentti, HY Tutkimuspäällikkö, Aalto-yliopisto

LAAJAN SUOSTUMUKSEN ONGELMIA. Tuija Takala Dosentti, HY Tutkimuspäällikkö, Aalto-yliopisto LAAJAN SUOSTUMUKSEN ONGELMIA Tuija Takala Dosentti, HY Tutkimuspäällikkö, Aalto-yliopisto Näytteiden jatkokäytön edut Resurssien hyötykäyttö Taloudellinen hyöty (erilaisille toimijoille) Suomi tutkimuksen

Lisätiedot

A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen

A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen Asiasisältö Keskeisyys Taso 1 2 3 A B C 1 Yleiskäsitteitä periytymiseen liittyen 1.1 Penetranssi

Lisätiedot

} Vastinkromosomit. Jalostusta selkokielellä. Miten niin voidaan jalostaa?

} Vastinkromosomit. Jalostusta selkokielellä. Miten niin voidaan jalostaa? Jalostusta selkokielellä Vuokatin jalostuskurssi 2015 Pirkko Taurén Miten niin voidaan jalostaa? Eri yksilöiden välillä on eroja Sukulaiset muistuttavat enemmän toisiaan kuin yksilöt keskimäärin Geenit

Lisätiedot

52746 Geneettinen analyysi

52746 Geneettinen analyysi 52746 Geneettinen analyysi Kaikille yhteiset luennot (3 kpl) Maanantai 3.2. Klo 10.15-12 Biokeskus 2 auditorio 1041 Todennäköisyyslaskennan kertaus, merkitys perinnöllisyystieteessä! Keskiviikko 5.2. Tilastotiede

Lisätiedot

Narkolepsia ja mitä tiedämme sen syistä

Narkolepsia ja mitä tiedämme sen syistä Työterveyslaitos Narkolepsia ja mitä tiedämme sen syistä Christer Hublin Neurologian dosentti ja erikoislääkäri Unilääketieteen erityispätevyys (SLL) Sleep Medicine Specialist (ESRS/NOSMAC) Esityksen sisältö

Lisätiedot

Suomenhevosten kasvuhäiriötutkimus Susanna Back

Suomenhevosten kasvuhäiriötutkimus Susanna Back Suomenhevosten kasvuhäiriötutkimus Susanna Back 1 Tutkimuksen tavoite Kartoittaa suomenhevospopulaatiossa osteokondroosin (OD) esiintyvyyttä ja periytyvyyttä (heritabiliteetti) Osa suomenhevosten jalostusohjesäännön

Lisätiedot

Autoimmuunitaudit: osa 1

Autoimmuunitaudit: osa 1 Autoimmuunitaudit: osa 1 Autoimmuunitaute tunnetaan yli 80. Ne ovat kroonisia sairauksia, joiden syntymekanismia eli patogeneesiä ei useimmissa tapauksissa ymmärretä. Tautien esiintyvyys vaihtelee maanosien,

Lisätiedot

PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa. Jyrki Lötjönen, johtava tutkija VTT

PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa. Jyrki Lötjönen, johtava tutkija VTT PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa Jyrki Lötjönen, johtava tutkija VTT 2 Alzheimerin taudin diagnostiikka Alzheimerin tauti on etenevä muistisairaus. Alzheimerin tauti

Lisätiedot

Vesirokkorokotukset vihdoinkin lasten rokotusohjelmaan

Vesirokkorokotukset vihdoinkin lasten rokotusohjelmaan Vesirokkorokotukset vihdoinkin lasten rokotusohjelmaan Tuija Leino, ylilääkäri Rokotusohjelmayksikkö 5.5.2017 Ei sidonnaisuuksia lääketeollisuuteen, THL: ssä vuodesta 1997 27.4.2017 Esityksen nimi / Tekijä

Lisätiedot

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma Evoluutio BI Elämä ja evoluutio Leena Kangas-Järviluoma 1 Evoluutio lajinkehitystä, jossa eliölajit muuttuvat ja niistä voi kehittyä uusia lajeja on jatkunut elämän synnystä saakka, sillä ei ole päämäärää

Lisätiedot

Genomitiedosta osa terveystietoa

Genomitiedosta osa terveystietoa Chembio 29.03.2017 Genomitiedosta osa terveystietoa Kristiina Aittomäki, ylilääkäri HYKS/HUSLAB, Helsingin yliopisto kristiina.aittomaki@hus.fi Kansallinen genomistrategia Työryhmän ehdotus julkaistiin

Lisätiedot

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015 Katekoli-O-metyylitransferaasi ja kipu Oleg Kambur Kipu Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 1 Katekoli-O-metyylitransferaasi (COMT) proteiini tuotetaan

Lisätiedot

Kliininen arviointi ja kliininen tieto mikä riittää?

Kliininen arviointi ja kliininen tieto mikä riittää? Kliininen arviointi ja kliininen tieto mikä riittää? Riittävä tutkimuksen otoskoko ja tulos Timo Partonen LT, psykiatrian dosentti, Helsingin yliopisto Ylilääkäri, Terveyden ja hyvinvoinnin laitos Tutkimuksen

Lisätiedot

VASTAUS 2a: Ruusukaijasten väri

VASTAUS 2a: Ruusukaijasten väri VASTAUS 2a: Ruusukaijasten väri Merkitään: ZK= Vihreän värin aiheuttava dominoiva alleeli Zk= keltaisen värin aiheuttava resessiivinen alleeli W= W-kromosomi Keltaisen koiraan perimä ZkZk, vihreän naaraan

Lisätiedot

Tutkimusasetelmat. - Oikea asetelma oikeaan paikkaan - Vaikeakin tutkimusongelma voi olla ratkaistavissa oikealla tutkimusasetelmalla

Tutkimusasetelmat. - Oikea asetelma oikeaan paikkaan - Vaikeakin tutkimusongelma voi olla ratkaistavissa oikealla tutkimusasetelmalla Tutkimusasetelmat - Oikea asetelma oikeaan paikkaan - Vaikeakin tutkimusongelma voi olla ratkaistavissa oikealla tutkimusasetelmalla Jotta kokonaisuus ei unohdu Tulisi osata Tutkimusasetelmat Otoskoko,

Lisätiedot

Symbioosi 2 VASTAUKSET. b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl

Symbioosi 2 VASTAUKSET. b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl Luku 14 Symbioosi 2 VASTAUKSET 1. Banaanikärpänen dihybridiristeytys a. Mikä on vanhempien genotyyppi? Vastaus: VvLl b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl c.

Lisätiedot

BIOLÄÄKETIETEEN LÄPIMURROT

BIOLÄÄKETIETEEN LÄPIMURROT BIOLÄÄKETIETEEN LÄPIMURROT Jussi Huttunen Tampere 20.4.2016 LÄÄKETIETEEN MEGATRENDIT Väestö vanhenee ja sairauskirjo muuttuu Teknologia kehittyy - HOITOTEKNOLOGIA - tietoteknologia Hoito yksilöllistyy

Lisätiedot

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se

Lisätiedot

KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS Koirilla esiintyy useita erilaisia perinnöllisiä sairauksia samalla tavalla kuin ihmisilläkin. Rotuhistoriasta johtuen perinnöllisten sairauksien yleisyys

Lisätiedot

Pia Soronen (FM, LK, väitellyt) 21.3.2013

Pia Soronen (FM, LK, väitellyt) 21.3.2013 Pia Soronen (FM, LK, väitellyt) 21.3.2013 Yleistä periytyvyydestä ja genetiikasta Miten perinnöllisyyttä tutkitaan Kytkentäanalyyseistä nykypäivään Tärkeimmät löydökset Ehdokasgeeni esimerkkejä Uudet GWAS

Lisätiedot

Osteoporoosi (luukato)

Osteoporoosi (luukato) Osteoporoosi (luukato) Lääkärikirja Duodecim Pertti Mustajoki, sisätautien erikoislääkäri Osteoporoosi tarkoittaa, että luun kalkkimäärä on vähentynyt ja luun rakenne muuttunut. Silloin luu voi murtua

Lisätiedot

Harvinaiset sairaudet Euroopassa

Harvinaiset sairaudet Euroopassa Harvinaiset sairaudet Euroopassa Helena Kääriäinen 5.10.2012 Esityksen nimi / Tekijä 1 Euroopan unionin suositus toimista harvinaisten sairauksien alalla (suositus 2009/C 151/02) kansallinen ohjelma osaamiskeskukset

Lisätiedot

Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Geenitutkimuksista Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; Huhtikuussa 2008 Tätä työtä

Lisätiedot

NCL australiankarjakoirilla

NCL australiankarjakoirilla NCL australiankarjakoirilla Yleistä NCL-ryhmään kuuluvat sairaudet ovat kuolemaan johtavia, yleensä resessiivisesti periytyviä sairauksia. Niissä mutaatiosta johtuva geenivirhe aiheuttaa sen, että hermosoluihin

Lisätiedot

Tieteellinen yhteistyö lääkekehityksessä merkittävistä geenivarianteista (IPHG)

Tieteellinen yhteistyö lääkekehityksessä merkittävistä geenivarianteista (IPHG) 16 BIOPANKKI 16 BIOPANKKI... 1 16.001 Tieteellinen yhteistyö lääkekehityksessä merkittävistä geenivarianteista (IPHG)... 2 16.002 Samuli Ripatti et al.... 2 16.003 Aarno Palotie et al.... 3 16.004 Josine

Lisätiedot

Geenitutkimuksen voittokulku on herättänyt

Geenitutkimuksen voittokulku on herättänyt Seulonnat Juha Kere Geenitestauksesta puhutaan paljon, mutta sitä käytetään vähän. Minkälaisia näköaloja geenitestien seulontakäyttöön liittyy? Tämän kirjoituksen näkökulma perustuu laskelmiin ja arvioihin

Lisätiedot

Monitekijäisten tautien genetiikka

Monitekijäisten tautien genetiikka Juha Kere, Samuli Ripatti ja Markus Perola TEEMA: LEENA PELTONEN-PALOTIE Monitekijäisten tautien genetiikka Monitekijäisillä taudeilla tarkoitetaan sellaisia, paljolti tavallisia tauteja, joiden syntyyn

Lisätiedot

Lapsuusiän astman ennuste aikuisiällä Anna Pelkonen, LT, Dos Lastentautien ja lasten allergologian el HYKS, Iho-ja allergiasairaala

Lapsuusiän astman ennuste aikuisiällä Anna Pelkonen, LT, Dos Lastentautien ja lasten allergologian el HYKS, Iho-ja allergiasairaala Lapsuusiän astman ennuste aikuisiällä Anna Pelkonen, LT, Dos Lastentautien ja lasten allergologian el HYKS, Iho-ja allergiasairaala 22.1.2015 Mikä on lapseni astman ennuste? Mikä on lapsen astman ennuste

Lisätiedot

Sukupuolitautien Käypä hoito - suositus. Risto Vuento Laboratoriokeskus PSHP

Sukupuolitautien Käypä hoito - suositus. Risto Vuento Laboratoriokeskus PSHP Sukupuolitautien Käypä hoito - suositus Risto Vuento Laboratoriokeskus PSHP 3.11.2009 Tavoitteet (1) Tavoitteena on vähentää sukupuoliteitse tarttuvien tautien esiintymistä yhdenmukaistamalla niiden diagnostiikkaa

Lisätiedot

Pohjois-Suomen syntymäkohorttitutkimus Yleisöluento , Oulu

Pohjois-Suomen syntymäkohorttitutkimus Yleisöluento , Oulu Pohjois-Suomen syntymäkohorttitutkimus Yleisöluento 12.11.2016, Oulu TUKI- JA LIIKUNTAELIMISTÖN SAIRAUDET (TULES) Professori Jaro Karppinen TUKI- JA LIIKUNTAELIMISTÖ Tuki- ja liikuntaelimistöön kuuluvat

Lisätiedot

Clostridium difficile diagnostiikan nykyvaihe ja pulmat. Janne Aittoniemi, LT, dos, oyl Fimlab Laboratoriot Oy

Clostridium difficile diagnostiikan nykyvaihe ja pulmat. Janne Aittoniemi, LT, dos, oyl Fimlab Laboratoriot Oy Clostridium difficile diagnostiikan nykyvaihe ja pulmat Janne Aittoniemi, LT, dos, oyl Fimlab Laboratoriot Oy 1.10.2013 Cd-laboratoriodiagnostiikan pulmat - Kuinka Cd-infektio pitäisi diagnostisoida laboratoriossa?

Lisätiedot

Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta

Lisätiedot

Erikoissairaanhoidon tehtävät hoitosuunnitelman tekemisessä Hanna Kuusisto hallintoylilääkäri neurologian el, dos, LT, FT Kanta-Hämeen keskussairaala

Erikoissairaanhoidon tehtävät hoitosuunnitelman tekemisessä Hanna Kuusisto hallintoylilääkäri neurologian el, dos, LT, FT Kanta-Hämeen keskussairaala Erikoissairaanhoidon tehtävät hoitosuunnitelman tekemisessä Hanna Kuusisto hallintoylilääkäri neurologian el, dos, LT, FT Kanta-Hämeen keskussairaala 2017 Pitkäaikaissairaan terveys- ja hoitosuunnitelma

Lisätiedot

Pakko-oireisen häiriön epidemiologiaa. Esiintyvyys Oheissairastavuus Ennuste

Pakko-oireisen häiriön epidemiologiaa. Esiintyvyys Oheissairastavuus Ennuste Pakko-oireisen häiriön epidemiologiaa Esiintyvyys Oheissairastavuus Ennuste Prevalenssilukuja Authors Number Age prevalence (%) M/F(% or n) Flament et al. 1988, USA 5596 14-18 1,9* 11M/9F Lewinsohn et

Lisätiedot

Geenitutkimukset tilannekatsaus

Geenitutkimukset tilannekatsaus Geenitutkimukset tilannekatsaus Miten geenejä tutkitaan? Complex traits voiko niihin vaikuttavia geenejä löytää? Saksanpaimenkoiran projektit - tilannekatsaus Katriina Tiira, FT, Peruseläinlääketieteen

Lisätiedot

Kokeellinen interventiotutkimus

Kokeellinen interventiotutkimus Kokeellinen interventiotutkimus Raija Sipilä LT, toimituspäällikkö Suomalainen Lääkäriseura Duodecim Kriittisen arvioinnin kurssi 2.10.2017 Kiitos Käypä hoito -tiimille Interventio Interventio tarkoittaa

Lisätiedot

Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012

Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012 Neurogenetiikkaa Lääketieteellinen genetiikka, L3, Syksy 2012 23.8. 2012 Anna-Elina Lehesjoki, LKT Professori, tutkimusjohtaja Neurotieteen tutkimuskeskus, Helsingin yliopisto Lääketieteellisen genetiikan

Lisätiedot

Suunnitelma Perinnöllisyys T9

Suunnitelma Perinnöllisyys T9 Suunnitelma Perinnöllisyys T9 Oppimistavoitteet Järjestelmällisten biologisten laboratoriotutkimuksien tekeminen. Perinnöllisyyteen liittyvien käsitteiden, mallien ja teorioiden ymmärtäminen ja käyttäminen

Lisätiedot