VASTAUS 1: Yhdistä oikein

Koko: px
Aloita esitys sivulta:

Download "VASTAUS 1: Yhdistä oikein"


1 KPL3

2 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen e) replikaatiohaarukka - II) dna:n kahdentuminen f) f) silmukointi - VIII) esiasterna g) g) antikodoni - I) siirtäjärna h) h) perimä - VII) yksilön kaikki dna

3 VASTAUS 2: Termit a) Dna b) Geeni c) Eksoni d) Introni e) Promoottori f) Operoni

4 VASTAUS 3: Proteiinisynteesi 6. translaatio eli siirtäjä-rna:t tuovat aminohapot ribosomille 3. transkriptio eli esi-lähetti-rna:n muodostuminen tumassa dnajuosteen mallin mukaisesti 2. dna-kaksoisjuoste avautuu 4. lähetti-rna kypsyy 5. lähetti-rna siirtyy ribosomille 8. aminohappoketjut laskostuvat kolmi- ulotteiseksi rakenteeksi 7. aminohapot kiinnittyvät toisiinsa peptidisidoksin 1. rna-polymeraasin kiinnittyminen promoottoriin

5 VASTAUS 4: Emäkset a) TACTATAATTGGCGGCTTTCGGCG b) AUGAUAUUAACCGCCGAAAGCCGC c) UAC UAU AAU UGG CGG CUU UCG GCG d) metioniini, isoleusiini, leusiini, treoniini, alaniini, glutamiinihappo,seriini, arginiini e) Isoleusiinin paikalle tulisikin leusiini f) Polypeptidiketjuun tulisi vain kolme aminohappoa metioniini, tyrosiini kolmas emäskolmikko olisi tuolloin lopetuskolmikko ja synteesi päättyisi tähän.

6 VASTAUS 5: Käsitekartta 1. pistemutaatio 2. kromosomimutaatio 3-5. kahdentuma, siirtymä, kääntymä 6. kromosomistomutaatio 7-8. monosomia, trisomia Allo- ja autopolyploidia

7 VASTAUS 6: YO S-08 Geeni on osa kromosomin dna-ketjua, joka koodaa kolmen emäksen jaksoina yhtä peptidiketjua. Geeni on kromosomissa sijaitseva perintötekijä. Geenistä voi olla eri alleeleja. Esitumaisilla geenin koodaava jakso on yhtenäinen, mutta tumallisilla se on usein jaksottunut koodaaviin (eksoneihin) ja ei-koodaaviin alueisiin (introneihin). Valmiissa lähetti rna:ssa on vain koodaavia alueita vastaavat alueet. Yksittäisissä geeneissä on säätelyalue (promoottori) ja varsinainen koodaava alue. Rna-polymeraasi sitoutuu promoottoriin ja lähetti rna:ta alkaa muodostua. Esitumaisilla sama säätelyalue voi säädellä useiden peräkkäisten geenien toimintaa (operoni). Geenien säätelyyn voi osallistua tehostajajaksoja. Ne voivat sijaita hyvinkin kaukana itse geenistä.

8 VASTAUS 7: YO S-05 Tieto valmistettavan proteiinin aminohappojärjestyksestä sisältyy dna:n emäsjärjestykseen, jossa yksi emäskolmikko vastaa yhtä aminohappoa. toimivan geenin alueelta kaksijuosteinen dna avautuu, viereen rakentuu emäsparisäännön mukaisesti (A U; T A; C G; G C) lähetti-rna lähetti-rna siirtyy tumasta tumakelmun huokosen kautta solulimaan ribosomille Siirtäjä-rna:t kuljettavat kukin oman aminohapponsa ribosomille. Siirtäjärna:n antikodoni ja lähetti-rna:n kodoni vastaavat toisiaan emäsparisäännöllä. Näin lähetti-rna:lle kopioitu geenin nukleotidikoodi kääntyy proteiinin aminohappojärjestykseksi

9 VASTAUS 7: YO S-05 Taulukosta 33B ilmenee että glutamiinihappoa vastaa kaksi emäskolmikkoa (CTT ja CTC) ja valiinia vastaa neljä eri emäskolmikkoa (CAA, CAG, CAT, CAC) Todennäköisintä on, että dna-koodissa on tapahtunut yksi pistemutaatio: CTT tai CTC keskimmäinen emäs on vaihtunut tymiinistä adeniiniksi CAT tai CAC Proteiinin avaruusrakenne määräytyy sen aminohappojärjestyksen mukaan. Oikea tertiäärirakenne taas vaikuttaa valkuaisen totuttuun toimintaan Sirppisoluhemoglobiini ei sido happea kuten normaali hemoglobiini. Poikkeava hemoglobiinirakenne ilmenee punasolujen sirppimäisyytenä, jolloin niiden hapenkuljetuskin veressä häiriintyy.

10 VASTAUS 8: YO K-10 a) Lähetti-rna:n emäsjärjestystä vastaava pätkä dna:n mallijuostetta on 3 ATAGGGGACATC (lopetus). Taulukosta 33B saadaan entsyymin vastaava aminohappojärjestys: tyrosiini, proliini, arginiini, lopetus. Lopetus-kodonia vastaavaa siirtäjä-rna:ta ei ole, joten proteiinisynteesi päättyy ennen aikaisesti, eikä toimivaa entsyymiä synny. b) Neljästä emäksestä saadaan 64 erilaista emäskolmikkoa. Erilaisia aminohappoja on 20 samaa aminohappoa voi koodata useampi dna:n emäskolmikko (taulukko 33B). Yhden emäksen mutaatio voi olla neutraali eikä näy fenotyypissä. c) Dna:n eristäminen, puhdistus, pilkkominen katkaisuentsyymillä, kloonaus, tunnistus koettimen avulla, dna - pätkien erottaminen elektroforeettisesti, emäsjärjestyksen määrittäminen sekvensoimalla. Dna:n eristäminen, puhdistus, pilkkominen katkaisuentsyymillä, monistaminen PCR -tekniikalla, elektroforeesi, sekvensointi (emäsjärjestyksen tunnistaminen perustuu eri tavoin merkattuihin lopettaviin nukleotideihin).

Francis Crick ja James D. Watson

Francis Crick ja James D. Watson Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel-palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän


DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri


II Genetiikka 4.(3) Nukleiinihapot

II Genetiikka 4.(3) Nukleiinihapot II Genetiikka 4.(3) Nukleiinihapot Geenitekniikka - menetelmiä, joiden avulla dna:ta ja rna:ta voidaan eristää, muokata ja siirtää muihin soluihin tai eliöihin kromosomit koostuvat dna-rihmasta ja siihen


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat


Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Perinnöllinen informaatio sijaitsee dna:ssa eli deoksiribonukleiinihapossa


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


Nimi sosiaaliturvatunnus

Nimi sosiaaliturvatunnus Valintakoe 2013 / Biokemia Nimi sosiaaliturvatunnus 1. Selitä: (3,0 p) a) Mitä ovat eksonit ja intronit ja miten ne eroavat toisistaan? b) Mitä eläinsolulle tapahtuu, jos se laitetaan sen sisällä olevaa



SÄTEILYN TERVEYSVAIKUTUKSET SÄTEILYN TERVEYSVAIKUTUKSET 25 Säteily- ja ydinturvallisuus -kirjasarjan toimituskunta: Sisko Salomaa, Wendla Paile, Tarja K. Ikäheimonen, Roy Pöllänen, Anne Weltner, Olavi Pukkila, Jorma Sandberg, Heidi


Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin





Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi


LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä



Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30 Tampereen yliopisto Bioteknologian tutkinto-ohjelma Valintakoe 21.5.2015 Henkilötunnus - Sukunimi Etunimet Tehtävä 3 Pisteet / 30 3. a) Alla on lyhyt jakso dsdna:ta, joka koodaa muutaman aminohappotähteen


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne



BIOLOGIAN OSIO (45 p.) BIOLÄÄKETIETEEN KOULUTUSOHJELMA PÄÄSYKOE 17.5.2017 BIOLOGIAN OSIO (45 p.) HYVÄN VASTAUKSEN PIIRTEET I) Esseetehtävät (2 kpl) a) Selitä perustellen, miten kuvaan merkittyihin kohtiin osuvat mutaatiot voivat


DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Ribosomit 1. Ribosomit 2. Ribosomit 3

Ribosomit 1. Ribosomit 2. Ribosomit 3 Ribosomit 1 Palade & Siekevitz eristivät jaottelusentrifugaatiolla ns. mikrosomeja radioakt. aminohapot kertyivät mikrosomeihin, jotka peräisin rer:ää sisältävistä soluista proteiinisynteesi soluliman


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. Valitse listasta kunkin yhdisteen yleiskielessä käytettävä ei-systemaattinen nimi. (pisteet yht. 5p) a) C-vitamiini b) glukoosi c) etikkahappo d) salisyylihappo e) beta-karoteeni a. b. c. d. e. ksylitoli


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 BIOLÄÄKETIETEEN Henkilötunnus: - KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 Kirjoita selvästi nimesi ja muut henkilötietosi niille varattuun


Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,


KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla 1. Avainsanat 2. Solut lisääntyvät jakautumalla 3. Dna eli deoksiribonukleiinihappo sisältää perimän


Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa


DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit


a) dominoivaan: esiintyy joka sukupolvessa, sairaille vanhemmille voi syntyä terveitä lapsia

a) dominoivaan: esiintyy joka sukupolvessa, sairaille vanhemmille voi syntyä terveitä lapsia 1. Sukupuut Seuraavat ihmisen sukupuut edustavat periytymistä, jossa ominaisuuden määrää yksi alleeli. Päättele sukupuista A-F, mitä periytymistapaa kukin niistä voi edustaa. Vastaa taulukkoon kirjaimin



NON-CODING RNA (ncrna) NON-CODING RNA (ncrna) 1. Yleistä NcRNA eli non-coding RNA tarkoittaa kaikkia proteiinia koodaamattomia rnamolekyylejä. Näistä yleisimmin tunnetut ovat ribosomaalinen RNA (rrna) sekä siirtäjä-rna (trna),



PROTEIINIEN RAKENTAMINEN PROTEIINIEN RAKENTAMINEN TAUSTAA Proteiinit ovat äärimmäisen tärkeitä kaikille elämänmuodoille. Kaikki solut tarvitsevat prote- iineja toimiakseen kunnolla. Osa proteiineista toimii entsyymeinä eli nopeuttaa


Biopolymeerit. Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä.

Biopolymeerit. Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä. Biopolymeerit Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä. Tärkeimpiä biopolymeerejä ovat hiilihydraatit, proteiinit ja nukleiinihapot. 1 Hiilihydraatit Hiilihydraatit jaetaan mono



465 E MOLEKYYLIBIOLOGIAA 465 E MOLEKYYLIBIOLOGIAA 466 E1 Geneettinen koodi elämän yhteinen kieli Latvala Juho & Seppälä Mika Solu-ja kehitysbiologian kurssin kirjoitelma Anatomian ja solubiologian laitos, Oulun yliopisto 12.9.2009


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


DNA, RNA ja proteiinirakenteen ennustaminen

DNA, RNA ja proteiinirakenteen ennustaminen S-114.500 Solubiosysteemien perusteet Harjoitustyö Syksy 2003 DNA, RNA ja proteiinirakenteen ennustaminen Ilpo Tertsonen, 58152p Jaakko Niemi, 55114s Sisällysluettelo 1. Alkusanat... 3 2. Johdanto... 4


"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein


Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.


VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


3 Eliökunnan luokittelu

3 Eliökunnan luokittelu 3 Eliökunnan luokittelu YO Biologian tehtävien vastausohjeista osa on luettelomaisia ja vain osa on laadittu siten, että ohjeen mukainen mallivastaus riittää täysiin pisteisiin esimerkiksi ylioppilaskokeessa.


Ribosomit 1. Ribosomit 4. Ribosomit 2. Ribosomit 3. Proteiinisynteesin periaate 1

Ribosomit 1. Ribosomit 4. Ribosomit 2. Ribosomit 3. Proteiinisynteesin periaate 1 Ribosomit 1 Ribosomit 4 Palade & Siekevitz eristivät jaottelusentrifugaatiolla ns. mikrosomeja radioakt. aminohapot kertyivät mikrosomeihin, jotka peräisin rer:ää sisältävistä soluista proteiinisynteesi


Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa

Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Susan Thorpe-Vargas Ph.D., John Cargill MA, MBA, MS, D. Caroline Coile, Ph.D. Käännös Inkeri Kangasvuo Koskaan ei ehkä


Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista


Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto.

Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto. Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto Nukleiinihapot! kertausta matkan varrella, vähemmän kuitenkin


Biomolekyylit ja biomeerit

Biomolekyylit ja biomeerit Biomolekyylit ja biomeerit Polymeerit ovat hyvin suurikokoisia, pitkäketjuisia molekyylejä, jotka muodostuvat monomeereista joko polyadditio- tai polykondensaatioreaktiolla. Polymeerit Synteettiset polymeerit


Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93.

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93. 1 I) Ovatko väittämät oikein (O) vai väärin (V)? Jos väite on mielestäsi väärin, perustele se lyhyesti väittämän alla oleville riveille. O/V 1.2. Downin oireyhtymä johtuu pistemutaatista fenyylialaniinin


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi


Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä

Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä Ekologiset ympäristöongelmat 10. Geeniteknologia Dna:n ja rna:n käsittely Eristäminen Puhdistaminen Lähetti-rna:t voidaan muuntaa niiden emäsjärjestystä vastaavaksi ns. komplementaariseksi dna:ksi (c-dna)


Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1 1) Tunnista molekyylit (1 piste) ja täytä seuraava taulukko (2 pistettä) a) b) c) d) a) Syklinen AMP (camp) (0.25) b) Beta-karoteeni (0.25 p) c) Sakkaroosi (0.25 p) d) -D-Glukopyranoosi (0.25 p) 2 Taulukko.



DRAAMAN KÄYTTÖ PROTEIINISYNTEESIN OPETUKSESSA LUKIOSSA ANNA RÄSÄNEN DRAAMAN KÄYTTÖ PROTEIINISYNTEESIN OPETUKSESSA LUKIOSSA ANNA RÄSÄNEN Pro gradu -tutkielma Itä-Suomen yliopisto Luonnontieteiden ja metsätieteiden tiedekunta Ympäristö- ja biotieteiden laitos Biologia 2016


Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 3. Solujen kemiallinen rakenne

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 3. Solujen kemiallinen rakenne Solun perusrakenne I Solun perusrakenne 3. Solujen kemiallinen rakenne 1. Avainsanat 2. Solut koostuvat molekyyleistä 3. Hiilihydraatit 4. Lipidit eli rasva-aineet 5. Valkuaisaineet eli proteiinit rakentuvat


Julkaistu Helsingissä 24 päivänä helmikuuta 2014. 141/2014 Maa- ja metsätalousministeriön asetus

Julkaistu Helsingissä 24 päivänä helmikuuta 2014. 141/2014 Maa- ja metsätalousministeriön asetus SUOMEN SÄÄDÖSKOKOELMA Julkaistu Helsingissä 24 päivänä helmikuuta 2014 141/2014 Maa- ja metsätalousministeriön asetus äidinmaidonkorvikkeesta ja vieroitusvalmisteesta annetun kauppa- ja teollisuusministeriön


MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta)

MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta) Tehtävä Pisteet a) Mitkä ovat solussa DNA:n, mitkä RNA:n tehtäviä? Miksi mielestäsi DNA on valikoitunut kaikkien solullisten organismien perintöainekseksi? max 5 DNA: perinnöllisen tiedon säilyttäminen


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus


*2,3,4,5 *1,2,3,4,5. Helsingin yliopisto. hakukohde. Sukunimi. Tampereen yliopisto. Etunimet. Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30. Tehtävä 1.

*2,3,4,5 *1,2,3,4,5. Helsingin yliopisto. hakukohde. Sukunimi. Tampereen yliopisto. Etunimet. Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30. Tehtävä 1. Helsingin yliopisto Molekyylibiotieteiden hakukohde Tampereen yliopisto Bioteknologian hakukohde Henkilötunnus - Sukunimi (myös entinen) Etunimet Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30 Tehtävä 1.


Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan?

Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Antipodidiversiteetin generointi Robert Koch (TB) 1905 Niels K. Jerne


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen


PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 2. Solun perusrakenne

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 2. Solun perusrakenne Solun perusrakenne I Solun perusrakenne 2. Solun perusrakenne 1. Avainsanat 2. Kaikille soluille yhteiset piirteet 3. Kasvisolun rakenne 4. Eläinsolun rakenne 5. Sienisolun rakenne 6. Bakteerisolun rakenne


b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina.

b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina. Bi5 kertaustehtäviä, mallivastauksia 1. Selosta lyhyesti, missä sijaitsevat seuraavat solun osat: a) tumajyvänen b) keskusjyvänen (sentrioli, sentrosomi), c) soluneste, d) mitokondrio, e) solulimakalvosto



BIOLOGIAN KOE 30.3.2016 HYVÄN VASTAUKSEN PIIRTEITÄ BIOLOGIAN KOE 30.3.2016 HYVÄN VASTAUKSEN PIIRTEITÄ Alla oleva vastausten piirteiden, sisältöjen ja pisteitysten luonnehdinta ei sido ylioppilastutkintolautakunnan arvostelua. Lopullisessa arvostelussa


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Seoksen komponentit voidaan erotella toisistaan kromatografisilla menetelmillä. Mihin kromatografiset menetelmät perustuvat? (2p) Menetelmät perustuvat seoksen osasten erilaiseen sitoutumiseen paikallaan


Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta KOE 8 Ravitsemustiede Sekä A- että B-osasta tulee saada vähintään 7 pistettä. Mikäli A-osan pistemäärä on vähemmän kuin 7 pistettä, B-osa jätetään arvostelematta. Lisäksi A-osasta on saatava yhteensä vähintään


III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 15. Populaatiogenetiikka ja evoluutio 1. Avainsanat 2. Evoluutio muuttaa geenipoolia 3. Mihin valinta kohdistuu? 4. Yksilön muuntelua


Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi





9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun


6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?


III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 11. Sukusolujen synty 1. Avainsanat 2. Geenien ja ympäristön vaikutus yksilöön 3. Meioosissa kromosomimäärä puolittuu, hedelmöityksessä


Perinnöllinen informaatio ja geneettinen koodi.

Perinnöllinen informaatio ja geneettinen koodi. Tehtävä A1 Kirjoita essee aiheesta: Perinnöllinen informaatio ja geneettinen koodi. Vastaa esseemuotoisesti, älä käytä ranskalaisia viivoja. Piirroksia voi käyttää. Vastauksessa luetaan ansioksi selkeä


Kuinka geenin emäsjärjestys muunnetaan proteiinin avaruusrakenteeksi ribosomaalisen proteiinisynteesin vaiheet

Kuinka geenin emäsjärjestys muunnetaan proteiinin avaruusrakenteeksi ribosomaalisen proteiinisynteesin vaiheet Kuinka geenin emäsjärjestys muunnetaan proteiinin avaruusrakenteeksi ribosomaalisen proteiinisynteesin vaiheet Yliopistonlehtori Tuomas Haltia Biotieteiden laitos Helsingin yliopisto Johdanto Ihmisellä


Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa

Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa Kati Rajanen & Mira Tyni Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa Metropolia Ammattikorkeakoulu Bioanalyytikko Bioanalytiikan koulutusohjelma Opinnäytetyö 6.4.03 Tiivistelmä Tekijä(t) Otsikko





Biologia ylioppilaskoe

Biologia ylioppilaskoe Biologia ylioppilaskoe 12 tehtävää, joista kahdeksaan (8) vastataan Tehtävät vaikeutuvat loppua kohden, jokeritehtävät merkitty +:lla Molempiin jokereihin saa vastata ja ne lasketaan mukaan kahdeksaan



EUROOPAN PARLAMENTTI EUROOPAN PARLAMENTTI 1999 2004 Ihmisgenetiikkaa ja nykylääketieteen muita uusia tekniikoita käsittelevä väliaikainen valiokunta VÄLIAIKAINEN 26. heinäkuuta 2001 Par2 KERTOMUSLUONNOS Ihmisgenetiikan sosiaaliset,


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


e-oppi Oy. Materiaalin käyttö sallittua vain osana e-opin oppimateriaalia ja maksettua käyttölisenssiä.

e-oppi Oy. Materiaalin käyttö sallittua vain osana e-opin oppimateriaalia ja maksettua käyttölisenssiä. LUKU1 makromolekyyli, macromolecule Suurikokoinen molekyyli, joka on usein polymeeri. Makromolekyylejä ovat proteiinit, dna ja polysakkaridit kuten selluloosa. solukalvo, cell membrane Solukalvo rajoittaa



BIOLOGIAN PRELIMINÄÄRIKOE 2008 BIOLOGIAN PRELIMINÄÄRIKOE 2008 Vastaa 8 tehtävään. Kukin tehtävä on 6 pisteen arvoinen, +:lla merkittyjen jokeritehtävien maksimipistemäärä on 9. 1. Vastaa kuhunkin kohtaan lyhyesti, enintään muutamalla


a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Mitä tarkoitetaan biopolymeerilla? Mihin kolmeen ryhmään biopolymeerit voidaan jakaa? (1,5 p) Biopolymeerit ovat luonnossa esiintyviä / elävien solujen muodostamia polymeerejä / makromolekyylejä.





Duchennen lihasdystrofian ja spinaalisen lihasatrofian hoidon uusia näkymiä. Jaana Lähdetie TYKS lastenneurologia

Duchennen lihasdystrofian ja spinaalisen lihasatrofian hoidon uusia näkymiä. Jaana Lähdetie TYKS lastenneurologia Duchennen lihasdystrofian ja spinaalisen lihasatrofian hoidon uusia näkymiä Jaana Lähdetie TYKS lastenneurologia Neuromuskulaaritaudit Lihasvoiman heikkenemisen seuraukset Kävelykyvyn heikkeneminen ja



PROTEIINIEN MUOKKAUS JA KULJETUS PROTEIINIEN MUOKKAUS JA KULJETUS 1.1 Endoplasmakalvosto Endoplasmakalvosto on organelli joka sijaitsee tumakalvossa kiinni. Se on topologisesti siis yhtä tumakotelon kanssa. Se koostuu kahdesta osasta:


Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus:

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus: Esseekysymyksistä 1 ja 2 voi saada enintään 5 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 4 pistettä. Lisäksi vastaaja saa enintään yhden pisteen, mikäli


Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma Evoluutio BI Elämä ja evoluutio Leena Kangas-Järviluoma 1 Evoluutio lajinkehitystä, jossa eliölajit muuttuvat ja niistä voi kehittyä uusia lajeja on jatkunut elämän synnystä saakka, sillä ei ole päämäärää








Aminohapot ja proteiinit

Aminohapot ja proteiinit Aminohapot ja proteiinit Proteiinit ovat aminohappoketjusta muodostuvia ihmiselle välttämättömiä yhdisteitä tai useammasta aminohappoketjusta muodostuvia komplekseja. Lähes kaikilla tunnetuilla eliöillä





Symbioosi 2 VASTAUKSET. b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl

Symbioosi 2 VASTAUKSET. b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl Luku 14 Symbioosi 2 VASTAUKSET 1. Banaanikärpänen dihybridiristeytys a. Mikä on vanhempien genotyyppi? Vastaus: VvLl b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl c.


A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen

A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen Asiasisältö Keskeisyys Taso 1 2 3 A B C 1 Yleiskäsitteitä periytymiseen liittyen 1.1 Penetranssi


Evoluutiovoimat. Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa?

Evoluutiovoimat. Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa? Evoluutiovoimat Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa? -sattuman sysäily: populaatiokoon vaikutus -valinta: positiivinen, tasapainottava ja negatiivinen -mutaatiot: neutraalien,


Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut Hemopoiesis Tuma Mitochondrion Tuma 2 Flagellum Peroxisome Centrioles Microfilaments Microtubules Nuclear envelope Rough endoplasmic reticulum Ribosomes NUCLEUS muoto: pallomainen liuskoittunut (esim.


Genomi- ilmentymisen säätely

Genomi- ilmentymisen säätely Genomi- ilmentymisen säätely Samuel Myllykangas, FT Biolääke


Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa
