Save this PDF as:

Koko: px
Aloita esitys sivulta:



1 GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien käyttösovelluksia. Geenitekniikan perusta on geenien kemiallisen rakenteen ja geneettisen koodin yleismaailmallisuus * kaikilla eliöillä geenien DNA:n emäsjärjestys kopioituu lähettirna:ksi, joka ohjaa proteiinien synteesiä Kehityksen virstan pylväitä: 1680-luku Bakteerit löytyivät 1860-luku Sterilointi keksittiin 1880-luku Bakteerien puhdasviljelmät kehitettiin 1890-luku Virukset löytyivät 1911 Ensimmäinen syöpävirus löytyi Bakteriofagit löytyivät 1928 Ensimmäinen antibiootti (penisilliini) löytyi 1930-luku Bakteerien transformaatio selvitettiin; virusten kasvatusmenetelmät kehitettiin 1944 Perintöaineksen todettiin olevan DNA:ta luvut Geenien perustoiminnot selvitettiin; useat DNA:han vaikuttavat entsyymit löydettiin 1970 Ensimmäiset DNA:n pilkkomiseen sopivat entsyymit ja käänteiskopioijaentsyymi löydettiin Ensimmäiset vieraat geenit siirrettiin bakteeriin 1977 Bakteerissa tuotettiin ensimmäinen ihmisproteiini 1982 Syöpägeenien merkitys selvitettiin 1986 Ensimmäinen yhdistelmä-dan-rokote (hepatiitti B) tuli markkinoille Kansainvälinen ihmisen genomihanke alkoi (15-vuotissuunnitelma, ihmisen perimän kartoitus- ja sekvensointihanke 1995 Esitumallisen solun koko perintöaineksen emäsjärjestys selvitettiin ensimmäistä kertaa (Heamophilus influenza bakteeri) 1996 Tumallisen solun perintöaineksen emäsjärjestys selvitettiin ensimmäistä kertaa (leivinhiiva, Saccharomyces cerevisiae) Ihmisen genomihanke valmistuu etuajassa (ennustetut geeniä muuttuu geeniksi) * Geenien perusrakenteet selvitettiin mikrobeja tutkimalla * Moderni biotekniikka hyödyntää muokattuja mikrobeja * Muokkausvälineet mikrobeista => entsyymit bakteerien selviytymiskeinoja => plasmidit bakteerien DNA:ta => virusvektorit virusdna:ta => solu- ja viruskannat

2 Terminologiaa Klooni = saman perimän omaavien eliöiden joukko, joka yleensä on syntynyt yhdestä ja samasta solusta (tai yksilöstä) suvuttoman lisääntymisen seurauksena Bakteeriklooni: Kukin yksittäinen bakteeri jakautuu n kertaa ja tuottaa oman klooninsa jälkeläisiä Massakasvatus koeputkessa => DNA:n / geenin puhdistus ja analysointi Kloonaamista varten geeni liitetään osaksi bakteerissa olevaa plasmidi- DNA:ta, joka siirretään bakteeriin monistumaan bakteerikloonissa E. Coli Bakteerin kromosomi Bakteeri plasmidi Yhdistelmäplasmidi Kloonaus geenitekniikassa tarkoittaa käytännössä geenin monistamista(=lisäämistä) bakteerissa ja eristämistä siitä. Yleensä sisältää myös kloonatun geenin emäsjärjestyksen määrittämisen = molekyylikloonaus

3 Geenin kloonaaminen ja analysointi * Geenin kloonaus tarkoittaa sen tunnistamista ja puhdistamista eliön muusta DNA:sta Geeni voidaan eristää kahdella tapaa: 1. Geenikirjastoista - ei tarvita tietoa emäsjärjestyksestä 2. PCR monistuksella - tarvitaan tieto emäsjärjestyksestä => Molemmat tavat tuottavat suuren määrän geeniä 1.Tiettyyn bakteeriyksilöön asettuneen geenin määrä lisääntyy ko.bakteerin jälkeläisjoukon eli bakteerikloonin mukana. => Koeputkeen saadaan suuri määrä bakteeria, josta DNA voidaan eristää

4 2. DNA:n kloonaaminen = monistaminen polymeraasiketjureaktiolla, PCR:lla - korvaa perinteistä kloonausta - edellyttäää tietoa geenin emäsjärjestyksestä - tehokas ja herkkä menetelmä (muutamasta DNA molekyylistä parissa tunnissa kymmeniä jopa satoja miljoonia kopioita) - DNA monistuu koeputkessa entsyymin avulla DNA polymeraasi ( arkkibakteereista eristetty, optimilämpötila + 72 ºC) DNA -polymeraasi Alukkeet Monistettava DNA esim. veren valkosoluista Nukleotidit 1. Lämmitys => + 95 ºC (1min) => DNA vastinjuosteet erkanevat toisistaan Monistusalue 2. Jäähdytys => + 55 ºC => monistettavan alueen rajaavat alukkeet pariutuvat yksijuosteisen DNA:n kanssa 3. Lämmitys => +72ºC => DNA polymeraasi entsyymi rakentaa alukkeesta eteenpäin vastinjuosteen 4. Vaiheita 1-3 toistetaan noin 20 kertaa! Jokaisessa syklissä alkuperäinen DNA määrä kaksinkertaistuu. Automaattinen PCR laite on ohjelmoitava koeputkien lämmitin!

5 Geenin / DNA:n eristäminen ja kloonaaminen => mahdollistaa geenin tutkimisen ja manipuloimisen (esim.yhdisteleminen muihin geeneihin tai emäsjärjestyksen muunteleminen) perustutkimukseen tai kaupallisiin / lääketieteellisiin tarpeisiin DNA:n käsittelyn vaiheita 1. DNA: n eristäminen - uuttamalla valkosoluista tai muista tumallisista soluista 2. DNA:n pilkkominen entsyymeillä - restriktioentsyymit katkaisevat DNA:n tietyistä tunnistuskohdista - entsyymit peräisin bakteereista,jotka käyttävät niitä tunnistamaanja tuhoamaan vierasta DNA:ta esim. fageista tai muista bakteereista 3. DNAfragmenttien elektroforeettinen erottelu

6 DNA:ta pilkkovat entsyymit - tunnistavat spesifin emäsjärjestyksen DNA:sta, ns.restriktiokohdan - liimapäät voidaan liittää yhteen -voidaan käyttää hyväksi yhden emäksen eroja tutkittaessa (esim. sirppisoluhemoglobiinin geeni)

7 DNA:ta pilkkovat entsyymit -katkaisukohdan ominaisuuksiin kuuluu, että samalla entsyymillä katkaistut päät voidaan liittää entsymaattisesti yhteen yhdistelmädna = rekombinanttidna - käänteiskopioija entyymi * tarvitaan, jotta bakteerisolu saadaan ilmentämään ihmisen geenejä, koska bakteereilla ei ole intronien pilkkomiseen tarvittavaa entsyymijärjestelmää

8 DNA:n säilöminen geenikirjastoon * Geenikirjasto on koeputkessa oleva,pakastimessa säilytettävä kokoelma DNA paloja, jotka on liitetty esim. plasmididna:han tai virusdna;han - Plasmidi ja virukset toimivatdna kuljettimina eli vektoreina

9 Geenin kloonauksen yleiset periaatteet * Vieras geeni siirretään bakteerin plasmidiin ja tämä yhdistelmä- DNA siirretään bakteeriin * Bakteerin jakautuessa myös yhdistelmäplasmidi jakautuu ja kopioituu jälkeläisiin * Suotuisissa olosuhteissa bakteeri saadaan tuottamaan vieraan geenin koodaamaa proteiinia Ihmisen geenin kloonaaminen bakteeriplasmidissa Bakteeriplasmidi, jossa ampisilliiniresistenssin antava geeni Katkaisu samalla entsyymillä HumaaniDNA Plasmidin ja kloonattavan geenin yhteen liittäminen Liittäjäentsyymi Yhdistelmäplasmidi E. coli -bakteeri, jossa plasmidi Yhdistelmäplasmidi siirretään E. coli bakteeriin Bakteerin kloonaaminen - maljalla kasvavat bakteerit, jotka ovat ampisilliini-resistenttejä Bakteeriklooni, joka sisältää halutun humaanigeenin => voidaan eristää geeni tutkittavaksi tai tuottamaan itse proteiinia

10 Plasmidin käyttö biotekniikassa E. coli Plasmidin eristys DNA:n puhdistus Solu Bakteerin kromosomi Plasmidi YhdistelmäDNA Geenin irrotus DNA Siirto bakteeriin Bakteerin kloonaus 2) 1) 2) Geeni voidaan eristää ja käyttää esim. tuottamaan bakteereita käytettäväksi öljyvaurioden korjaamisessa tai antamaan kasville tuhohyönteissuojan 1) Bakteerin tuottama proteiini voidaan eristää, esim kasvuhormoni tai veren hyytymistekijä

11 Geenimuunnellun tomaatin tuottaminen * hyönteisresistenssi

12 Rekombinanttirokotteet, DNA - rokotteet Rokotteet: => aktiivinen immuniteetti => muistisolut => passiivinen immuniteetti => vasta-aine taudin puhjettua => nopea vaste, lyhytaikainen, ei muistisoluja DNA tekniikalla: * plasmidiin antigeenisen proteiinin geeni => antigeenisen proteiinin tuotto => immunisointi Hepatiitti B viruksen rekombinanttirokotteen valmistaminen hiivasolussa Hepatiitti B virus ei kasva missään tunnetussa soluviljelyjärjestelmässä Etu: vain aktiivisin osa taudinaiheuttajasta => ei sivuvaikutuksia Haitta: teho voi olla heikompi kuin perinteisillä

13 Geenien ilmentymisen / SNP:ien tutkiminen mikrosiruanalyyseillä * Tutkitaan yhtä aikaa suuren geenijoukon ilmentymistä ts. niiden lrna:ta * Tutkitaan yhden emäksen muutoksesta aiheutuvia geenien rakenne-eroja /SNP (single nucleotide polymorphism) - Mikrosirulle on koneellisesti applikoitu eri geenejä vastaavia DNA palasia, jotka tunnistavat näytteessä olevat, tutkittavan näytteen RNA:ta vastaavat cdna:t -Mikrosiru voidaan valmistaa tunnistamaan koko perimän geenit tai tietty geenijoukko (esim. syöpägeenit). - Suomi siru tunnistaa 30 tunnettua suomalaiseen tautiperimään kuuluvaa tautiageeniä 80 näytteestä

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli


Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.


PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä

Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä Ekologiset ympäristöongelmat 10. Geeniteknologia Dna:n ja rna:n käsittely Eristäminen Puhdistaminen Lähetti-rna:t voidaan muuntaa niiden emäsjärjestystä vastaavaksi ns. komplementaariseksi dna:ksi (c-dna)


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


Genetiikan perusteiden harjoitustyöt

Genetiikan perusteiden harjoitustyöt Genetiikan perusteiden harjoitustyöt Molekyylien kloonaus ja siihen liittyvät taidot ja temput, osa 1 Restriktioentsyymit, elektroforeesi Moniste sivulta 24-: Geenien kloonaus CELL 491- Isolating, cloning,


Bioteknologia BI5. Mikrobit

Bioteknologia BI5. Mikrobit Bioteknologia BI5 Mikrobit MIKROBIT eliöitä kaikista neljästä kunnasta + virukset ja prionit kaikki mikroskooppisen pienet eliöt yksilö- ja lajimäärältään enemmän kuin muita eliöitä esiintyvät kaikenlaisissa


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset)

Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset) Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset) Hajottajia (lahottajat ja mädättäjät), patogeeneja (taudinaiheuttajia), tuottajia (yhteyttävät),


Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu


Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa


Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi)

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) CHEM-A1310 Biotieteen perusteet Heli Viskari 2017 DNA-harjoitustöiden aikataulu, valitse yksi näistä


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


Biologia ylioppilaskoe

Biologia ylioppilaskoe Biologia ylioppilaskoe 12 tehtävää, joista kahdeksaan (8) vastataan Tehtävät vaikeutuvat loppua kohden, jokeritehtävät merkitty +:lla Molempiin jokereihin saa vastata ja ne lasketaan mukaan kahdeksaan


b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina.

b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina. Bi5 kertaustehtäviä, mallivastauksia 1. Selosta lyhyesti, missä sijaitsevat seuraavat solun osat: a) tumajyvänen b) keskusjyvänen (sentrioli, sentrosomi), c) soluneste, d) mitokondrio, e) solulimakalvosto


Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun


Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30 Tampereen yliopisto Bioteknologian tutkinto-ohjelma Valintakoe 21.5.2015 Henkilötunnus - Sukunimi Etunimet Tehtävä 3 Pisteet / 30 3. a) Alla on lyhyt jakso dsdna:ta, joka koodaa muutaman aminohappotähteen


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Seoksen komponentit voidaan erotella toisistaan kromatografisilla menetelmillä. Mihin kromatografiset menetelmät perustuvat? (2p) Menetelmät perustuvat seoksen osasten erilaiseen sitoutumiseen paikallaan


KandiakatemiA Kandiklinikka

KandiakatemiA Kandiklinikka Kandiklinikka Kandit vastaavat Immunologia Luonnollinen ja hankittu immuniteetti IMMUNOLOGIA Ihmisen immuniteetti pohjautuu luonnolliseen ja hankittuun immuniteettiin. Immunologiasta vastaa lymfaattiset


Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 4. Entsyymit ovat solun kemiallisia robotteja

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 4. Entsyymit ovat solun kemiallisia robotteja Solun perusrakenne I Solun perusrakenne 4. Entsyymit ovat solun kemiallisia robotteja 1. Avainsanat 2. Solut tuottavat entsyymejä katalyyteiksi 3. Entsyymien rakenne ja toiminta 4. Entsyymit vaativat toimiakseen


Virukset lääketieteen apuvälineinä. Veijo Hukkanen, Veli-Matti Kähäri ja Timo Hyypiä

Virukset lääketieteen apuvälineinä. Veijo Hukkanen, Veli-Matti Kähäri ja Timo Hyypiä Kuvat kertovat Veijo Hukkanen, Veli-Matti Kähäri ja Timo Hyypiä Virusten molekyylitasoinen tuntemus on tehnyt mahdolliseksi hyödyntää viruksia niiden luonnollisessa tehtävässä geenien kuljettimina eli


Mikrobiryhmät. Bakteeriviljelmät

Mikrobiryhmät. Bakteeriviljelmät Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset) Hajottajia (lahottajat ja mädättäjät), patogeeneja (taudinaiheuttajia), tuottajia (yhteyttävät),


Eliömaailma. BI1 Elämä ja evoluutio Leena Kangas-Järviluoma

Eliömaailma. BI1 Elämä ja evoluutio Leena Kangas-Järviluoma Eliömaailma BI1 Elämä ja evoluutio Leena Kangas-Järviluoma Aitotumalliset l. eukaryootit Esitumalliset l. prokaryootit kasvit arkit alkueliöt sienet bakteerit eläimet Eliökunnan sukupuu Tumattomat eliöt


Kukan kehitystä säätelevien geenien molekyylikloonaus

Kukan kehitystä säätelevien geenien molekyylikloonaus Sanna Viitanen Kukan kehitystä säätelevien geenien molekyylikloonaus Opinnäytetyö Metropolia Ammattikorkeakoulu Terveys- ja hoitoala Bioanalytiikka Opinnäytetyö 15.5.2014 Tiivistelmä Tekijä(t) Otsikko


Elimistö puolustautuu

Elimistö puolustautuu Elimistö puolustautuu Tautimikrobit (= patogeenit): Bakteerit (esim. kolera), virukset (esim. influenssa), alkueliöt (esim. malaria), eräät sienet (esim. silsa) Aiheuttavat infektiotaudin Mistä taudinaiheuttajat


Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,


Nimi sosiaaliturvatunnus

Nimi sosiaaliturvatunnus Valintakoe 2013 / Biokemia Nimi sosiaaliturvatunnus 1. Selitä: (3,0 p) a) Mitä ovat eksonit ja intronit ja miten ne eroavat toisistaan? b) Mitä eläinsolulle tapahtuu, jos se laitetaan sen sisällä olevaa


Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti


Geeninsiirron peruskäsitteet

Geeninsiirron peruskäsitteet Geeninsiirron peruskäsitteet GMO = muuntogeeninen eliö, eliö johon on siirretty toisen eliön perimää Käyttö: biologinen perustutkimus, maatalous (esim. tuottavammat lajikkeet), teollisuus (esim. myrkkyjen


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,


Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien


Francis Crick ja James D. Watson

Francis Crick ja James D. Watson Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel-palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän


Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen



BIOLOGIAN OSIO (45 p.) BIOLÄÄKETIETEEN KOULUTUSOHJELMA PÄÄSYKOE 17.5.2017 BIOLOGIAN OSIO (45 p.) HYVÄN VASTAUKSEN PIIRTEET I) Esseetehtävät (2 kpl) a) Selitä perustellen, miten kuvaan merkittyihin kohtiin osuvat mutaatiot voivat


Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen





DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri


Molekyylibiologian perusmenetelmät

Molekyylibiologian perusmenetelmät 2 3 Molekyylibiologian perusmenetelmät 740151P Biokemian menetelmät I 26.9.2017 Juha Kerätär / BMTK Päivän aiheet Mitä on molekyylibiologia? Mitä ovat keskeiset molekyylibiologian menetelmät ja mihin ne


Molekyylibiologian perusmenetelmät P Biokemian menetelmät I Juha Kerätär / BMTK

Molekyylibiologian perusmenetelmät P Biokemian menetelmät I Juha Kerätär / BMTK Molekyylibiologian perusmenetelmät 740151P Biokemian menetelmät I 26.9.2017 Juha Kerätär / BMTK Päivän aiheet Mitä on molekyylibiologia? Mitä ovat keskeiset molekyylibiologian menetelmät ja mihin ne perustuvat?


- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa Kertaus CHEM-C2300 0 Tällä luennolla: - Oletteko lukeneet artikkelia, käydäänkö läpi? - Ehdotuksia tenttikysymyksiin? - Käydään läpi kurssin keskeiset asiakokonaisuudet otsikkotasolla - Extra: PCR-alukkeiden


Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 2. Solun perusrakenne

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 2. Solun perusrakenne Solun perusrakenne I Solun perusrakenne 2. Solun perusrakenne 1. Avainsanat 2. Kaikille soluille yhteiset piirteet 3. Kasvisolun rakenne 4. Eläinsolun rakenne 5. Sienisolun rakenne 6. Bakteerisolun rakenne


Narkolepsian immunologiaa ja Pandemrixiin liittyvät tutkimkset

Narkolepsian immunologiaa ja Pandemrixiin liittyvät tutkimkset Narkolepsian immunologiaa ja Pandemrixiin liittyvät tutkimkset Outi Vaarala, Immuunivasteyksikön päällikkö, THL Narkolepsian kulku - autoimmuunihypoteesiin perustuva malli Hypokretiinia Tuottavat neuronit


Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Mitä tarkoitetaan biopolymeerilla? Mihin kolmeen ryhmään biopolymeerit voidaan jakaa? (1,5 p) Biopolymeerit ovat luonnossa esiintyviä / elävien solujen muodostamia polymeerejä / makromolekyylejä.


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does


DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen

DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen DNA-testit sukututkimuksessa 28.11.2017 Keravan kirjasto Paula Päivinen Solu tuma kromosomit 23 paria DNA Tumassa olevat kromosomit periytyvät jälkeläisille puoliksi isältä ja äidiltä Y-kromosomi periytyy


Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne



TESTITULOSTEN YHTEENVETO TESTITULOSTEN YHTEENVETO LIHASTEN VÄSYMINEN JA PALAUTUMINEN Lihaksesi eivät väsy niin helposti ja ne palautuvat nopeammin. Kehitettävä Hyvä AEROBINEN KUNTO Sinulla on edellytyksiä kasvattaa aerobista kuntoa


VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.


Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta KOE 8 Ravitsemustiede Sekä A- että B-osasta tulee saada vähintään 7 pistettä. Mikäli A-osan pistemäärä on vähemmän kuin 7 pistettä, B-osa jätetään arvostelematta. Lisäksi A-osasta on saatava yhteensä vähintään


Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin?

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? 26.3.2015 Kalaterveyspäivät, Tampere Krister Sundell Akvaattisen patobiologian laboratorio Åbo Akademi Flavobacterium psychrophilum Aiheuttaa


Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93.

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93. 1 I) Ovatko väittämät oikein (O) vai väärin (V)? Jos väite on mielestäsi väärin, perustele se lyhyesti väittämän alla oleville riveille. O/V 1.2. Downin oireyhtymä johtuu pistemutaatista fenyylialaniinin



BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA MITÄ ROKOTUKSIA? Muistatko mitä rokotuksia olet saanut ja minkä viimeiseksi? Miten huolehdit koulun jälkeen rokotuksistasi? Mikrobit uhkaavat elimistöä Mikrobit voivat olla bakteereita,


Miten rokottaminen suojaa yksilöä ja rokotuskattavuus väestöä Merit Melin Rokotusohjelmayksikkö

Miten rokottaminen suojaa yksilöä ja rokotuskattavuus väestöä Merit Melin Rokotusohjelmayksikkö Miten rokottaminen suojaa yksilöä ja rokotuskattavuus väestöä Merit Melin Rokotusohjelmayksikkö 1 ESITYKSEN SISÄLTÖ Miten rokottaminen suojaa yksilöä? Immuunijärjestelmä Taudinaiheuttajilta suojaavan immuniteetin


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Hyvä käyttäjä! Ystävällisin terveisin. Toimitus

Hyvä käyttäjä! Ystävällisin terveisin. Toimitus Hyvä käyttäjä! Tämä pdf-tiedosto on ladattu Tieteen Kuvalehden verkkosivuilta ( Tiedosto on tarkoitettu henkilökohtaiseen käyttöön, eikä sitä saa luovuttaa kolmannelle osapuolelle.


Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa


MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta)

MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta) Tehtävä Pisteet a) Mitkä ovat solussa DNA:n, mitkä RNA:n tehtäviä? Miksi mielestäsi DNA on valikoitunut kaikkien solullisten organismien perintöainekseksi? max 5 DNA: perinnöllisen tiedon säilyttäminen


Entsyymit ja niiden tuotanto. Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä

Entsyymit ja niiden tuotanto. Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä Entsyymit ja niiden tuotanto Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä Mitä ovat entsyymit? Entsyymit ovat proteiineja (eli valkuaisaineita), jotka vauhdittavat (katalysoivat) kemiallisia



KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,


Uutta pikadiagnostiikkaan

Uutta pikadiagnostiikkaan Uutta pikadiagnostiikkaan Joanna Peltola Sairaalamikrobiologi NordLab Rovaniemi Käsitteitä Perinteiset mikrobiologiset menetelmät Viljely Biokemiallinen tunnistus Kiekkoherkkyysmääritys Pikatestit Immunografiset


Virusriskin vähentäminen elintarviketuotannossa

Virusriskin vähentäminen elintarviketuotannossa Virusriskin vähentäminen elintarviketuotannossa Satu Salo, VTT Expert Services Oy Marjaana Rättö, Irina Tsitko ja Hanna Miettinen, VTT 2 Viruskontaminaation riskinhallintakeinojen kehittäminen ja arvioiminen


5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin


Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus:

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus: Esseekysymyksistä 1 ja 2 voi saada enintään 5 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 4 pistettä. Lisäksi vastaaja saa enintään yhden pisteen, mikäli


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays



BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava


Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä

Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen. Mendelistinen g. on sen synonyymi Toisessa osassa ryhdymme


Synteettinen biologia

Synteettinen biologia Synteettinen biologia Julkaisun on toimittanut biotekniikan neuvottelukunta (BTNK) Kirjoittajat: Anneli Ritala, Outi Koivistoinen, Jussi Jäntti Teknologian tutkimuskeskus VTT Marko Ahteensuu Helsingin


Perinnöllinen informaatio ja geneettinen koodi.

Perinnöllinen informaatio ja geneettinen koodi. Tehtävä A1 Kirjoita essee aiheesta: Perinnöllinen informaatio ja geneettinen koodi. Vastaa esseemuotoisesti, älä käytä ranskalaisia viivoja. Piirroksia voi käyttää. Vastauksessa luetaan ansioksi selkeä


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. Valitse listasta kunkin yhdisteen yleiskielessä käytettävä ei-systemaattinen nimi. (pisteet yht. 5p) a) C-vitamiini b) glukoosi c) etikkahappo d) salisyylihappo e) beta-karoteeni a. b. c. d. e. ksylitoli


Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia

Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Genomi-ilmentyminen Genom expression (uttryckning) DNA RNA 7.12.2017 Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Osaamistavoitteet Lärandemål Luennon jälkeen ymmärrät pääperiaatteet



Genomin ylläpito TIINA IMMONEN MEDICUM BIOKEMIA JA KEHITYSBIOLOGIA Genomin ylläpito 5.12.2017 TIINA IMMONEN MEDICUM BIOKEMIA JA KEHITYSBIOLOGIA Luennon sisältö Tuman kromosomien rakenne ja pakkautuminen Pakkautumisen säätely: histonien modifikaatiot DNA:n kahdentuminen


2a) Piirrä ison valtimon ja laskimon rakenne ja nimeä kuvaan siinä näkyvät rakenteet (4p) (Ihminen s.40)

2a) Piirrä ison valtimon ja laskimon rakenne ja nimeä kuvaan siinä näkyvät rakenteet (4p) (Ihminen s.40) TerBio Valintakoe 2010 Biologian osakoe, vastaukset 1. Määrittele lyhyesti, mitä tarkoittavat a) Systolinen verenpaine (1p) (Ihminen s.42) b) Imuneste (1p) (Ihminen s. 179) c) Perusaineenvaihdunta (2p)



BIOLOGIAN YHTEISVALINTA 2011 KYSYMYS 1. Mallivastaus KYSYMYS 1 Lepät (Alnus) ovat lehtipuita, jotka elävät symbioosissa juurinystyröitä aikaansaavan Frankia - bakteerin kanssa. A. Kerro, miten leppä ottaa ravinteita. (24 p) B. Mitä ravinteita tarvitaan ja


TARTUNTATAUDIT Ellen, Olli, Maria & Elina

TARTUNTATAUDIT Ellen, Olli, Maria & Elina TARTUNTATAUDIT Ellen, Olli, Maria & Elina ELIMISTÖN PUOLUSTUSKYKY Immuniteetti eli vastutuskyky on elimistön kyky suojautua tarttuvilta taudeilta Jos tauteja aiheuttavat mikrobit uhkaavat elimistöä, käynnistyy


"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein


3 Eliökunnan luokittelu

3 Eliökunnan luokittelu 3 Eliökunnan luokittelu YO Biologian tehtävien vastausohjeista osa on luettelomaisia ja vain osa on laadittu siten, että ohjeen mukainen mallivastaus riittää täysiin pisteisiin esimerkiksi ylioppilaskokeessa.


Bakteereja tunnistetaan a) muodon perusteella:

Bakteereja tunnistetaan a) muodon perusteella: Bakteereja tunnistetaan a) muodon perusteella: ja b) värjäytyvyyden perusteella: 1) Gram-positiiviset Soluseinän ulkokalvo värjäytyy 2) Gram negatiiviset Soluseinän ulkokalvo jää värjäytymättä Laborointi


LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä



Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla 1. Avainsanat 2. Solut lisääntyvät jakautumalla 3. Dna eli deoksiribonukleiinihappo sisältää perimän


(51) Int.c1.5 C 12P 21/00, C 12N 15/38. (41) Tullut julkiseksi - Blivit offentlig 21.01.84. (32) (33) (31) Etuoikeus - Prioritet

(51) Int.c1.5 C 12P 21/00, C 12N 15/38. (41) Tullut julkiseksi - Blivit offentlig 21.01.84. (32) (33) (31) Etuoikeus - Prioritet (B) (11) KUULUTUSJULKAISU UTLAGGNINGSSKRIFT 83974 C (51) Int.c1.5 C 12P 21/00, C 12N 15/38 (21) Patenttihakemus - Patentansökning 832632 SUOMI-FINLAND (FI) Patentti- ja rekisterihallitus Patent


DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =


Syövän lääkehoito. Salla Kalsi

Syövän lääkehoito. Salla Kalsi Syövän lääkehoito Salla Kalsi Syöpä Yleisnimitys maligneille (pahanlaatuisille) kasvaimille Karsinogeeninen = syöpää aiheuttava Syövän taustalla voi olla Ympäristötekijät, elintavat, perimä, eräät virus-


Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se


Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1 1) Tunnista molekyylit (1 piste) ja täytä seuraava taulukko (2 pistettä) a) b) c) d) a) Syklinen AMP (camp) (0.25) b) Beta-karoteeni (0.25 p) c) Sakkaroosi (0.25 p) d) -D-Glukopyranoosi (0.25 p) 2 Taulukko.


BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta

BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi


Mikrobilääkkeet. Salla Kalsi Proviisori

Mikrobilääkkeet. Salla Kalsi Proviisori Mikrobilääkkeet Salla Kalsi Proviisori Mikrobilääkkeet Bakteerilääkkeet Viruslääkkeet Sieni-infektioiden lääkkeet Alkueläimiin vaikuttavat lääkkeet Loisten häätöön tarkoitetut lääkkeet Desinfioivat aineet


Mallivastaus: Selkeys ja johdonmukaisuus. Yhteensä 21

Mallivastaus: Selkeys ja johdonmukaisuus. Yhteensä 21 Joensuun yliopisto/metsätieteellinen tiedekunta Valintakoe 009/MALLIVATAUKET BIOLOGIA. ellunkeiton aikana puusta vapautuviin kuituihin jää noin 0 % jäännösligniiniä, joka aiheuttaa sellulle sen ominaisen
