Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Koko: px
Aloita esitys sivulta:

Download "Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen"

Transkriptio

1 Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

2 Geenisakset

3 2 2 N A T U R E V O L J U N E

4 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset Mitä ovat ja miten toimivat? Mihin niitä voi käyttää?

5 Perinnöllisyystieteen kysymyksiä Mitä ovat perimämme geenisekvenssit ja niiden geenituotteet? Miten geenien ilmenemistä säädellään? Millaisin mekanismein? Miten eri soluissa? Mitä geenituotteet tekevät? Miten geenit ohjaavat biologiaamme? Miten geenien vauriot johtavat sairauksiin ja voidaanko niitä korjata?

6 Geenimuokkaus - Historiallinen perspektiivi

7 Restriktioentsyymit Bakteerien luontaisen immuniteetin mekanismi Werner Arber, Daniel Nathans, Hamilton O. Smith (Nobel 1978)

8 Paul Berg (Nobel 1980) Rekombinantti-DNA

9 Geenimuokkaus Restriktioentsyymit Bakteerien luontaisen immuniteetin mekanismi Työkalut DNA muokkaukseen koeputkessa Geeniteknologian vallankumous!

10 Muuntogeeniset hiiret ( knock-out ) Martin Evans Matthew Kaufman Gail Martin Oliver Smithies Mario Capecchi Alkion kantasolut Homologinen rekombinaatio Frohman and Martin, Cell 56, , 1989 Martin Evans, Oliver Smithies, Mario Capecchi, Nobel 2007

11 https://www.mousephenotype.org/

12 Geenimuokkaus Restriktioentsyymit Bakteerien luontaisen immuniteetin mekanismi Työkalut DNA muokkaukseen koeputkessa Geeniteknologian vallankumous! Alkion kantasolut ja homologinen rekombinaatio Työkalut genomin DNA:n muokkaukseen Geenien biologisten tehtävien ymmärryksen vallankumous!

13 Geenimuokkaus - ongelmat Teho Alhainen geenimuokkausfrekvenssi edellyttää miljoonien solujen seulontaa mutaation löytämiseksi Muokkaus edellyttää alkion kantasoluviljelmiä Somaattisten solukoiden muokkaus vaikeaa Laji Mahdollista vain lajeissa joista viljeltävissä muokkauskykyisä kantasoluja (= hiiri)

14 DNA katkos lisää muokkaustehoa Räätälöidyt sinkkisorminukleaasi ja TALEN proteiinit Nat Rev Neurosci Jan;17(1): doi: /nrn

15 Geenisakset - toiminta ja sovellukset

16 The Heroes of CRISPR Cell 164, Issues 1 2, 14 January 2016, Pages Jennifer Doudna UC Berkeley Emmanuelle Charpentier Max Planck, Berlin Feng Zhang, MIT Virginijys Siksnys, Vilnus Univ.

17 CRISPR naturell CRISPR - Clustered regularly interspaced short palindromic repeats Cas9 - CRISPR associated protein 9 (DNA endonukleaasi) Bakteerien hankitun immuniteetin mekanismi

18 CRISPR näppärämpi geenisaksi Nat Rev Neurosci Jan;17(1): doi: /nrn

19 CRISPR mahdollisuuksia Nat Rev Neurosci Jan;17(1): doi: /nrn

20 CRISPR mahdollisuuksia Nat Rev Neurosci Jan;17(1): doi: /nrn

21 CRISPR geenisakset Leikkaavat tehokkaasti DNA:ta Myös eukaryoottien kromatiinirihmaa Ohjataan RNA-opas -molekyylillä Helppoa, halpaa, monta kohdetta kerralla Aktivoivat solun korjausmekanismit Halutun mutaation siirto genomiin Sovellettavissa eri lajien genomien muokkaukseen Mikrobit, kasvit, eläimet

22 4 J U N E V O L N A T U R E 2 1

23 4 J U N E V O L N A T U R E 2 1

24 4 J U N E V O L N A T U R E 2 1

25 Geenisaksien sovellukset Biologia Geenivariantit Eri eläin- ja kasvilajien geenitutkimus Kuinka geenit ohjaavat biologiaamme? Hsu et al., Cell 157, June 5, 2014

26 Understanding gene function Rapid affordable generation of multiple designed gene alterations Eugene Koonin, NCBI Rodolphe Barrangou, Carolina State Univ. Jennifer Doudna, UC Berkeley Emmanuelle Charpentier, Umea Univ. George Church, Harvard Univ. Rudolph Jaenisch, Whitehead Inst.

27 Geenisaksien sovellukset Biotekniikka Muuntogeeniset kasvit ja eläimet ravinnon tuotannossa Synteettinen biologia Voidaanko uutta geenitekniikkaa hyödyntää tuotannossa? Hsu et al., Cell 157, June 5, 2014

28 CRSPR ja muuntogeeniset viljelykasvit Geeniteknologia käyttöön taloudellisesti vähämerkityksellisemmissä tuotantokasveissa? Mikä on muuntogeeninen kasvi? 2 2 N A T U R E V O L J U N E

29 Geenisaksien sovellukset Lääketiede Geeniterapia Tautimallit Ihmisgenomin ituradan korjaus? - kielletty Voidaanko geenivaurioita korjata? Voidaanko solujen käyttäytymistä ohjata? Hsu et al., Cell 157, June 5, 2014

30 CRISPR Syövän immunoterapiassa Programmed cell death protein (PD-1) inaktivaatio T-soluissa

31 CRISPR geeniterapiassa Edut Täsmällisyys: solun omien geenien muokkaus Nopeus ja kustannukset: RNA ohjuri Osoittanut kykynsä eläinmalleissa: esim. lihasdystrofia, tyrosinemia (perinnöllinen maksasairaus) Haasteet Jakautumattomien solujen editointi? Editointi kudoksessa? Leikkausvirheet (Off-target cuts)? Immuunireaktio Cas9 vastaan?

32 CRISPR tarinan opetus?

33 CRISPR ja ihmisen ituradan editointi Lainsäädäntö vaihtelee Useissa maissa täysin kielletty Luotettavuus Sivuvaikutukset (Off-target) Nature 526, (15 October 2015) doi: /526310a

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays

Lisätiedot

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli

Lisätiedot

Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa

Lisätiedot

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja

Lisätiedot

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa Kertaus CHEM-C2300 0 Tällä luennolla: - Oletteko lukeneet artikkelia, käydäänkö läpi? - Ehdotuksia tenttikysymyksiin? - Käydään läpi kurssin keskeiset asiakokonaisuudet otsikkotasolla - Extra: PCR-alukkeiden

Lisätiedot

5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin

Lisätiedot

Duchennen lihasdystrofian ja spinaalisen lihasatrofian hoidon uusia näkymiä. Jaana Lähdetie TYKS lastenneurologia

Duchennen lihasdystrofian ja spinaalisen lihasatrofian hoidon uusia näkymiä. Jaana Lähdetie TYKS lastenneurologia Duchennen lihasdystrofian ja spinaalisen lihasatrofian hoidon uusia näkymiä Jaana Lähdetie TYKS lastenneurologia Neuromuskulaaritaudit Lihasvoiman heikkenemisen seuraukset Kävelykyvyn heikkeneminen ja

Lisätiedot

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus

Lisätiedot

Geenisaksilla hermoston sairauksien jäljille

Geenisaksilla hermoston sairauksien jäljille KATSAUS Aino Vesikansa Geenisaksilla hermoston sairauksien jäljille Geenisaksiksi kutsuttua CRISPR-menetelmää pidetään yhtenä tämän vuosikymmenen suurimmista tieteellisistä läpimurroista. CRISPR-menetelmän

Lisätiedot

BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta

BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi

Lisätiedot

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen

Lisätiedot

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2)

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2) 5.7 Biologia Biologia tutkii elämää ja sen edellytyksiä. Opetus syventää aikuisopiskelijan luonnontuntemusta ja auttaa ymmärtämään luonnon perusilmiöitä. Biologian opiskelu kehittää opiskelijan luonnontieteellistä

Lisätiedot

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki

Lisätiedot

Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

? LUCA (Last universal common ancestor) 3.5 miljardia v.

? LUCA (Last universal common ancestor) 3.5 miljardia v. Mitä elämä on? - Geneettinen ohjelma, joka kykenee muuttamaan ainehiukkaset ja molekyylit järjestyneeksi itseään replikoivaksi kokonaisuudeksi. (= geneettistä antientropiaa) ? LUCA (Last universal common

Lisätiedot

Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä

Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä Ekologiset ympäristöongelmat 10. Geeniteknologia Dna:n ja rna:n käsittely Eristäminen Puhdistaminen Lähetti-rna:t voidaan muuntaa niiden emäsjärjestystä vastaavaksi ns. komplementaariseksi dna:ksi (c-dna)

Lisätiedot

organisaatiotasot molekyylitasolta biosfääriin ökunnan monimuotoisuutta ja ymmärtämään eliöiden sopeutumisen erilaisiin ympäristöihin irteet

organisaatiotasot molekyylitasolta biosfääriin ökunnan monimuotoisuutta ja ymmärtämään eliöiden sopeutumisen erilaisiin ympäristöihin irteet BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat

Lisätiedot

LUKION OPETUSSUUNNITELMAN PERUSTEET 2003, OPETUSHALLITUKSEN MÄÄRÄYS 33/011/2003

LUKION OPETUSSUUNNITELMAN PERUSTEET 2003, OPETUSHALLITUKSEN MÄÄRÄYS 33/011/2003 LUKION OPETUSSUUNNITELMAN PERUSTEET 2003, OPETUSHALLITUKSEN MÄÄRÄYS 33/011/2003 -BIOLOGIA (s. 1-5) -KEMIA (s. 6-7) BIOLOGIA Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset

Lisätiedot

Syövän lääkehoito. Salla Kalsi

Syövän lääkehoito. Salla Kalsi Syövän lääkehoito Salla Kalsi Syöpä Yleisnimitys maligneille (pahanlaatuisille) kasvaimille Karsinogeeninen = syöpää aiheuttava Syövän taustalla voi olla Ympäristötekijät, elintavat, perimä, eräät virus-

Lisätiedot

Uusi teollinen biotekniikka ja biotalous. Prof. Merja Penttilä VTT

Uusi teollinen biotekniikka ja biotalous. Prof. Merja Penttilä VTT Uusi teollinen biotekniikka ja biotalous Prof. Merja Penttilä VTT ÖLJYJALOSTAMO Yhteiskuntamme on öljystä riippuvainen Öljyn riittämättömyys ja hinta CO 2 Ilmaston muutos BIOJALOSTAMO Iso haaste - mutta

Lisätiedot

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi Tulehduksen osuus syövän synnyssä Ari Ristimäki, professori Patologia Helsingin yliopisto esiasteissa ja useissa eri syöpäkasvaintyypeissä. 1 A Mantovani, et al. NATURE Vol 454 24 July 2008 Figure 15.22d

Lisätiedot

PAKOLLISET KURSSIT. 1. Eliömaailma (BI1)

PAKOLLISET KURSSIT. 1. Eliömaailma (BI1) Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja

Lisätiedot

Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi

Lisätiedot

Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien

Lisätiedot

Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa

Lisätiedot

BIOS 1 ja OPS 2016 OPS Biologian opetussuunnitelma Opetuksen tavoitteet

BIOS 1 ja OPS 2016 OPS Biologian opetussuunnitelma Opetuksen tavoitteet BIOS 1 ja OPS 2016 Biologian opetussuunnitelma 2016 Biologian opetuksen tehtävänä on tukea opiskelijan luonnontieteellisen ajattelun kehittymistä. Opetus lisää ymmärrystä biologian merkityksestä osana

Lisätiedot

Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa

Lisätiedot

Opiskelijoiden nimet, s-postit ja palautus pvm. Kemikaalin tai aineen nimi. CAS N:o. Kemikaalin ja aineen olomuoto Valitse: Kiinteä / nestemäinen

Opiskelijoiden nimet, s-postit ja palautus pvm. Kemikaalin tai aineen nimi. CAS N:o. Kemikaalin ja aineen olomuoto Valitse: Kiinteä / nestemäinen Harjoitus 2: Vastauspohja. Valitun kemikaalin tiedonhaut ja alustava riskinarviointi. Ohje 09.03.2016. Laat. Petri Peltonen. Harjoitus tehdään k2016 kurssilla parityönä. Opiskelijoiden nimet, s-postit

Lisätiedot

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne

Lisätiedot

Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan?

Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Antipodidiversiteetin generointi Robert Koch (TB) 1905 Niels K. Jerne

Lisätiedot

Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti

Lisätiedot

Biologian kokeellisuuteen liittyvä pienimuotoinen tutkimus tai projekti. Kurssia ei suositella itsenäisesti suoritettavaksi.

Biologian kokeellisuuteen liittyvä pienimuotoinen tutkimus tai projekti. Kurssia ei suositella itsenäisesti suoritettavaksi. Pakolliset kurssit 1. Elämä ja evoluutio (BI01) Kurssilla perehdytään elämän edellytyksiin ja kaikille eliöille tunnusomaisiin piirteisiin. Kurssilla tutustutaan myös biologian tapaan hankkia ja kuvata

Lisätiedot

FM-opiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo)

FM-opiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo) FMopiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo) 1. PERINNÖLLISYYSTIETEEN SYVENTÄVÄT OPINNOT (527050), 94 op 1.1. Pakolliset

Lisätiedot

6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?

Lisätiedot

BI4 IHMISEN BIOLOGIA

BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava

Lisätiedot

CHEM-C2300 Solu- ja molekyylibiologia Luento

CHEM-C2300 Solu- ja molekyylibiologia Luento CHEM-C2300 Solu- ja molekyylibiologia Luento1 0 Heli Viskari Tervetuloa kurssille! 1 Kurssin sisältö (Oodista) Mikrobi-, kasvi- ja eläinsolujen solutason rakenteiden ja toiminnan vuorovaikutus Luokittelun

Lisätiedot

Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä

Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Reportterigeenit ja reportterikonstruktiot? Monissa tilanteissa tarvitaan ilmaisinta (proobi, luotain, reportteri) kertomaan, mitä/missä/milloin

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

GMO-tietopaketti. Kasvinjalostuksen menetelmiä

GMO-tietopaketti. Kasvinjalostuksen menetelmiä GMO-tietopaketti Markku Keinänen Itä-Suomen yliopisto Muuntogeeninen kasvintuotanto, MTK ja BTNK, Kampustalo, Seinäjoki, 13.4.2010 Kasvinjalostuksen menetelmiä Risteytys ja valinta Mutaatiojalostus Lajien

Lisätiedot

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93.

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93. 1 I) Ovatko väittämät oikein (O) vai väärin (V)? Jos väite on mielestäsi väärin, perustele se lyhyesti väittämän alla oleville riveille. O/V 1.2. Downin oireyhtymä johtuu pistemutaatista fenyylialaniinin

Lisätiedot

GMO-ABC. Markku Keinänen Itä-Suomen yliopisto

GMO-ABC. Markku Keinänen Itä-Suomen yliopisto GMO-ABC Markku Keinänen Itä-Suomen yliopisto Geenimuunnellut elintarvikkeet, BTNK, Tieteiden Talo, Helsinki, 24.3.2010 Kasvinjalostuksen menetelmiä Risteytys ja valinta Mutaatiojalostus Lajien väliset

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio

Lisätiedot

DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit

Lisätiedot

Genetiikan perusteiden harjoitustyöt

Genetiikan perusteiden harjoitustyöt Genetiikan perusteiden harjoitustyöt Molekyylien kloonaus ja siihen liittyvät taidot ja temput, osa 1 Restriktioentsyymit, elektroforeesi Moniste sivulta 24-: Geenien kloonaus CELL 491- Isolating, cloning,

Lisätiedot

BI4 IHMISEN BIOLOGIA

BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA MITÄ ROKOTUKSIA? Muistatko mitä rokotuksia olet saanut ja minkä viimeiseksi? Miten huolehdit koulun jälkeen rokotuksistasi? Mikrobit uhkaavat elimistöä Mikrobit voivat olla bakteereita,

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...

Lisätiedot

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne

Lisätiedot

Nanoteknologian mahdollisuudet lääkesovelluksissa

Nanoteknologian mahdollisuudet lääkesovelluksissa Nanoteknologian mahdollisuudet lääkesovelluksissa Marjo Yliperttula 1,3 ja Arto Urtti 1,2 1 Farmaseuttisten biotieteiden osasto, Lääketutkimuksen keskus, Farmasian tiedekunta, Helsingin Yliopisto, Helsinki;

Lisätiedot

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus:

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus: Esseekysymyksistä 1 ja 2 voi saada enintään 5 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 4 pistettä. Lisäksi vastaaja saa enintään yhden pisteen, mikäli

Lisätiedot

Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä

Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Vesihuoltopäivät 10.5.2017, Jyväskylä Jenni Kesulahti Diplomityö Aalto-yliopistossa Hankkeessa

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Seoksen komponentit voidaan erotella toisistaan kromatografisilla menetelmillä. Mihin kromatografiset menetelmät perustuvat? (2p) Menetelmät perustuvat seoksen osasten erilaiseen sitoutumiseen paikallaan

Lisätiedot

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Perinnöllinen informaatio sijaitsee dna:ssa eli deoksiribonukleiinihapossa

Lisätiedot

FIT Biotech Oy - Innovatiivisia lääkehoitoja. Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK

FIT Biotech Oy - Innovatiivisia lääkehoitoja. Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK FIT Biotech Oy - Innovatiivisia lääkehoitoja Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK Tärkeää tietoa Tämä esitys saattaa sisältää tulevaisuutta koskevia lausumia, arvioita ja laskelmia Yhtiöstä

Lisätiedot

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina

Lisätiedot

Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine

Lisätiedot

3i Innova*ve Induc*on Ini*a*ve Fixing the broken heart Heikki Ruskoaho Farmakologian ja lääkehoidon osasto Farmasian *edekunta

3i Innova*ve Induc*on Ini*a*ve Fixing the broken heart Heikki Ruskoaho Farmakologian ja lääkehoidon osasto Farmasian *edekunta 3i Innova*ve Induc*on Ini*a*ve Fixing the broken heart Heikki Ruskoaho Farmakologian ja lääkehoidon osasto Farmasian *edekunta www.helsinki.fi/yliopisto 1 Sydänlihasvaurion yleisin syy on sydäninfark*

Lisätiedot

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi)

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) CHEM-A1310 Biotieteen perusteet Heli Viskari 2017 DNA-harjoitustöiden aikataulu, valitse yksi näistä

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta

BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja

Lisätiedot

Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016

Lisätiedot

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien

Lisätiedot

Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä

Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen. Mendelistinen g. on sen synonyymi Toisessa osassa ryhdymme

Lisätiedot

Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10.

Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10. Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10.2015 Tärkeää tietoa Tämä esitys saattaa sisältää tulevaisuutta

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

Luennon aiheet: GM-eläimet. Geenimuunnellut hiiret. Alkioiden pakastus. Geenimuunnellut eläimet: miksi ja miten?

Luennon aiheet: GM-eläimet. Geenimuunnellut hiiret. Alkioiden pakastus. Geenimuunnellut eläimet: miksi ja miten? Luennon aiheet: GM-eläimet Koe-eläinkurssi 9.11.12 Petra Sipilä Geenimuunnellut hiiret Siirtogeeniset eläimet Poistogeeniset eläimet Alkioiden pakastus Terminologiaa Geenimuunnellut eläimet: miksi ja miten?

Lisätiedot

Genetiikan perusteiden toisen jakson kaavailua

Genetiikan perusteiden toisen jakson kaavailua Genetiikan perusteiden toisen jakson kaavailua Tiedämme kaiken siitä, miten geenit siirtyvät sukupolvelta seuraavalle solun ja yksilön tasolla Toisen jakson sisältö: Mitä geenit ovat? Miten geenit toimivat?

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

Avainsanat: BI5 III Biotekniikan sovelluksia 7.Kasvin- ja eläinjalostuksella tehostetaan ravinnontuotantoa.

Avainsanat: BI5 III Biotekniikan sovelluksia 7.Kasvin- ja eläinjalostuksella tehostetaan ravinnontuotantoa. Avainsanat: kasvinjalostus eläinjalostus lajike risteytysjalostus itsepölytteinen ristipölytteinen puhdas linja heteroosi hybridilajike ylläpitojalostus geneettinen eroosio autopolyploidia allopolyploidia

Lisätiedot

SÄTEILY JA SOLU. Riitta Mustonen ja Aki Salo

SÄTEILY JA SOLU. Riitta Mustonen ja Aki Salo 2 SÄTEILY JA SOLU Riitta Mustonen ja Aki Salo SISÄLLYSLUETTELO 2.1 Solun toiminta on tarkoin säädeltyä... 28 2.2 Säteilyn fysikaaliset vuorovaikutukset solussa... 28 2.3 Ionisoiva säteily vaurioittaa DNA:ta...

Lisätiedot

3.7 Biologia. Opetuksen tavoitteet

3.7 Biologia. Opetuksen tavoitteet 3.7 Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin

Lisätiedot

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se

Lisätiedot

Epigene'ikka ja terveysvies'nnän tabut

Epigene'ikka ja terveysvies'nnän tabut Biosynteesi XIV Biokeskus Helsinki 11.5. Epigene'ikka ja terveysvies'nnän tabut Mitä uuga bio'eteet tuovat terveyden tekijöihin? Miksi tutkimus'eto leviää niin hitaas'? Vienna Setälä- Pynnönen VTT, FL

Lisätiedot

Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and

Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and Duodecim, and a textbook chapter on viral gene therapy for

Lisätiedot

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma Evoluutio BI Elämä ja evoluutio Leena Kangas-Järviluoma 1 Evoluutio lajinkehitystä, jossa eliölajit muuttuvat ja niistä voi kehittyä uusia lajeja on jatkunut elämän synnystä saakka, sillä ei ole päämäärää

Lisätiedot

Toivomme, että tämä sanasto auttaa osaltaan selkeyttämään bioalasta käytävää keskustelua ja viestintää.

Toivomme, että tämä sanasto auttaa osaltaan selkeyttämään bioalasta käytävää keskustelua ja viestintää. BIOSANASTO ALKUSANAT Monenlaiset uudet bio-ilmiöt ovat tulleet jäädäkseen suomalaiseen keskusteluun. Bioalan valtaisa kehitys viime vuosina on saanut niin maallikon, toimittajan kuin kokeneen tutkijankin

Lisätiedot

IMMUUNIPUUTOKSET. Olli Vainio Turun yliopisto

IMMUUNIPUUTOKSET. Olli Vainio Turun yliopisto IMMUUNIPUUTOKSET Olli Vainio Turun yliopisto 130204 IMMUNOLOGIA Oppi kehon puolustusmekanismeista infektiota vastaan Immuunijärjestelmä = kudokset, solut ja molekyylit, jotka muodostavat vastustuskyvyn

Lisätiedot

Suunnitelma Perinnöllisyys T9

Suunnitelma Perinnöllisyys T9 Suunnitelma Perinnöllisyys T9 Oppimistavoitteet Järjestelmällisten biologisten laboratoriotutkimuksien tekeminen. Perinnöllisyyteen liittyvien käsitteiden, mallien ja teorioiden ymmärtäminen ja käyttäminen

Lisätiedot

Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa

Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Maria Valkonen, Kaisa Jalkanen, Martin Täubel, Anne Hyvärinen 31.3.2014 Sisäilmastoseminaari 2014 1 Tausta Asumisterveysoppaan mukaiset sisäympäristön

Lisätiedot

Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme?

Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme? Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme? Riikka Kivelä, LitT Tutkijatohtori Molekyyli ja syöpäbiologian tutkimusohjelma Lääketieteellinenen

Lisätiedot

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan

Lisätiedot

Ma > GENERAL PRINCIPLES OF CELL SIGNALING

Ma > GENERAL PRINCIPLES OF CELL SIGNALING Ma 5.12. -> GENERAL PRINCIPLES OF CELL SIGNALING Cell-Surface Receptors Relay Extracellular Signals via Intracellular Signaling Pathways Some Intracellular Signaling Proteins Act as Molecular Switches

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

Kasvinjalostus 2000-luvulla

Kasvinjalostus 2000-luvulla Kasvinjalostus 2000-luvulla (Kirsi Lehto, Biotieteet ja geeniteknologia -seminaari, Turku 10.2.2001) Kasvien jalostus ennen Kasvinjalostuksella on pitkät perinteet: jo varhaiseen kasvinviljelyyn liittyi

Lisätiedot

Synteettinen biologia

Synteettinen biologia Synteettinen biologia Julkaisun on toimittanut biotekniikan neuvottelukunta (BTNK) Kirjoittajat: Anneli Ritala, Outi Koivistoinen, Jussi Jäntti Teknologian tutkimuskeskus VTT Marko Ahteensuu Helsingin

Lisätiedot

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten

Lisätiedot

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyvaikutuksen synty Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyn ja biologisen materian vuorovaikutus Koska ihmisestä 70% on vettä, todennäköisin (ja tärkein) säteilyn ja biologisen

Lisätiedot

Mallivastaus: Selkeys ja johdonmukaisuus. Yhteensä 21

Mallivastaus: Selkeys ja johdonmukaisuus. Yhteensä 21 Joensuun yliopisto/metsätieteellinen tiedekunta Valintakoe 009/MALLIVATAUKET BIOLOGIA. ellunkeiton aikana puusta vapautuviin kuituihin jää noin 0 % jäännösligniiniä, joka aiheuttaa sellulle sen ominaisen

Lisätiedot

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla 1. Avainsanat 2. Solut lisääntyvät jakautumalla 3. Dna eli deoksiribonukleiinihappo sisältää perimän

Lisätiedot

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA Robert Winqvist SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PROFESSORILIITON SYYSSEMINAARI TUTKIMUSTA KAIKKIEN HYÖDYKSI

Lisätiedot

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio:

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio: -mesenkyymi-vuorovaikutukset, esimerkkinä hammas ja ihokarva elimiä muodostuu kaikista alkiokerroksista, usein epiteelin ja mesenkyymin vuorovaikutuksesta epiteeli ektodermi kumpi aloittaa elimen kehityksen:

Lisätiedot

Genomin evoluutio. Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan?

Genomin evoluutio. Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan? Genomin evoluutio Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan? -duplikaatiot: geenien, geenin osien duplikaatiot, segmentaaliset, koko genomin duplikaatiot -duplikoituneiden geenien

Lisätiedot

"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein

Lisätiedot

Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen

Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Opintori 10.5.2012 Minna Männikkö Biolääketieteen laitos Lääketieteellisen biokemian ja molekyylibiologian kurssi 15 op, 170 opiskelijaa Kemia:

Lisätiedot