Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Koko: px
Aloita esitys sivulta:

Download "Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen"


1 Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

2 Geenisakset

3 2 2 N A T U R E V O L J U N E

4 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset Mitä ovat ja miten toimivat? Mihin niitä voi käyttää?

5 Perinnöllisyystieteen kysymyksiä Mitä ovat perimämme geenisekvenssit ja niiden geenituotteet? Miten geenien ilmenemistä säädellään? Millaisin mekanismein? Miten eri soluissa? Mitä geenituotteet tekevät? Miten geenit ohjaavat biologiaamme? Miten geenien vauriot johtavat sairauksiin ja voidaanko niitä korjata?

6 Geenimuokkaus - Historiallinen perspektiivi

7 Restriktioentsyymit Bakteerien luontaisen immuniteetin mekanismi Werner Arber, Daniel Nathans, Hamilton O. Smith (Nobel 1978)

8 Paul Berg (Nobel 1980) Rekombinantti-DNA

9 Geenimuokkaus Restriktioentsyymit Bakteerien luontaisen immuniteetin mekanismi Työkalut DNA muokkaukseen koeputkessa Geeniteknologian vallankumous!

10 Muuntogeeniset hiiret ( knock-out ) Martin Evans Matthew Kaufman Gail Martin Oliver Smithies Mario Capecchi Alkion kantasolut Homologinen rekombinaatio Frohman and Martin, Cell 56, , 1989 Martin Evans, Oliver Smithies, Mario Capecchi, Nobel 2007


12 Geenimuokkaus Restriktioentsyymit Bakteerien luontaisen immuniteetin mekanismi Työkalut DNA muokkaukseen koeputkessa Geeniteknologian vallankumous! Alkion kantasolut ja homologinen rekombinaatio Työkalut genomin DNA:n muokkaukseen Geenien biologisten tehtävien ymmärryksen vallankumous!

13 Geenimuokkaus - ongelmat Teho Alhainen geenimuokkausfrekvenssi edellyttää miljoonien solujen seulontaa mutaation löytämiseksi Muokkaus edellyttää alkion kantasoluviljelmiä Somaattisten solukoiden muokkaus vaikeaa Laji Mahdollista vain lajeissa joista viljeltävissä muokkauskykyisä kantasoluja (= hiiri)

14 DNA katkos lisää muokkaustehoa Räätälöidyt sinkkisorminukleaasi ja TALEN proteiinit Nat Rev Neurosci Jan;17(1): doi: /nrn

15 Geenisakset - toiminta ja sovellukset

16 The Heroes of CRISPR Cell 164, Issues 1 2, 14 January 2016, Pages Jennifer Doudna UC Berkeley Emmanuelle Charpentier Max Planck, Berlin Feng Zhang, MIT Virginijys Siksnys, Vilnus Univ.

17 CRISPR naturell CRISPR - Clustered regularly interspaced short palindromic repeats Cas9 - CRISPR associated protein 9 (DNA endonukleaasi) Bakteerien hankitun immuniteetin mekanismi

18 CRISPR näppärämpi geenisaksi Nat Rev Neurosci Jan;17(1): doi: /nrn

19 CRISPR mahdollisuuksia Nat Rev Neurosci Jan;17(1): doi: /nrn

20 CRISPR mahdollisuuksia Nat Rev Neurosci Jan;17(1): doi: /nrn

21 CRISPR geenisakset Leikkaavat tehokkaasti DNA:ta Myös eukaryoottien kromatiinirihmaa Ohjataan RNA-opas -molekyylillä Helppoa, halpaa, monta kohdetta kerralla Aktivoivat solun korjausmekanismit Halutun mutaation siirto genomiin Sovellettavissa eri lajien genomien muokkaukseen Mikrobit, kasvit, eläimet

22 4 J U N E V O L N A T U R E 2 1

23 4 J U N E V O L N A T U R E 2 1

24 4 J U N E V O L N A T U R E 2 1

25 Geenisaksien sovellukset Biologia Geenivariantit Eri eläin- ja kasvilajien geenitutkimus Kuinka geenit ohjaavat biologiaamme? Hsu et al., Cell 157, June 5, 2014

26 Understanding gene function Rapid affordable generation of multiple designed gene alterations Eugene Koonin, NCBI Rodolphe Barrangou, Carolina State Univ. Jennifer Doudna, UC Berkeley Emmanuelle Charpentier, Umea Univ. George Church, Harvard Univ. Rudolph Jaenisch, Whitehead Inst.

27 Geenisaksien sovellukset Biotekniikka Muuntogeeniset kasvit ja eläimet ravinnon tuotannossa Synteettinen biologia Voidaanko uutta geenitekniikkaa hyödyntää tuotannossa? Hsu et al., Cell 157, June 5, 2014

28 CRSPR ja muuntogeeniset viljelykasvit Geeniteknologia käyttöön taloudellisesti vähämerkityksellisemmissä tuotantokasveissa? Mikä on muuntogeeninen kasvi? 2 2 N A T U R E V O L J U N E

29 Geenisaksien sovellukset Lääketiede Geeniterapia Tautimallit Ihmisgenomin ituradan korjaus? - kielletty Voidaanko geenivaurioita korjata? Voidaanko solujen käyttäytymistä ohjata? Hsu et al., Cell 157, June 5, 2014

30 CRISPR Syövän immunoterapiassa Programmed cell death protein (PD-1) inaktivaatio T-soluissa

31 CRISPR geeniterapiassa Edut Täsmällisyys: solun omien geenien muokkaus Nopeus ja kustannukset: RNA ohjuri Osoittanut kykynsä eläinmalleissa: esim. lihasdystrofia, tyrosinemia (perinnöllinen maksasairaus) Haasteet Jakautumattomien solujen editointi? Editointi kudoksessa? Leikkausvirheet (Off-target cuts)? Immuunireaktio Cas9 vastaan?

32 CRISPR tarinan opetus?

33 CRISPR ja ihmisen ituradan editointi Lainsäädäntö vaihtelee Useissa maissa täysin kielletty Luotettavuus Sivuvaikutukset (Off-target) Nature 526, (15 October 2015) doi: /526310a

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli


Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa Kertaus CHEM-C2300 0 Tällä luennolla: - Oletteko lukeneet artikkelia, käydäänkö läpi? - Ehdotuksia tenttikysymyksiin? - Käydään läpi kurssin keskeiset asiakokonaisuudet otsikkotasolla - Extra: PCR-alukkeiden


5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin


Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus


BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta

BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi


Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen


5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2)

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2) 5.7 Biologia Biologia tutkii elämää ja sen edellytyksiä. Opetus syventää aikuisopiskelijan luonnontuntemusta ja auttaa ymmärtämään luonnon perusilmiöitä. Biologian opiskelu kehittää opiskelijan luonnontieteellistä


Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki


Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.


Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin


? LUCA (Last universal common ancestor) 3.5 miljardia v.

? LUCA (Last universal common ancestor) 3.5 miljardia v. Mitä elämä on? - Geneettinen ohjelma, joka kykenee muuttamaan ainehiukkaset ja molekyylit järjestyneeksi itseään replikoivaksi kokonaisuudeksi. (= geneettistä antientropiaa) ? LUCA (Last universal common


organisaatiotasot molekyylitasolta biosfääriin ökunnan monimuotoisuutta ja ymmärtämään eliöiden sopeutumisen erilaisiin ympäristöihin irteet

organisaatiotasot molekyylitasolta biosfääriin ökunnan monimuotoisuutta ja ymmärtämään eliöiden sopeutumisen erilaisiin ympäristöihin irteet BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat



LUKION OPETUSSUUNNITELMAN PERUSTEET 2003, OPETUSHALLITUKSEN MÄÄRÄYS 33/011/2003 LUKION OPETUSSUUNNITELMAN PERUSTEET 2003, OPETUSHALLITUKSEN MÄÄRÄYS 33/011/2003 -BIOLOGIA (s. 1-5) -KEMIA (s. 6-7) BIOLOGIA Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset


Syövän lääkehoito. Salla Kalsi

Syövän lääkehoito. Salla Kalsi Syövän lääkehoito Salla Kalsi Syöpä Yleisnimitys maligneille (pahanlaatuisille) kasvaimille Karsinogeeninen = syöpää aiheuttava Syövän taustalla voi olla Ympäristötekijät, elintavat, perimä, eräät virus-


Uusi teollinen biotekniikka ja biotalous. Prof. Merja Penttilä VTT

Uusi teollinen biotekniikka ja biotalous. Prof. Merja Penttilä VTT Uusi teollinen biotekniikka ja biotalous Prof. Merja Penttilä VTT ÖLJYJALOSTAMO Yhteiskuntamme on öljystä riippuvainen Öljyn riittämättömyys ja hinta CO 2 Ilmaston muutos BIOJALOSTAMO Iso haaste - mutta


Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi Tulehduksen osuus syövän synnyssä Ari Ristimäki, professori Patologia Helsingin yliopisto esiasteissa ja useissa eri syöpäkasvaintyypeissä. 1 A Mantovani, et al. NATURE Vol 454 24 July 2008 Figure 15.22d


PAKOLLISET KURSSIT. 1. Eliömaailma (BI1)

PAKOLLISET KURSSIT. 1. Eliömaailma (BI1) Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja


Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi


Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa


Opiskelijoiden nimet, s-postit ja palautus pvm. Kemikaalin tai aineen nimi. CAS N:o. Kemikaalin ja aineen olomuoto Valitse: Kiinteä / nestemäinen

Opiskelijoiden nimet, s-postit ja palautus pvm. Kemikaalin tai aineen nimi. CAS N:o. Kemikaalin ja aineen olomuoto Valitse: Kiinteä / nestemäinen Harjoitus 2: Vastauspohja. Valitun kemikaalin tiedonhaut ja alustava riskinarviointi. Ohje 09.03.2016. Laat. Petri Peltonen. Harjoitus tehdään k2016 kurssilla parityönä. Opiskelijoiden nimet, s-postit


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti


6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?



BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava


CHEM-C2300 Solu- ja molekyylibiologia Luento

CHEM-C2300 Solu- ja molekyylibiologia Luento CHEM-C2300 Solu- ja molekyylibiologia Luento1 0 Heli Viskari Tervetuloa kurssille! 1 Kurssin sisältö (Oodista) Mikrobi-, kasvi- ja eläinsolujen solutason rakenteiden ja toiminnan vuorovaikutus Luokittelun


FM-opiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo)

FM-opiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo) FMopiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo) 1. PERINNÖLLISYYSTIETEEN SYVENTÄVÄT OPINNOT (527050), 94 op 1.1. Pakolliset


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


GMO-tietopaketti. Kasvinjalostuksen menetelmiä

GMO-tietopaketti. Kasvinjalostuksen menetelmiä GMO-tietopaketti Markku Keinänen Itä-Suomen yliopisto Muuntogeeninen kasvintuotanto, MTK ja BTNK, Kampustalo, Seinäjoki, 13.4.2010 Kasvinjalostuksen menetelmiä Risteytys ja valinta Mutaatiojalostus Lajien


GMO-ABC. Markku Keinänen Itä-Suomen yliopisto

GMO-ABC. Markku Keinänen Itä-Suomen yliopisto GMO-ABC Markku Keinänen Itä-Suomen yliopisto Geenimuunnellut elintarvikkeet, BTNK, Tieteiden Talo, Helsinki, 24.3.2010 Kasvinjalostuksen menetelmiä Risteytys ja valinta Mutaatiojalostus Lajien väliset


Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93.

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93. 1 I) Ovatko väittämät oikein (O) vai väärin (V)? Jos väite on mielestäsi väärin, perustele se lyhyesti väittämän alla oleville riveille. O/V 1.2. Downin oireyhtymä johtuu pistemutaatista fenyylialaniinin


DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve


Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä

Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen. Mendelistinen g. on sen synonyymi Toisessa osassa ryhdymme


T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...


Nanoteknologian mahdollisuudet lääkesovelluksissa

Nanoteknologian mahdollisuudet lääkesovelluksissa Nanoteknologian mahdollisuudet lääkesovelluksissa Marjo Yliperttula 1,3 ja Arto Urtti 1,2 1 Farmaseuttisten biotieteiden osasto, Lääketutkimuksen keskus, Farmasian tiedekunta, Helsingin Yliopisto, Helsinki;


DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus:

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus: Esseekysymyksistä 1 ja 2 voi saada enintään 5 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 4 pistettä. Lisäksi vastaaja saa enintään yhden pisteen, mikäli


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Seoksen komponentit voidaan erotella toisistaan kromatografisilla menetelmillä. Mihin kromatografiset menetelmät perustuvat? (2p) Menetelmät perustuvat seoksen osasten erilaiseen sitoutumiseen paikallaan


Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä

Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Reportterigeenit ja reportterikonstruktiot? Monissa tilanteissa tarvitaan ilmaisinta (proobi, luotain, reportteri) kertomaan, mitä/missä/milloin


Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Perinnöllinen informaatio sijaitsee dna:ssa eli deoksiribonukleiinihapossa


Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina


BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta

BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja


3i Innova*ve Induc*on Ini*a*ve Fixing the broken heart Heikki Ruskoaho Farmakologian ja lääkehoidon osasto Farmasian *edekunta

3i Innova*ve Induc*on Ini*a*ve Fixing the broken heart Heikki Ruskoaho Farmakologian ja lääkehoidon osasto Farmasian *edekunta 3i Innova*ve Induc*on Ini*a*ve Fixing the broken heart Heikki Ruskoaho Farmakologian ja lääkehoidon osasto Farmasian *edekunta 1 Sydänlihasvaurion yleisin syy on sydäninfark*


Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi)

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) CHEM-A1310 Biotieteen perusteet Heli Viskari 2017 DNA-harjoitustöiden aikataulu, valitse yksi näistä


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10.

Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10. Suomalaista bioteknologiaa kansainväliseen lääkehoitoon. FIT Biotech Oy toimitusjohtaja Kalevi Reijonen Osakesäästäjien Keskusliitto 28.10.2015 Tärkeää tietoa Tämä esitys saattaa sisältää tulevaisuutta


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


Genetiikan perusteiden toisen jakson kaavailua

Genetiikan perusteiden toisen jakson kaavailua Genetiikan perusteiden toisen jakson kaavailua Tiedämme kaiken siitä, miten geenit siirtyvät sukupolvelta seuraavalle solun ja yksilön tasolla Toisen jakson sisältö: Mitä geenit ovat? Miten geenit toimivat?


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


SÄTEILY JA SOLU. Riitta Mustonen ja Aki Salo

SÄTEILY JA SOLU. Riitta Mustonen ja Aki Salo 2 SÄTEILY JA SOLU Riitta Mustonen ja Aki Salo SISÄLLYSLUETTELO 2.1 Solun toiminta on tarkoin säädeltyä... 28 2.2 Säteilyn fysikaaliset vuorovaikutukset solussa... 28 2.3 Ionisoiva säteily vaurioittaa DNA:ta...


3.7 Biologia. Opetuksen tavoitteet

3.7 Biologia. Opetuksen tavoitteet 3.7 Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin


Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä

Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Vesihuoltopäivät 10.5.2017, Jyväskylä Jenni Kesulahti Diplomityö Aalto-yliopistossa Hankkeessa


Avainsanat: BI5 III Biotekniikan sovelluksia 7.Kasvin- ja eläinjalostuksella tehostetaan ravinnontuotantoa.

Avainsanat: BI5 III Biotekniikan sovelluksia 7.Kasvin- ja eläinjalostuksella tehostetaan ravinnontuotantoa. Avainsanat: kasvinjalostus eläinjalostus lajike risteytysjalostus itsepölytteinen ristipölytteinen puhdas linja heteroosi hybridilajike ylläpitojalostus geneettinen eroosio autopolyploidia allopolyploidia


Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se


Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and

Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and Conflict of interest: No! VH has no association with companies mentioned! VH has authored reviews on virus vectors in Suomen Lääkärilehti and Duodecim, and a textbook chapter on viral gene therapy for


Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma Evoluutio BI Elämä ja evoluutio Leena Kangas-Järviluoma 1 Evoluutio lajinkehitystä, jossa eliölajit muuttuvat ja niistä voi kehittyä uusia lajeja on jatkunut elämän synnystä saakka, sillä ei ole päämäärää


Toivomme, että tämä sanasto auttaa osaltaan selkeyttämään bioalasta käytävää keskustelua ja viestintää.

Toivomme, että tämä sanasto auttaa osaltaan selkeyttämään bioalasta käytävää keskustelua ja viestintää. BIOSANASTO ALKUSANAT Monenlaiset uudet bio-ilmiöt ovat tulleet jäädäkseen suomalaiseen keskusteluun. Bioalan valtaisa kehitys viime vuosina on saanut niin maallikon, toimittajan kuin kokeneen tutkijankin


Suunnitelma Perinnöllisyys T9

Suunnitelma Perinnöllisyys T9 Suunnitelma Perinnöllisyys T9 Oppimistavoitteet Järjestelmällisten biologisten laboratoriotutkimuksien tekeminen. Perinnöllisyyteen liittyvien käsitteiden, mallien ja teorioiden ymmärtäminen ja käyttäminen


PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto



Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme?

Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme? Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme? Riikka Kivelä, LitT Tutkijatohtori Molekyyli ja syöpäbiologian tutkimusohjelma Lääketieteellinenen


IMMUUNIPUUTOKSET. Olli Vainio Turun yliopisto

IMMUUNIPUUTOKSET. Olli Vainio Turun yliopisto IMMUUNIPUUTOKSET Olli Vainio Turun yliopisto 130204 IMMUNOLOGIA Oppi kehon puolustusmekanismeista infektiota vastaan Immuunijärjestelmä = kudokset, solut ja molekyylit, jotka muodostavat vastustuskyvyn


Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016


Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa

Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Maria Valkonen, Kaisa Jalkanen, Martin Täubel, Anne Hyvärinen 31.3.2014 Sisäilmastoseminaari 2014 1 Tausta Asumisterveysoppaan mukaiset sisäympäristön


HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan



Ma > GENERAL PRINCIPLES OF CELL SIGNALING Ma 5.12. -> GENERAL PRINCIPLES OF CELL SIGNALING Cell-Surface Receptors Relay Extracellular Signals via Intracellular Signaling Pathways Some Intracellular Signaling Proteins Act as Molecular Switches


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


Kasvinjalostus 2000-luvulla

Kasvinjalostus 2000-luvulla Kasvinjalostus 2000-luvulla (Kirsi Lehto, Biotieteet ja geeniteknologia -seminaari, Turku 10.2.2001) Kasvien jalostus ennen Kasvinjalostuksella on pitkät perinteet: jo varhaiseen kasvinviljelyyn liittyi


Luennon aiheet: GM-eläimet. Geenimuunnellut hiiret. Alkioiden pakastus. Geenimuunnellut eläimet: miksi ja miten?

Luennon aiheet: GM-eläimet. Geenimuunnellut hiiret. Alkioiden pakastus. Geenimuunnellut eläimet: miksi ja miten? Luennon aiheet: GM-eläimet Koe-eläinkurssi 9.11.12 Petra Sipilä Geenimuunnellut hiiret Siirtogeeniset eläimet Poistogeeniset eläimet Alkioiden pakastus Terminologiaa Geenimuunnellut eläimet: miksi ja miten?


Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten


Synteettinen biologia

Synteettinen biologia Synteettinen biologia Julkaisun on toimittanut biotekniikan neuvottelukunta (BTNK) Kirjoittajat: Anneli Ritala, Outi Koivistoinen, Jussi Jäntti Teknologian tutkimuskeskus VTT Marko Ahteensuu Helsingin


Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyvaikutuksen synty Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyn ja biologisen materian vuorovaikutus Koska ihmisestä 70% on vettä, todennäköisin (ja tärkein) säteilyn ja biologisen


epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio:

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio: -mesenkyymi-vuorovaikutukset, esimerkkinä hammas ja ihokarva elimiä muodostuu kaikista alkiokerroksista, usein epiteelin ja mesenkyymin vuorovaikutuksesta epiteeli ektodermi kumpi aloittaa elimen kehityksen:


Duchennen lihasdystrofiasta

Duchennen lihasdystrofiasta Page 1 of 8 JULKAISTU NUMEROSSA 4/2016 TEEMAT Duchennen lihasdystrofiasta Jaana Lähdetie, Pirjo Isohanni / Kirjoitettu 22.2.2017 / Julkaistu Duchennen lihasdystrofia on vakava lihassairaus, joka johtuu


Genomin evoluutio. Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan?

Genomin evoluutio. Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan? Genomin evoluutio Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan? -duplikaatiot: geenien, geenin osien duplikaatiot, segmentaaliset, koko genomin duplikaatiot -duplikoituneiden geenien


"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein



KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,


Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen


Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä


Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,


Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset EU:ssa ei ole yleisesti hyväksyttyä elintarvikepetosten määritelmää. Yleinen ohjeistus löytyy elintarvikelainsäädäntöä


Synteettinen biologia kestävä biotalouden Biotekniikan mahdollistajana

Synteettinen biologia kestävä biotalouden Biotekniikan mahdollistajana TEKNOLOGIAN TUTKIMUSKESKUS VTT OY Synteettinen biologia kestävä biotalouden Biotekniikan mahdollistajana tulevaisuus loistaa kirkkaana! Suomen Bioteollisuus ry:n (FIB) 20 v. juhlaseminaari 6.4.2017 Merja


Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa

Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa KOTIELÄINJALOSTUKSEN TIEDOTE No 82 Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa Sampo Sirkkomaa ja Matti Ojala Kotieläinten jalostustieteen laitos Helsinki 1988 Julkaistjat: Kotieläinten


9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun


Mallivastaus: Selkeys ja johdonmukaisuus. Yhteensä 21

Mallivastaus: Selkeys ja johdonmukaisuus. Yhteensä 21 Joensuun yliopisto/metsätieteellinen tiedekunta Valintakoe 009/MALLIVATAUKET BIOLOGIA. ellunkeiton aikana puusta vapautuviin kuituihin jää noin 0 % jäännösligniiniä, joka aiheuttaa sellulle sen ominaisen


Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.


Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia


Ihmisalkuperää olevat biomateriaalit

Ihmisalkuperää olevat biomateriaalit Lääkelaitoksen julkaisusarja 5/2003 Ihmisalkuperää olevat biomateriaalit Veikko Viljanen TERVEYDENHUOLLON LAITTEISSA JA TARVIKKEISSA KÄYTETYT IHMISALKUPERÄÄ OLEVAT BIOMATERIAALIT Osa 3 Kirjoittaja: Veikko


Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,
