FIMM Technology Services FIMM:n teknologiapalvelut 1

Koko: px
Aloita esitys sivulta:

Download "FIMM Technology Services FIMM:n teknologiapalvelut 1"

Transkriptio

1 FIMM Technology Services FIMM:n teknologiapalvelut 1

2 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based High Throughput Screening 14 Drug Sensitivity and Resistance Testing 15 Imaging and Microarray Printing 16 Bioinformatics 17 Cell Line Authentication 18 Molecular Pathology Services 19 Meilahti Integrated Biobank Infrastructure, MIBI Jouko Siro, Gary Wornell, Michel Mees and EATRIS, Tea Pemovska, Kaisa Kettunen, Vilja Pietiäinen and Vidya Velagapudi are acknowledged for the figures.

3 FIMM Technology Centre and Biobank Infrastructure FIMM:n Teknologiakeskus ja biobankki-infrastruktuuri FIMM Technology Centre is a national and international research core unit providing an extensive spectrum of biomedical research services. FIMM Technology Centre operates several core units with a nearly technology experts from diverse educational backgrounds being involved in the operations. Technology Centre develops methods and offers services in the areas of genomics (sequencing, genotyping, expression, methylation and CNV profiling), high throughput biomedicine (screening of chemical compounds, approved drugs, and sirna, as well as serum, cell and protein lysate microarrays), metabolomics, bioinformatics and IT services using state-of-the-art technologies. Furthermore, FIMM and THL joined forces in 2011 and created Meilahti Integrated Biobank Infrastructure, MIBI, which offers a wide range of biobanking services for all interested research projects collecting samples and data. This brochure summarizes our services and lists contact persons for further enquiries. We hope that you will find this useful! FIMM:n Teknologiakeskus on kansallinen ja kansainvälinen tutkimuksen tukiyksikkö, joka tarjoaa mittavan valikoiman biolääketieteellisen alan tutkimuspalveluja. Teknologiakeskus muodostuu useasta erikois-yksiköstä, joissa työskentelee lähes 50 monipuolisen koulutustaustan omaavaa teknologia-asiantuntijaa. Teknologiakeskuksella on tärkeä rooli menetelmien kehittäjänä. Palveluja tarjotaan genomiikan (sekvensointi, genotyyppaus, geeniekspressio-, metylaatioja kopiolukumäärä- määritykset), tehoseulontapalvelujen (lääkeherkkyystestit, kemikaaliseulonnat, RNAi seulonnat, erilaiset mikrosirutulostukset), metabolomiikan, bioinformatiikan ja IT-palvelujen alalla. Lisäksi vuonna 2011 FIMM ja THL perustivat yhdessä Meilahden biopankki-infrastruktuurin (MIBI), joka tarjoaa monipuolisia ja nykyaikaisia näytteiden käsittely- ja säilytyspalveluja tutkimushankkeille. Tässä esitteessä kerromme lyhyesti palveluistamme ja listaamme yhteyshenkilöt, joilta on saatavissa lisätietoja. Toivomme että tästä esitteestä on sinulle hyötyä! Janna Saarela, Research Director

4 A wide range of services suitable for various research purposes is available at FIMM Technology Centre FIMM Teknologiakeskuksessa on tarjolla mittava valikoima erilaisiin tutkimustarkoituksiin soveltuvia palveluja The figure on the next page illustrates how a researcher could utilize the various services available at FIMM Technology Centre. In this example the researcher is dealing with cancer patients but most of the services are not restricted by the disease of interest. More information is available at: https://www.fimm.fi/en/services/technology-centre Viereisen sivun kuvassa on esitetty, miten tutkija voisi hyödyntää FIMM Teknologiakeskuksen tarjoamia lukuisia palveluja. Tässä esimerkissä tutkija on kiinnostunut syövän molekyylitason tapahtumista, mutta useimmat palvelumme soveltuvan eri tyyppisten sairauksien tutkimiseen. Lisätietoja palveluistamme löytyy myös osoitteesta: https://www.fimm.fi/en/services/technology-centre 4

5 Blood cells Tissue biopsy Serum Automated DNA and RNA extraction, sample handling Biobanking High-throughput screens Molecular profiling Tissue imaging Drug sensitivity Mutation detection (hereditary) Histochemical stainings Chemical screens Mutation detection (somatic) Webmicroscopy Gene silencing Metabolomics Whole-genome SNP genotyping CNV profiling Gene expression levels Fusion gene detection Epigenetics 5

6 Genomic Profiling Identification of Known and Novel Variants FIMM Technology Centre offers a wide variety of genomic profiling services that can be used for detection of novel and analysis of known genetic variations: mutations, SNPs, indels and CNVs. We offer high-throughput as well as targeted genotyping and sequencing services. For high-throughput next generation sequencing (NGS) services we utilize Illumina s massively parallel sequencing platforms (Illumina HiSeq and Illumina MiSeq). Our NGS service portfolio for variant and mutation detection includes.: whole genome sequencing (WGS) exome sequencing custom targeted re-sequencing ultra-deep amplicon sequencing targeted mutation panels NGS data analysis services for variant detection are provided. Classical capillary sequencing services are used for various validation purposes. We also offer SNP and CNV genotyping with Illumina Infinium and GoldenGate methodologies for wholegenome, targeted and custom SNP and CNV sets, as well as for cytogenetic analysis needs. For custom SNP genotyping the RT-PCR based LightCycler genotyping and MALDI-TOF (Matrix- Assisted Laser Desorption / Ionization Time-Of- Flight) based Sequenom genotyping services are also available. Sequencing services: Pekka Ellonen Genotyping services: Kati Donner

7 Genomin profilointi uusien varianttien tunnistaminen ja tunnettujen varianttien määrittäminen FIMM:n Teknologiakeskus tarjoaa monenlaisia geneettiseen profilointiin sopivia menetelmiä uusien varianttien tunnistamiseksi ja tunnettujen varianttien määrittämiseksi. Sopivia menetelmiä sekä genominlaajuisiin että tietyille alueille kohdistettuihin analyyseihin löytyy niin genomiikkakuin sekvensointiyksikön palveluista. Uuden sukupolven sekvensointiin perustuvat palvelut (Next Generation Sequencing,NGS) hyödyntävät Illuminan suuren kapasiteetin HiSeq ja MiSeq laitteita. NGS sovellutuksiimme kuuluvat: koko genomin sekvensointi eksomisekvensointi kohdennettu uudelleensekvensointi korkean lukupeiton amplikonisekvensointi valmiit mutaatiopaneelit Genomin variaatiota - yhden nukleotidin polymorfismeja (SNP), kopiolukumäärävaihtelua (CNV) ja sytogeneettisiä muutoksia - voi tutkia sekä genominlaajuisesti että kohdennetusti myös Illuminan Infinium ja GoldenGate teknologioiden avulla. Lisäksi tarjoamme yksittäisten SNP-varianttien määrittämistä RT-PCR -menetelmään pohjautuvalla LightCycler instrumentilla sekä kymmenien tai satojen varianttien kyseessä ollessa massaspektrofotometriaan perustuvalla Sequenomin MALDI-TOF (Matrix-Assisted Laser Desorption / Ionization Time-Of-Flight) genotyypitysmenetelmällä. Tarjoamme myös NGS tulosten analyysipalvelua. Uusien löydösten varmistamiseen tarjoamme klassista kapillaarisekvensointimenetelmää. 7

8 Gene Expression Analyses Geeniekpressiomääritykset FIMM Technology Centre offers gene expression services using Next Generation Sequencing (NGS) based technologies and microarrays. RNAseq is a NGS-application used for sequencing of transcriptomes. It enables detection of novel transcripts and splice variants, putative fusion genes and exon level expression analysis of known genes. For RNAseq we currently utilize Illumina s massively parallel sequencing platform (Illumina HiSeq). RNAseq data analysis pipeline is available for organisms supported by Ensembl. We also offer Illumina gene expression technologies, i.e. direct hybridization and DASL gene expression assays, available for whole-genome expression analysis of human, mouse and rat RNA samples. FIMM:n Teknologiakeskuksella on käytössä geeniekspressiotasojen määrittämiseksi kaksi eri menetelmää: uuden sukupolven sekvensointi (Next Generation Sequencing, NGS) sekä mikrosiruanalyysit. RNA-sekvensointi on transkriptomien sekvensointiin tarkoitettu NGS:n sovellus. Se mahdollistaa suhteellisten ekspressiotasojen määrittämisen lisäksi uusien transkriptien, silmikointivarianttien ja fuusiogeenien tunnistamisen. Käytämme RNA:n sekvensointiin Illuminan HiSeq-laitteistoa. Tarjoamme myös RNAseq datan analysointipalveluja niille eliöille, joiden verrokkisekvenssi löytyy Ensembltietokannasta. Geeniekspressiota voi tutkia genominlaajuisesti myös Illuminan mikrosiruilla, joita on saatavilla ihmisen, hiiren ja rotan genomeille. Sequencing services: Pirkko Mattila Array based services: Kati Donner

9 DNA Methylation Analyses DNA:n metylaatiotason analysointi FIMM Tecnology Centre Sequencing Unit offers high throughput DNA methylation services by next generation sequencing based technologies. For methyl sequencing bisulfite conversion -based methods among others followed by Illumina s massively parallel sequencing platforms are being used to reveal methylation patterns. DNA methylation profiling with Illumina s 450k Infinium Methylation BeadChip microarray, covering over methylation sites and target sequence methylation profiling using the Sequenom EpiTYPER application are available at our Genomics Unit. FIMM:n Teknologiakeskuksen Sekvensointiyksikkö tarjoaa DNA:n metylaatiotasojen genominlaajuista määrittämistä uuden sukupolven sekvensointitekniikkaan perustuvilla menetelmillä. Käytössämme on mm. bisulfiitti konversioon perustuva näytteenvalmistusmenetelmä. Metyloidun DNA:n sekvensointiin käytämme Illuminan HiSeqlaitteistoja. Genomiikkayksikössä metylaatiotasoja voidaan määrittää Illuminan 450k Infinium Methylation BeadChip mikrosirulla, jonka avulla genomista analysoidaan yli metylaatiokohtaa ja Sequenomin EpiTYPER sovelluksella, kun halutaan tutkia kohdistetusti kiinnostavia genomialueita. Sequencing services: Pekka Ellonen Array based services: Kati Donner

10 smallrna Sequencing and Screening Pienten RNA-molekyylien sekvensointi ja seulonta smallrnaseq is a Next Generation Sequencing (NGS) application used for sequencing of small (<200nt) RNA molecules. It enables analysis of both known and novel smallrnas. Established service is available for mirna profiling including size-based selection of mirna fraction from smallrnaseq libraries. Illumina plattforms, high capacity Hiseq and lighter capacity fully integrated personal sequencer, MiSeq can be used for mirna sequencing. Primary analysis services for computing expression levels of known mirnas are available. The FIMM High Throughput Biomedicine (HTB) unit has expertise in gain-of-function as well as loss-of function microrna functional screening. Protein level measurements by protein lysate microarrays, cell viability read-outs and high content image-based assays can be used to monitor for the phenotype. Pienten RNA-molekyylien sekvensointi on uuden sukupolven sekvensointitekniikan sovellus, jolla tarkoitetaan alle 200 nukleotidin pituisten RNAmolekyylien sekvensointia. Menetelmä mahdollistaa sekä tunnettujen että uusien pienten RNAmolekyylien analysoinnin. Tarjoamamme mikrornaprofilointipalvelu sisältää mirna-molekyylien kokoon perustuvan eristämisen pienten RNA-molekyylien muodostamasta kirjastosta. mirna profiloinnissa hyödynnämme Illuminan suuren kapasiteetin HiSeq tai MiSeq alustoja. Tarjoamme myös analyysipalveluja mirna-sekvensointidatalle. FIMM:in High Throughput Biomedicine (HTB) yksikkö tarjoaa RNAi seulontojen lisäksi myös mikrorna-seulontoja. mirna seulontojen vaikutusta fenotyyppiin voidaan analysoida proteiinilysaattimikrosirujen, solujen elinkykyä mittaavien kokeiden sekä kuvantamisen avulla. smallrna sequencing : Pirkko Mattila mirna screening: Carina von Schantz-Fant

11 Metabolomics Metabolomiikka FIMM Metabolomics Unit provides high-throughput targeted mass spectrometry based quantitative metabolomics services to basic, biomedical, preclinical and clinical researchers. Our Metabolomics technology platform offers services to researchers in many diverse scientific fields. We can analyse 147 metabolites from 15 different biological classes in many different types of samples from humans, animal models (mouse, rat, dog), C.elegans, and yeast etc. We offer high quality services using state-of-theart technologies, standardised laboratory protocols, quality controls (every 5th run is a blank and every 10th run is our quality control sample), randomisation procedures at both sample extraction and analysis stages, and maintain documentation using electronic lab notebook. Our services and technologies can be applied to research projects in many ways and we will work with you to fit them to your needs. FIMM:n Metabolomiikkayksikkö tarjoaa massaspektrometriaan perustuvia metaboliittien määrityspalveluja biologisille näytteille. Palvelujamme ja teknologiaamme voi hyödyntää monenlaisissa tutkimusprojekteissa. Kehittämällämme menetelmällä voidaan tällä hetkellä tunnistaa 147 metaboliittia laajalla konsentraatioskaalalla. Tarjoamme kohdennettuja, kvantitatiivisia määrityspalveluja monille erilaisille näytetyypeille sekä ihmisperäisille että eläinmalleista peräisin oleville näytteille. Käytämme moderneja teknologioita, standardoituja prosesseja ja kiinnitämme erityistä huomiota laadunvalvontaan. Vidya Velagapudi

12 Cell-based High Throughput Screening The FIMM High Throughput Biomedicine unit (HTB) provides high-throughput approaches for cell based assays and (bio)chemical screening. We aid our users in transforming their assay to platebased high throughput formats (96-, 384 and well). To this end our unit harbors robotics and automation for liquid handling, contact printing, plate reading assays, and high content automated imaging. We collaborate closely with researchers and we are available for consultation at the earliest stages of assay conception through all stages of assay development, optimization, automation, and screening. RNAi screening The HTB unit offers sirna screening for smaller targeted gene sets, such as druggable genes, kinases or phosphatases as well as whole human genome screening. We maintain a genome-wide collection of Ambion human sirnas. Our current endpoints include cell viability readout, automated high content microscopy, kinetic live cell imaging and protein level measurements by protein lysate microarrays. Chemical screening We provide high-throughput approaches of many types for (bio)chemical screening: Cell-based and biochemical screens (using targeted or large chemically diverse libraries) Molecular probe discovery Biological profiling (using libraries of known bioactives) Drug repositioning We provide researchers with access to high throughput screening of chemical libraries (in total compounds, including chemical diversity, natural compound, known bioactive and approved drug collections). Distribution of chemicals We also provide research groups with assay-ready chemicals on plates for their experiments and provide larger amounts of chemicals (5 ul of x concentration) for proof-of-principle experiments with information of the recommended concentration of usage. RNAi screening: Carina von Schantz-Fant Chemical screening: Jani Saarela Sharing of chemicals: Laura Turunen

13 Solubiologinen tehoseulonta FIMM:n High Throughput Biomedicine (HTB) yksikkö tarjoaa eri tyyppisiä solubiologisia tehoseulontapalveluja. Yksikkö on erikoistunut solukokeisiin ja biokemiallisiin analyyseihin ja auttaa käyttäjiä muuntamaan kokeensa 96-, 384-, tai 1536-kuoppalevyille sopiviksi. Tehoseulontalaitteistoon kuuluu robotiikkaa ja automatisoituja nesteenkäsittelylaitteita, mikrosirutulostin, levylukijoita sekä automatisoitu fluoresenssimikroskooppisysteemi. Teemme tiivistä yhteistyötä tutkijoiden kanssa ja autamme mielellämme kokeiden suunnittelussa alusta loppuun. RNAi tehoseulonta HTB yksikkö tarjoaa RNAi tehoseulontaa genominlaajuisesti sekä kohdennetuille geeniryhmille, kuten kinaaseille ja fosfataaseille. Yksiköllä on käytössään Ambionin genominlaajuinen sirnakokoelma ihmisen geeneille. RNAi seulontojen vaikutusta voidaan analysoida solujen elinkykyä mittaavien kokeiden, automatisoidun solumikroskoopin, elävien solujen kineettisen kuvantamisen sekä proteiinilysaattimikrosirujen avulla. Kemiallinen tehoseulonta Yksikkömme tarjoaa erilaisia kemiallisia tehoseulontapalveluita: solukokeet ja biokemialliset kokeet (kohdennettuja tai laajempia kemikaalikirjastoja käyttäen) biologisten vuorovaikutusten tutkimisen mahdollistavien yhdisteiden etsintä (molecular probe discovery) biologinen profilointi (tunnettujen bioaktiivisten aineiden kirjastoja käyttäen) tunnettujen lääkeaineiden testaaminen uusiin tarkoituksiin HTB yksikön kokoelmiin kuuluu yhdistettä, mm. kemiallisesti monimuotoisten yhdisteiden, luonnollisten yhdisteiden ja tunnettujen bioaktiivisten ja hyväksyttyjen yhdisteiden kokoelmat. Kemikaalien jakaminen Yksikön palveluihin kuuluu myös käyttövalmiiden kemikaalilevyjen sekä suurempien kemikaalimäärien (5µl kutakin kemikaalia x konsentraatiossa) jakaminen tutkimusryhmille. 13

14 Drug Sensitivity and Resistance Testing Lääkeaineherkkyysmääritys The FIMM High Throughput Biomedicine unit (HTB) provides a drug sensitivity and resistance testing (DSRT) assay platform to users. DSRT provides the means for functional profiling of cancer cells and other cell systems in terms of drug sensitivity profiles. The FIMM oncology drug collection currently consists of 306 approved and emerging investigational oncology compounds covering a wide range of molecular targets where the effect of each compound is described with a unique drug sensitivity score. The DSRT platform is actively being used in personalized cancer medicine setting in collaboration with clinicians in order to identify personalized treatment strategies. In addition, numerous different cancer cell lines have been analysed using the platform to detect cancer effective and selective compounds. To date, more than 700 DSRT screens have been run. The active substances in the DSRT platform are also available to users in microgram quantities for followup proof-of-principle studies. Yksi FIMM:in High Throughput Biomedicine (HTB) yksikön tarjoamista palveluista on lääkeaineherkkyysmääritys (DSRT). DSRT:n avulla syöpäsoluja sekä muita solulinjoja voidaan profiloida lääkeaineherkkyyden suhteen. FIMM:n syöpälääkeainekokoelma käsittää tällä hetkellä 306 hyväksyttyä ja kliinisissä kokeissa olevaa lääkeainetta, ja kattaa hyvin laajan kohdemolekyylien kirjon soluissa. DSRT-palvelua käytetään aktiivisesti yksilöllisen lääketieteen tutkimusasetelmassa, jossa yhteistyössä potilasta hoitavan lääkärin kanssa pyritään löytämään juuri kyseiselle potilaalle toimiva hoitostrategia. Lisäksi DSRT-palvelun avulla on tutkittu lukuisia syöpäsolulinjoja ja löydetty tehokkaita ja selektiivisiä syöpäsolujen kasvua estäviä yhdisteitä. Tähän mennessä olemme tehneet yli 700 DSRT-seulontaa. FIMM:in syöpälääkeaine kokoelmaan kuuluvia yhdisteitä on saatavissa mikrogramma-skaalassa tutkimushypoteesien todistamiseksi seurantatutkimuksissa. Krister Wennerberg

15 Imaging and Microarray Printing Kuvantaminen ja mikrosirutulostus The FIMM High Throughput Biomedicine Unit (HTB) provides access to both an Olympus ScanR high content screening system and an INCUCYTE (Essen Bioscience) live cell microscope to visualize cells in high throughput assays. The fully automated Olympus IX81 inverted microscope enables simultaneous visualization of up to 5 different fluorescent labels in fixed cells. The system is designed to produce images from multi-well plates as well as from single slides. Acquired images can be automatically analyzed by, e.g. ScanR image analysis software. The INCUCYTE system, a microscope placed inside a cell incubator, can be used for longterm kinetic live cell imaging of wide variety of cell culture vessels and plates, both in high quality phase contrast or fluorescent mode. We offer also a variety of printing services, such as serum, oligo, plasmid, and protein lysate microarray printing utilizing our Aushon Biosystems 2470 contact printer. FIMM:n High Throughput Biomedicine (HTB) yksikkö tarjoaa solujen kuvantamiseen tehoseulontaanalyyseissä INCUCYTE - (Essen Bioscience) ja Olympus ScanR- kuvantamissysteemejä. Täysin automatisoidulla Olympus IX81 mikroskoopilla on mahdollista visualisoida samanaikaisesti jopa viittä erilaista fluoresoivaa leimaa fiksatuissa soluissa. Systeemi soveltuu sekä yksittäisille objektilaseille että kuoppalevyille. Kuvien analysointi voidaan tehdä automaattisesti systeemin omalla kuvaanalyysiohjelmalla. INCUCYTE, mikroskooppi soluinkubaattorissa, sopii elävien solujen pitkäaikaiseen kineettiseen kuvantamiseen. INCUCYTE mahdollistaa solujen kuvaamisen sekä faasikontrasti- että fluoresenssimikroskopiaa käyttäen useissa erilaisissa kasvatusastioissa. Palveluihimme kuuluu myös mikrosirujen valmistus. Yksikössä on Aushon Biosystems 2470 mikrosirutulostin, jolla on mahdollista valmistaa mm. seerumi-, oligo-, plasmidi-, ja proteiinilysaattimikrosiruja. Carina von Schantz-Fant

16 Bioinformatics Bioinformatiikkapalvelut Many of the technologies and services offered by FIMM produce considerable amounts of data, which typically requires extensive data analysis to make it usable for researchers. FIMM provides expertise and help in the following areas of bioinformatics: pipelines for identification of germline and somatic mutations from exome-, whole genome- and amplicon sequencing data identification of copy number variants from sequencing data RNA-seq data analysis: estimation of gene-, transcript- and exon expression levels, mutation calling and fusion gene detection FIMM provides the computing platform and necessary storage infrastructure for solving questions in bioinformatics, molecular medicine, genetics and related fields. Monet FIMM:n Teknologiakeskuksen tarjoamista palveluista ja teknologioista tuottavat suuria tietomääriä, jonka hyödyntämiseksi dataa täytyy käsitellä ja analysoida. Tarjoamme apuamme erityisesti seuraavilla bioinformatiikan osa-alueilla: periytyvien ja somaattisten mutaatioiden tunnistaminen uuden sukupolven sekvensointitekniikoiden tuottamasta datasta kopiolukumäärämuutosten tunnistaminen sekvensointidatasta RNA-seq datan analysointi: geenien, transkriptien ja eksonien ekspressiotasojen määritys, mutaatioiden tunnistaminen, fuusiogeenit FIMM tarjoaa tarvittavan infrastruktuurin bioinformatiikan, systeemibiologian, molekyylilääketieteen, genetiikan ja muiden vastaavien tieteenalojen kysymysten ratkaisemiseksi. Imre Västrik

17 Cell Line Authentication Solulinjojen autentikointi FIMM Genomics Unit offers cell line authentication services. The method used allows co-amplification and detection of ten human loci (9 STR loci, Amelogenin for gender identification). These loci collectively provide a genetic profile with a random match probability of 1 in 2.92 x 109. Results are compared to allelic information in different publicly available databases to confirm the authenticity of the cell line. The service can also be used for fingerprinting DNA-samples or cell lines. FIMM:n Genomiikkayksikkö tarjoaa tutkimusryhmille solulinjojen autentikointipalvelua. Menetelmässä monistetaan samanaikaisesti 10 ihmisen genomilokusta (9 mikrosatelliittia ja amelogenin-geeni sukupuolen määrittämiseksi). Saatua profiilia verrataan julkisiin tietokantoihin solulinjan alkuperän toteamiseksi. Vastaavan identtisen geneettisen profiilin löytäminen sattumalta on hyvin epätodennäköistä. Menetelmää voidaan käyttää myös DNA-näytteiden tai solulinjojen sormenjäljen luomiseksi. Kati Donner

18 Molecular Pathology Services Molekyylipatologian palvelut Molecular pathology laboratory provides services for tissue-based research such as: -tissue processing -embedding and sectioning -staining histochemically or by using immunohistochemical techniques The laboratory offers also tissue microarray design and preparation which allows simultaneous analysis of large number of cases under standardized laboratory and evaluation conditions without significant damage to the original tissue block. Molekyylipatologian laboratorio tarjoaa asiakkailleen mm. seuraavia kudosnäytteiden tutkimiseen liittyviä palveluja: -automaattinen kudoskäsittely -näytteiden parafiinivalu ja leikkaus -värjäys histokemiallisin tai immunohistokemiallisin menetelmin Laboratoriossa on myös laitteisto kudossirujen (Tissue Microarray, TMA) suunnittelua ja valmistusta varten. TMA:n käyttö kokoleikkeiden sijaan mahdollistaa useiden kudosnäytteiden samanaikaisen ja standardoidun leikkauksen, värjäyksen sekä analysoinnin. Tiina Vesterinen

19 Meilahti Integrated Biobank Infrastructure, MIBI Meilahden biopankkipalvelut, MIBI The MIBI infrastructure provides state-of-the-art sample processing and storing and several technology platforms such as ips cell preparation, tissue cultures, exosome isolation and different databases. Sample storage services MIBI has liquid nitrogen (LN2) based sample storage facility which provides low-cost, secure and controlled storage of samples in the liquid nitrogen vapour phase (-180 C). This sample storage is available to all research groups for storing small and medium sized sample collections. In addition to LN2, samples can be stored in -20 C, -80 C or at room temperature when appropriate. Automated sample processing MIBI offers automated DNA extraction service from whole blood, buffy coats, cell and tissue samples, saliva and buccal swabs, as well as automated DNA aliquoting, including normalization and quality control. Similarly, liquid handling robotics allows automated serum and plasma aliquoting if needed. MIBI tarjoaa asiakkailleen nykyaikaista näytteiden käsittelyä ja säilytystä sekä useita erilaisia teknologiapalveluja kuten ips-solujen valmistusta, kudosviljelyä, eksosomien eristystä ja erilaisia tietokantoja. Näytteiden säilytyspalvelut MIBI:llä on nestemäiseen typpeen perustuva näytesäilytysjärjestelmä, jossa näytekokoelmia voidaan säilyttää nestetypen kaasufaasissa -180 C lämpötilassa edullisesti, luotettavasti ja tarkasti valvottuina. Tämä järjestelmä on kaikkien tutkimusryhmien käytettävissä, jotka haluavat tallettaa pieniä tai keskisuuria näytekokoelmia. Nestetyppilämpötilan lisäksi MIBI tarjoaa näytesäilytystä -20 C:ssa, -80 C:ssa ja huoneenlämpötilassa. Automaattinen näytteiden käsittely MIBI tarjoaa automatisoitua DNA:n eristystä erilaisista lähtömateriaaleista kuten kokoverestä, verisoluista, kudoksesta, syljestä ja poskisolunäytteistä. Eristetylle DNA:lle tehdään samalla tarvittavat laadunvarmistustoimenpiteet ja se normalisoidaan ja jaetaan eriin asiakkaan haluamalla tavalla. Nesteenkäsittelyrobotteja voidaan hyödyntää myös seerumi- ja plasmanäytteiden jakamisessa pienempiin eriin. Päivi Laiho,

20 Further information: https://www.fimm.fi/en/services/technology-centre Joint research institute with: 20

FIMM Technology Services FIMM:n teknologiapalvelut 1

FIMM Technology Services FIMM:n teknologiapalvelut 1 FIMM Technology Services FIMM:n teknologiapalvelut 1 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based

Lisätiedot

Syövät pirstaloituvat: haaste hoidon kehitykselle

Syövät pirstaloituvat: haaste hoidon kehitykselle Syövät pirstaloituvat: haaste hoidon kehitykselle Kimmo Porkka Professor, head of division hematology Helsinki University Central Hospital Helsinki, Finland Syövän heterogeenisyys: esimerkkinä akuutti

Lisätiedot

Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi

Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

Sisällysluettelo Table of contents

Sisällysluettelo Table of contents Sisällysluettelo Table of contents OTC:n Moodlen käyttöohje suomeksi... 1 Kirjautuminen Moodleen... 2 Ensimmäinen kirjautuminen Moodleen... 2 Salasanan vaihto... 2 Oma käyttäjäprofiili... 3 Työskentely

Lisätiedot

LYTH-CONS CONSISTENCY TRANSMITTER

LYTH-CONS CONSISTENCY TRANSMITTER LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are

Lisätiedot

Suomalaiset vahvuudet

Suomalaiset vahvuudet Suomalaiset vahvuudet Korkealaatuinen terveydenhuoltojärjestelmä Luotettavat terveydenhuollon rekisterit Väestöaineistot ja terveydenhuollon näytekokoelmat Geneettisesti homogeeninen väestö Kansainvälisesti

Lisätiedot

TIEKE Verkottaja Service Tools for electronic data interchange utilizers. Heikki Laaksamo

TIEKE Verkottaja Service Tools for electronic data interchange utilizers. Heikki Laaksamo TIEKE Verkottaja Service Tools for electronic data interchange utilizers Heikki Laaksamo TIEKE Finnish Information Society Development Centre (TIEKE Tietoyhteiskunnan kehittämiskeskus ry) TIEKE is a neutral,

Lisätiedot

PrinLab. Antti Berg Oulun seudun ammattikorkeakoulu, Tekniikan yksikkö 29.2.2012

PrinLab. Antti Berg Oulun seudun ammattikorkeakoulu, Tekniikan yksikkö 29.2.2012 PrinLab Painettavien antureiden kehityslaboratorio Antti Berg Oulun seudun ammattikorkeakoulu, Tekniikan yksikkö 29.2.2012 1. Tausta 2. PrinLabtavoitteet 3. PrinLablaboratorio 4. Kehityslaboratorion toiminta

Lisätiedot

Suomalainen koulutusosaaminen vientituotteena

Suomalainen koulutusosaaminen vientituotteena Suomalainen koulutusosaaminen vientituotteena Case Saudi Arabia EduCluster Finland Ltd. Anna Korpi, Manager, Client Relations AIPA-päivät Kouvolassa 11.6.2013 11.6.2013 EduCluster Finland Ltd Contents

Lisätiedot

Skene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene

Skene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene Skene Muokkaa perustyyl. Games Refueled napsautt. @Games for Health, Kuopio Muokkaa alaotsikon perustyyliä napsautt. 2013 kari.korhonen@tekes.fi www.tekes.fi/skene 10.9.201 3 Muokkaa Skene boosts perustyyl.

Lisätiedot

Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland

Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research

Lisätiedot

Basic Flute Technique

Basic Flute Technique Herbert Lindholm Basic Flute Technique Peruskuviot huilulle op. 26 Helin & Sons, Helsinki Basic Flute Technique Foreword This book has the same goal as a teacher should have; to make himself unnecessary.

Lisätiedot

ATLAS-kartan esittely - Peli palveluiden yhteiskehittämisen menetelmistä Päivi Pöyry-Lassila, Aalto-yliopisto

ATLAS-kartan esittely - Peli palveluiden yhteiskehittämisen menetelmistä Päivi Pöyry-Lassila, Aalto-yliopisto ATLAS-kartan esittely - Peli palveluiden yhteiskehittämisen menetelmistä Päivi Pöyry-Lassila, Aalto-yliopisto Serve Research Brunch 24.10.2013 Esityksen sisältö ATLAS-hanke lyhyesti ATLAS-kartan kehittäminen:

Lisätiedot

MUSEOT KULTTUURIPALVELUINA

MUSEOT KULTTUURIPALVELUINA Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina

Lisätiedot

Terveysalan uudistaminen yritysten, korkeakoulujen ja palvelujärjestelmän yhteistyöllä 15.4.2015

Terveysalan uudistaminen yritysten, korkeakoulujen ja palvelujärjestelmän yhteistyöllä 15.4.2015 Terveysalan uudistaminen yritysten, korkeakoulujen ja palvelujärjestelmän yhteistyöllä 15.4.2015 Reijo Salonen Johtaja, Lääketutkimus ja kehitys Orion Yliopistot Terveydenhoito Teollisuus Kolme pilaria,

Lisätiedot

WAMS 2010,Ylivieska Monitoring service of energy efficiency in housing. 13.10.2010 Jan Nyman, jan.nyman@posintra.fi

WAMS 2010,Ylivieska Monitoring service of energy efficiency in housing. 13.10.2010 Jan Nyman, jan.nyman@posintra.fi WAMS 2010,Ylivieska Monitoring service of energy efficiency in housing 13.10.2010 Jan Nyman, jan.nyman@posintra.fi Background info STOK: development center for technology related to building automation

Lisätiedot

Tietojenkäsittelytieteiden koulutusohjelma. Tietojenkäsittelytieteiden laitos Department of Information Processing Science

Tietojenkäsittelytieteiden koulutusohjelma. Tietojenkäsittelytieteiden laitos Department of Information Processing Science Tietojenkäsittelytieteiden koulutusohjelma Tietojenkäsittelytieteet Laskennallinen data-analyysi Ohjelmistotekniikka, käyttöjärjestelmät, ihminen-kone -vuorovaikutus Teoreettinen tietojenkäsittelytiede

Lisätiedot

HITSAUKSEN TUOTTAVUUSRATKAISUT

HITSAUKSEN TUOTTAVUUSRATKAISUT Kemppi ARC YOU GET WHAT YOU MEASURE OR BE CAREFUL WHAT YOU WISH FOR HITSAUKSEN TUOTTAVUUSRATKAISUT Puolitetaan hitsauskustannukset seminaari 9.4.2008 Mikko Veikkolainen, Ratkaisuliiketoimintapäällikkö

Lisätiedot

Tork Paperipyyhe. etu. tuotteen ominaisuudet. kuvaus. Väri: Valkoinen Malli: Vetopyyhe

Tork Paperipyyhe. etu. tuotteen ominaisuudet. kuvaus. Väri: Valkoinen Malli: Vetopyyhe etu Monikäyttöpaperi hoitaa useimmat pyyhintätehtävät Sopiva lasipintojen pyyhintään Sopii käsien kuivaamiseen Elintarvikekäyttöön hyväksytty Tork Easy Handling, pakkaus, jota on helppo kantaa mukana,

Lisätiedot

Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä

Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Arkkitehtuuritietoisku eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Esikysymys Kuinka moni aikoo suunnitella projektityönsä arkkitehtuurin? Onko tämä arkkitehtuuria?

Lisätiedot

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012

Lisätiedot

Choose Finland-Helsinki Valitse Finland-Helsinki

Choose Finland-Helsinki Valitse Finland-Helsinki Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun

Lisätiedot

1. Laitoksen tutkimusstrategia: mitä painotetaan (luettelo, ei yli viisi eri asiaa)

1. Laitoksen tutkimusstrategia: mitä painotetaan (luettelo, ei yli viisi eri asiaa) Tutkimuksen laadunvarmistus laitostasolla: Itsearviointi Tutkimuksen laadunvarmistukseen ja laadun arviointiin liittyvä kysely on tarkoitettu vastattavaksi perusyksiköittäin (laitokset, osastot / laboratoriot,

Lisätiedot

Näytön jäljillä CINAHL-tietokannassa

Näytön jäljillä CINAHL-tietokannassa BMF, Osaamisen ytimessä -kevätseminaari 13.4.2011 Maarit Putous, informaatikko Näytön jäljillä CINAHL-tietokannassa CINAHL Cumulative index to nursing and allied health literature 1981- viitteitä yli 3000

Lisätiedot

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project

Lisätiedot

Mitä on moderni biopankkitoiminta?

Mitä on moderni biopankkitoiminta? Mitä on moderni biopankkitoiminta? LabQuality-päivät 9.2.2012 Kimmo Pitkänen kehittämispäällikkö Suomen molekyylilääketieteen instituutti FIMM FIMM - Institute for Molecular Medicine Finland 1) Mikä on

Lisätiedot

Space for work, meetings and events. Expert Services for knowledge intensive and growth oriented SME s

Space for work, meetings and events. Expert Services for knowledge intensive and growth oriented SME s Success from innovations Terttu Kinnunen OSKE Energy Technology Cluster Joensuu Science Park Ltd. Länsikatu 15 80110 Joensuu terttu.kinnunen@carelian.fi 1 Space for work, meetings and events Expert Services

Lisätiedot

3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ

3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ Puhe ja kieli, 27:4, 141 147 (2007) 3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ Soile Loukusa, Oulun yliopisto, suomen kielen, informaatiotutkimuksen ja logopedian laitos & University

Lisätiedot

Indoor Environment 2011-2015

Indoor Environment 2011-2015 Indoor Environment 2011-2015 18.4.2013 Risto Kosonen Ohjelma on investointinäkökulmasta edennyt pääosin suunnitelman mukaisesti Työpaketti Kumulatiiviset kustannukset 1.5.2011 31.8.2012 Kumulatiiviset

Lisätiedot

LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet

LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50

Lisätiedot

Lääketieteellisen fysiikan ja tekniikan yhdistys (LFTY) Finnish Society for Medical Physics and Medical Engineering

Lääketieteellisen fysiikan ja tekniikan yhdistys (LFTY) Finnish Society for Medical Physics and Medical Engineering Sivu 1/5 1) LFTY järjestämässä teemasessioita EMBEC2011 konferenssiin 2) Professori, terveydenhuollon tietotekniikka Professori, terveydenhuollon tietotekniikka 3) Early stage researcher positions in scientific

Lisätiedot

Windows Phone. Module Descriptions. Opiframe Oy puh. +358 44 7220800 eero.huusko@opiframe.com. 02600 Espoo

Windows Phone. Module Descriptions. Opiframe Oy puh. +358 44 7220800 eero.huusko@opiframe.com. 02600 Espoo Windows Phone Module Descriptions Mikä on RekryKoulutus? Harvassa ovat ne työnantajat, jotka löytävät juuri heidän alansa hallitsevat ammatti-ihmiset valmiina. Fiksuinta on tunnustaa tosiasiat ja hankkia

Lisätiedot

SIMULINK S-funktiot. SIMULINK S-funktiot

SIMULINK S-funktiot. SIMULINK S-funktiot S-funktio on ohjelmointikielellä (Matlab, C, Fortran) laadittu oma algoritmi tai dynaamisen järjestelmän kuvaus, jota voidaan käyttää Simulink-malleissa kuin mitä tahansa valmista lohkoa. S-funktion rakenne

Lisätiedot

Keskijännitekojeistot. Medium Voltage Power Distribution Equipment

Keskijännitekojeistot. Medium Voltage Power Distribution Equipment Keskijännitekojeistot Medium Voltage Power Distribution Equipment Avaimet menestykseen Satmatic Oy on yksi Suomen johtavista sähkö- ja automaatiotekniikan rakentajista lähes 30 vuoden kokemuksella. Ulvilassa

Lisätiedot

Miten biopankkitoiminta vaikuttaa patologian osastoissa

Miten biopankkitoiminta vaikuttaa patologian osastoissa Miten biopankkitoiminta vaikuttaa patologian osastoissa Markku Kallajoki TYKS-SAPA/patologia ja Auria Biopankki Labquality days 6.2. 2015 Sisältö Motivointi Biopankkilaki Tuorenäytekeräys Arkistotoimi

Lisätiedot

ETIIKKASEMINAARI 18.11.2015. Rahoitushauissa huomioitavaa

ETIIKKASEMINAARI 18.11.2015. Rahoitushauissa huomioitavaa ETIIKKASEMINAARI 18.11.2015 Rahoitushauissa huomioitavaa Tutkimuksen eettisten kysymysten luonteen yhteensopivuus rahoittajien edellyttämän tarkkuuden ja muodon kanssa? Tutkimuksen eettisiä kysymyksiä

Lisätiedot

JA CHALLENGE 18.-19.4.2013. Anna-Mari Sopenlehto Central Administration The City Development Group Business Developement and Competence

JA CHALLENGE 18.-19.4.2013. Anna-Mari Sopenlehto Central Administration The City Development Group Business Developement and Competence JA CHALLENGE 18.-19.4.2013 Anna-Mari Sopenlehto Central Administration The City Development Group Business Developement and Competence 12.11.2014 Challenges of the City of Turku What kind of city you would

Lisätiedot

Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat

Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät

Lisätiedot

Työsuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016. Peter Michelsson Wallstreet Asset Management Oy

Työsuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016. Peter Michelsson Wallstreet Asset Management Oy Työsuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016 Peter Michelsson Wallstreet Asset Management Oy Wallstreet lyhyesti Perustettu vuonna 2006, SiPa toimilupa myönnetty 3/2014 Täysin kotimainen,

Lisätiedot

ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana

ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä

Lisätiedot

I have seen teachers change teaching methods a little, a little more, and a lot. Erasmus-intensiivikurssien vaikuttavuus koordinaattoreiden silmin

I have seen teachers change teaching methods a little, a little more, and a lot. Erasmus-intensiivikurssien vaikuttavuus koordinaattoreiden silmin I have seen teachers change teaching methods a little, a little more, and a lot. Erasmus-intensiivikurssien vaikuttavuus koordinaattoreiden silmin 29.9.2011 Ulla Tissari Taustaa Euroopan laajuinen kysely,

Lisätiedot

Biopankkitoiminta Suomessa. Dos. Heli Salminen

Biopankkitoiminta Suomessa. Dos. Heli Salminen Biopankkitoiminta Suomessa Dos. Heli Salminen Suomalaisten sairaalabiopankkien erityispiirteet ja mahdollisuudet Miten biopankit vastaavat terveydenhuollon haasteisiin Perustuslaki Biopankkilaki Henkilötietolaki

Lisätiedot

7. Product-line architectures

7. Product-line architectures 7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software

Lisätiedot

Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa?

Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa? Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa? Kerro meille datastasi työpaja 10.4.2013 Antti Auer Tietohallintopäällikkö Jyväskylän yliopisto Strateginen kehittäminen Johtamista, tutkimushallintoa

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

Rekisteriseloste. Rekisterinpitäjä. Yhteyshenkilö rekisteriä koskevissa asioissa. Rekisterin nimi. Henkilötietojen käsittelyn tarkoitus

Rekisteriseloste. Rekisterinpitäjä. Yhteyshenkilö rekisteriä koskevissa asioissa. Rekisterin nimi. Henkilötietojen käsittelyn tarkoitus Rekisteriseloste Henkilötietolaki (523/1999) 10. Rekisterinpitäjä Anders Manager Oy Aurakatu 12 B 20100 Turku Y-tunnus: 1024785-9 Yhteyshenkilö rekisteriä koskevissa asioissa Matias Mäenpää +358 (0)45

Lisätiedot

Tässä ohjeessa käydään läpi sosiaalisen median verkkopalveluiden lisätoimintojen lisääminen verkkosivuillesi.

Tässä ohjeessa käydään läpi sosiaalisen median verkkopalveluiden lisätoimintojen lisääminen verkkosivuillesi. SOSIAALINEN MEDIA Tässä ohjeessa käydään läpi sosiaalisen median verkkopalveluiden lisätoimintojen lisääminen verkkosivuillesi. FACEBOOK Facebook mahdollistaa useiden erilaisten Social plugins -toimintojen

Lisätiedot

Suomen molekyylilääketieteen instituutti (FIMM)

Suomen molekyylilääketieteen instituutti (FIMM) FIMM - Institute for Molecular Medicine Finland Suomen molekyylilääketieteen instituutti (FIMM) Teknologia Tutkimus Terveys Biopankkilaki voimaan uudet biopankit käynnistymässä Kimmo Pitkänen Kehittämispäällikkö

Lisätiedot

Ostamisen muutos muutti myynnin. Technopolis Business Breakfast 21.8.2014

Ostamisen muutos muutti myynnin. Technopolis Business Breakfast 21.8.2014 Ostamisen muutos muutti myynnin Technopolis Business Breakfast 21.8.2014 Taking Sales to a Higher Level Mercuri International on maailman suurin myynnin konsultointiyritys. Autamme asiakkaitamme parantamaan

Lisätiedot

A new model of regional development work in habilitation of children - Good habilitation in functional networks

A new model of regional development work in habilitation of children - Good habilitation in functional networks A new model of regional development work in habilitation of children - Good habilitation in functional networks Salla Sipari, PhD, Principal Lecturer Helena Launiainen, M.Ed, Manager Helsinki Metropolia

Lisätiedot

The spectroscopic imaging of skin disorders

The spectroscopic imaging of skin disorders Automation technology October 2007 University of Vaasa / Faculty of technology 1000 students 4 departments: Mathematics and statistics, Electrical engineerin and automation, Computer science and Production

Lisätiedot

Guidebook for Multicultural TUT Users

Guidebook for Multicultural TUT Users 1 Guidebook for Multicultural TUT Users WORKPLACE PIRKANMAA-hankkeen KESKUSTELUTILAISUUS 16.12.2010 Hyvää käytäntöä kehittämässä - vuorovaikutusopas kansainvälisille opiskelijoille TTY Teknis-taloudellinen

Lisätiedot

Lakimies PDF. ==>Download: Lakimies PDF ebook

Lakimies PDF. ==>Download: Lakimies PDF ebook Lakimies PDF ==>Download: Lakimies PDF ebook Lakimies PDF - Are you searching for Lakimies Books? Now, you will be happy that at this time Lakimies PDF is available at our online library. With our complete

Lisätiedot

812336A C++ -kielen perusteet, 21.8.2010

812336A C++ -kielen perusteet, 21.8.2010 812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys

Lisätiedot

Use of spatial data in the new production environment and in a data warehouse

Use of spatial data in the new production environment and in a data warehouse Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population

Lisätiedot

Yritysyhteistyö Turun yliopistossa Turku 3.5.2011 Harri Lönnberg

Yritysyhteistyö Turun yliopistossa Turku 3.5.2011 Harri Lönnberg Yritysyhteistyö Turun yliopistossa Turku 3.5.2011 Harri Lönnberg Toiminta-ajatus Kansainvälisesti kilpailukykyinen tutkimusyliopisto Tavoitetila vuosille 2010-2012 Kansainvälisesti arvostettu valitsemillaan

Lisätiedot

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS:n haasteet diagnostiikassa 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly

Lisätiedot

Rekisteröiminen - FAQ

Rekisteröiminen - FAQ Rekisteröiminen - FAQ Miten Akun/laturin rekisteröiminen tehdään Akun/laturin rekisteröiminen tapahtuu samalla tavalla kuin nykyinen takuurekisteröityminen koneille. Nykyistä tietokantaa on muokattu niin,

Lisätiedot

The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region

The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region The BaltCICA Project is designed to focus on the most imminent problems that climate change is likely to cause

Lisätiedot

Ajankohtaista dopingaineista ja testeistä 2013

Ajankohtaista dopingaineista ja testeistä 2013 Liikuntalääketieteen päivät 7.11.2013 Ajankohtaista dopingaineista ja testeistä 2013 Timo Seppälä LKT, Farmakologian dosentti ADT:n lääketieteellinen johtaja 1) Testosteronista a) Yksilölliset (geneettiset)

Lisätiedot

TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015

TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti

Lisätiedot

Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO

Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO Tomi Kauppinen, Eero Hyvönen, Jari Väätäinen Semantic Computing Research Group (SeCo) http://www.seco.tkk.fi/

Lisätiedot

Data Quality Master Data Management

Data Quality Master Data Management Data Quality Master Data Management TDWI Finland, 28.1.2011 Johdanto: Petri Hakanen Agenda 08.30-09.00 Coffee 09.00-09.30 Welcome by IBM! Introduction by TDWI 09.30-10.30 Dario Bezzina: The Data Quality

Lisätiedot

Johdatus tutkimustyöhön -luento: Kirjallisuuskatsaus. Arto Lanamäki, 2015 arto.lanamaki@oulu.fi

Johdatus tutkimustyöhön -luento: Kirjallisuuskatsaus. Arto Lanamäki, 2015 arto.lanamaki@oulu.fi + Johdatus tutkimustyöhön -luento: Kirjallisuuskatsaus Arto Lanamäki, 2015 arto.lanamaki@oulu.fi + Osa 1: Tarina yhdestä pitkästä kirjallisuuskatsausprojektista + Miten tämä artikkeli syntyi? Artikkeli

Lisätiedot

The role of 3dr sector in rural -community based- tourism - potentials, challenges

The role of 3dr sector in rural -community based- tourism - potentials, challenges The role of 3dr sector in rural -community based- tourism - potentials, challenges Lappeenranta, 5th September 2014 Contents of the presentation 1. SEPRA what is it and why does it exist? 2. Experiences

Lisätiedot

Kilpailukyky, johtaminen ja uusi tietotekniikka. Mika Okkola, liiketoimintajohtaja, Microsoft Oy

Kilpailukyky, johtaminen ja uusi tietotekniikka. Mika Okkola, liiketoimintajohtaja, Microsoft Oy Kilpailukyky, johtaminen ja uusi tietotekniikka Mika Okkola, liiketoimintajohtaja, Microsoft Oy k Agenda Kansallinen kilpailukyky: Tietoalojen kasvu ja kilpailukyky Liiketoiminnan odotukset tietohallinnolle:

Lisätiedot

Suopeuden ainekset. Dos. Ilpo Helén Biomedicine in Society (BitS) Department of Social Reseach

Suopeuden ainekset. Dos. Ilpo Helén Biomedicine in Society (BitS) Department of Social Reseach Biomedicine in Society (BitS) Department of Social Reseach Suopeuden ainekset 17.10.2013 1 Suomalaiset ovat suopeita biopankeille Pohjoismainen erityispiirre Mitä suopeus sisältää? Moninaiset yleisöt Laaja

Lisätiedot

3i Innova*ve Induc*on Ini*a*ve Fixing the broken heart Heikki Ruskoaho Farmakologian ja lääkehoidon osasto Farmasian *edekunta

3i Innova*ve Induc*on Ini*a*ve Fixing the broken heart Heikki Ruskoaho Farmakologian ja lääkehoidon osasto Farmasian *edekunta 3i Innova*ve Induc*on Ini*a*ve Fixing the broken heart Heikki Ruskoaho Farmakologian ja lääkehoidon osasto Farmasian *edekunta www.helsinki.fi/yliopisto 1 Sydänlihasvaurion yleisin syy on sydäninfark*

Lisätiedot

SQL SERVER 2012 PARALLEL DATA WAREHOUSE APPLIANCE

SQL SERVER 2012 PARALLEL DATA WAREHOUSE APPLIANCE SQL SERVER 2012 PARALLEL DATA WAREHOUSE APPLIANCE Toukokuu, 2013 Pekka Pykäläinen Tuote- ja ratkaisupäällikkö Application Platform Microsoft HYÖDYNNÄ KAIKKI KÄYTETTÄVISSÄ OLEVA TIETO NEW WORLD OF DATA

Lisätiedot

Rakennettu ympäristö. Kiinteistötalous TkT Juhana Hiironen

Rakennettu ympäristö. Kiinteistötalous TkT Juhana Hiironen Rakennettu ympäristö Kiinteistötalous TkT Juhana Hiironen Kiinteistö on oikeuksien, rajoitusten ja velvollisuuksien muodostama alueellisesti rajattu kokonaisuus Reaalitalouden yksikkö Maankäytön yksikkö

Lisätiedot

Hankkeen toiminnot työsuunnitelman laatiminen

Hankkeen toiminnot työsuunnitelman laatiminen Hankkeen toiminnot työsuunnitelman laatiminen Hanketyöpaja LLP-ohjelman keskitettyjä hankkeita (Leonardo & Poikittaisohjelma) valmisteleville11.11.2011 Työsuunnitelma Vastaa kysymykseen mitä projektissa

Lisätiedot

HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism

HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism Final SmPC and PL wording agreed by PhVWP December 2011 SUMMARY OF PRODUCT CHARACTERISTICS New Class Warnings

Lisätiedot

PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING

PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING Veijalainen O, Kares S, Kujala P, Vuento R, TirKkonen M, Kholová I, Osuala V, Mäenpää J University and University Hospital of Tampere, Finland,

Lisätiedot

Mitä mahdollisuuksia tuloksemme tarjoavat museoille?

Mitä mahdollisuuksia tuloksemme tarjoavat museoille? Mitä mahdollisuuksia tuloksemme tarjoavat museoille? Prof. Eero Hyvönen Helsinki Institute for Information Technology HIIT University of Helsinki, Dept. of Computer Science Semantic Computing Research

Lisätiedot

LUONNOS RT 80260 EN AGREEMENT ON BUILDING WORKS 1 THE PARTIES. May 1998 1 (10)

LUONNOS RT 80260 EN AGREEMENT ON BUILDING WORKS 1 THE PARTIES. May 1998 1 (10) RT 80260 EN May 1998 1 (10) AGREEMENT ON BUILDING WORKS This agreement template is based on the General Terms and Conditions of Building Contracts YSE 1998 RT 16-10660, LVI 03-10277, Ratu 417-7, KH X4-00241.

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri

Lisätiedot

Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE

Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE November 7, 2014 Paula Kilpinen 1 7.11.2014 Aalto University

Lisätiedot

Visualisoinnin aamu 16.4 Tiedon visualisointi. Ari Suominen Tuote- ja ratkaisupäällikkö Microsoft

Visualisoinnin aamu 16.4 Tiedon visualisointi. Ari Suominen Tuote- ja ratkaisupäällikkö Microsoft Visualisoinnin aamu 16.4 Tiedon visualisointi Ari Suominen Tuote- ja ratkaisupäällikkö Microsoft 1 Visualisoinnin aamu 8:00 Ilmoittautuminen ja aamukahvi 8:45 Tiedon visualisointi Ari Suominen, Tuote-

Lisätiedot

Tervetuloa bussimatkalle, jonka avainsanoja. Welcome on board! We hope you enjoy your

Tervetuloa bussimatkalle, jonka avainsanoja. Welcome on board! We hope you enjoy your www.vent Tervetuloa bussimatkalle, jonka avainsanoja ovat asiakaslähtöisyys ja laadukkuus. Vuonna 1928 startannut, jo kolmannen polven perheyritys, Ventoniemi Oy on liikenteen moniosaaja. Tilausajomme

Lisätiedot

EBM ja laboratorio. Kristina Hotakainen HY ja HUSLAB

EBM ja laboratorio. Kristina Hotakainen HY ja HUSLAB EBM ja laboratorio Kristina Hotakainen HY ja HUSLAB EBLM Arvioidaan laboratoriokokeiden vaikutuksia kliiniseen päätöksentekoon ja potilaan hoitotuloksiin mm. kliinistä epidemiologiaa, tilastotiedettä,

Lisätiedot

SCIENTIX - LUMA-opettajien. uusia ideoita opetukseen. M ij P ll i. Maija Pollari LUMA-keskus Suomi MAOL-kevätkoulutuspäivä 18.4.

SCIENTIX - LUMA-opettajien. uusia ideoita opetukseen. M ij P ll i. Maija Pollari LUMA-keskus Suomi MAOL-kevätkoulutuspäivä 18.4. SCIENTIX - LUMA-opettajien verkkoportaalista t uusia ideoita opetukseen M ij P ll i Maija Pollari LUMA-keskus Suomi MAOL-kevätkoulutuspäivä 18.4.2015 Mitä ajatuksia herättävät nämä yhdistelmät: Opettaja

Lisätiedot

Näyttelyhaku. Näyttelyhaku on kahdesti vuodessa, 28.2. ja 30.9.

Näyttelyhaku. Näyttelyhaku on kahdesti vuodessa, 28.2. ja 30.9. Näyttelyhaku Napa Galleria esittelee nuorta kotimaista nykytaidetta laajasti; kuvituksesta valokuvaan, maalauksesta graffitiin. Napa kannustaa näyttelyhakijoita gallerian tilallisiin sekä toiminnallisiin

Lisätiedot

Helsinki Region Infoshare 2013

Helsinki Region Infoshare 2013 Helsinki Region Infoshare 2013 Apps4Finland 2012 Ville Meloni & Petri Kola Forum Virium Helsinki 1 Suomalainen tietoyhteiskunta 2012? Tietoyhteiskunnan kehittäminen Kansalaiset vaativat avoimuutta Rohkeita

Lisätiedot

Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi

Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi Green Cities and Settlements 18.2.2014 Ville Manninen Writers Project group Sirpa Korhonen, Anna Mari

Lisätiedot

Sosiaalisen median liiketoimintamallit ja käyttöön oton suunnitelma 9/23/2012

Sosiaalisen median liiketoimintamallit ja käyttöön oton suunnitelma 9/23/2012 Sosiaalisen median liiketoimintamallit ja käyttöön oton suunnitelma 9/23/2012 Liiketoimintamalli: taustaa (R. Jaikumar ja Barettan autotehdas) Tuottavuuden jatkuva parantaminen on mahdollista vain toteuttamalla

Lisätiedot

FPGA-piirien käyttökohteet nyt ja tulevaisuudessa Tomi Norolampi

FPGA-piirien käyttökohteet nyt ja tulevaisuudessa Tomi Norolampi FPGA-piirien käyttökohteet nyt ja tulevaisuudessa Tomi Norolampi ESITYKSEN SISÄLTÖ Flexibilis Oy lyhyesti FPGA FPGA-teknologian nykytilanne ja tulevaisuus Kaupallinen näkökulma Uudelleenkonfiguroinnin

Lisätiedot

UX NÄKÖKULMA - KONECRANES

UX NÄKÖKULMA - KONECRANES UX NÄKÖKULMA - KONECRANES Johannes Tarkiainen Industrial Design Manager KONECRANES NUMEROINA LAITTEET TOIMINTOJA LÄHES 60 % 11 800 TYÖNTEKIJÄÄ 600 TOIMIPISTETTÄ ERI PUOLILLA MAAILMAA 50 MAASSA LIIKEVAIHDOSTA

Lisätiedot

Verkkokauppatilasto 2014. Perustietoa verkkokauppaseurannasta sekä verkko-ostaminen 2014/H1

Verkkokauppatilasto 2014. Perustietoa verkkokauppaseurannasta sekä verkko-ostaminen 2014/H1 Verkkokauppatilasto 2014 Perustietoa verkkokauppaseurannasta sekä verkko-ostaminen 2014/H1 Verkkokauppatilasto Suomalaisen verkkokaupan arvo Verkkokauppatilasto sisältää kaiken verkkokauppaostamisen Kaikki

Lisätiedot

BIOPANKKI YLIOPISTOSAIRAALASSA Matka suunnitelmasta kansainväliseksi keulakuvaksi

BIOPANKKI YLIOPISTOSAIRAALASSA Matka suunnitelmasta kansainväliseksi keulakuvaksi BIOPANKKI YLIOPISTOSAIRAALASSA Matka suunnitelmasta kansainväliseksi keulakuvaksi Beyond Biobanking Towards Digital Phenotyping Samu Kurki, erikoistutkija; TY 40%, VSSHP 60% Lila Kallio, projektipäällikkö;

Lisätiedot

==>Download: Lakimies PDF ebook By Allan Särkilahti

==>Download: Lakimies PDF ebook By Allan Särkilahti Lakimies PDF ==>Download: Lakimies PDF ebook By Allan Särkilahti Lakimies PDF By Allan Särkilahti - Are you searching for Lakimies pdf Books? Now, you will be happy that Lakimies PDF is available at our

Lisätiedot

4x4cup Rastikuvien tulkinta

4x4cup Rastikuvien tulkinta 4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,

Lisätiedot

Structure of Service Production in Central Finland

Structure of Service Production in Central Finland Structure of Service Production in Central Finland Martti Ahokas Regional Council of Central Finland Introduction Traditionally services in Finland produced by over 400 municipalities The service production

Lisätiedot

Sähköjärjestelmän käyttövarmuus & teknologia Käyttövarmuuspäivä 25.11.2014

Sähköjärjestelmän käyttövarmuus & teknologia Käyttövarmuuspäivä 25.11.2014 Sähköjärjestelmän käyttövarmuus & teknologia Käyttövarmuuspäivä 25.11.2014 Jarmo Partanen, professori, Lappeenrannan yliopisto jarmo.partanen@lut.fi +358 40 5066 564 Electricity Market, targets Competitive

Lisätiedot

Research plan for masters thesis in forest sciences. The PELLETime 2009 Symposium Mervi Juntunen

Research plan for masters thesis in forest sciences. The PELLETime 2009 Symposium Mervi Juntunen Modelling tree and stand characteristics and estimating biomass removals and harvesting costs of lodgepole pine (Pinus contorta) plantations in Iceland Research plan for masters thesis in forest sciences

Lisätiedot

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...

Lisätiedot

Mineral raw materials Public R&D&I funding in Finland and Europe, 2015. Kari Keskinen

Mineral raw materials Public R&D&I funding in Finland and Europe, 2015. Kari Keskinen Mineral raw materials Public R&D&I funding in Finland and Europe, 2015 Kari Keskinen DM1369699 DM1369699 Green Mining (2011-2016) 81 projects started (39 company projects and 42 research projects) 117

Lisätiedot

Ammattiasut Industrial Workwear

Ammattiasut Industrial Workwear Ammattiasut Industrial Workwear ESD- ja puhdastilavaatteet ESD and cleanroom clothing Täyden palvelun puhdastilavaatehuolto Tarjoamme yrityksellenne täyden palvelun puhdastilavaatehuollon. Myymme, vuokraamme,

Lisätiedot

Requirements for Modelling Bicycle Traffic A project funded by Ministry of Transportation and Telecommunications (Finland)

Requirements for Modelling Bicycle Traffic A project funded by Ministry of Transportation and Telecommunications (Finland) Requirements for Modelling Bicycle Traffic A project funded by Ministry of Transportation and Telecommunications (Finland) Jukka Räsänen, Tuuli Järvi-Nykänen (Technical Research Centre of Finland) Jukka-Matti

Lisätiedot