Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä

Save this PDF as:
 WORD  PNG  TXT  JPG

Koko: px
Aloita esitys sivulta:

Download "Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä"

Transkriptio

1 Ekologiset ympäristöongelmat 10. Geeniteknologia

2 Dna:n ja rna:n käsittely Eristäminen Puhdistaminen Lähetti-rna:t voidaan muuntaa niiden emäsjärjestystä vastaavaksi ns. komplementaariseksi dna:ksi (c-dna)

3 Dna:n muokkaaminen Katkaisuentsyymit Bakteerien luontainen puolustuskeino Pilkkovat dna:n halutusta kohdasta Liittäjäentsyymit Liittää katkaistut juosteet yhteen Yhdistää myös eri alkuperää olevaa dna:ta

4 Dna:n ja rna:n tutkimusmenetelmiä PCR = dnan monistaminen Alukkeet, nukleotideja, dna-polymeraasia Hyödynnetään mm. dna:n emäsjärjestyksen selvittämisessä eli sekvensoinnissa ja yksilöiden tunnistuksessa

5 Dna:n ja rna:n tutkimusmenetelmiä Elektroforeesi Käytetään erimittaisten dna- ja rna-palasten havaitsemiseen Geenin dna:n erojen tutkiminen Sekvensoinnin väline Dna:n hybridisaatio Dna:n juosteiden irrottaminen toisistaan kuumentamalla Koetin: Merkitään leimaamalla fluoresoivalla väriaineella tai radioaktiivisella merkillä Koetin ja tutkittava kohde pariutuvat keskenään

6

7

8

9

10 Dna:n ja rna:n tutkimusmenetelmiä Sekvensointi Dna:n emäsjärjestyksen selvittäminen PCR, mukana värileimattuja nukleotideja, jotka päättävät reaktion Dna-pätkät erotellaan pituusjärjestykseen elektroforeesissa

11

12 Geenien toiminnan tutkiminen Dna-siru lasista tai muovista valmistettu pieni levy, johon on kiinnitetty DNA-palasia Voidaan tutkia ympäristötekijöiden, ravintoaineiden tai lääkehoitojen vaikutusta geenien toimintaan Voidaan havaita yksilöiden välisiä eroja dna:n emäsjärjestyksessä

13 DNA-siru: käytännön sovellutukset Mitkä geenit ilmenevät tietyissä soluissa tai kudoksessa? Diagnostiikka: Hyvänlaatuinen vs pahanlaatuinen syöpä Terve vs sairas Lääkkeiden tai hoitojen vaikutus Ei hoidettu vs hoidettu Lääkevaste vs ei vastetta Perustutkimus Kehitysbiologia esim. alkion kehitys, kudoksen tai solujen erilaistuminen

14 Mikrosirut Yleistä Mitä mikrosirut ovat? Alusta (muovi, pii, kvartsi, lasi tms), johon kiinnitetty tutkittavaksi ja tunnistettavaksi jopa satoja tuhansia tai miljoonia DNA-paloja (tai esim. proteiineja, soluja, kudosta, vasta-aineita, sirna:ta).

15 cdna sirut Sirujen design ja valmistus cdna klooni kirjasto Kloonien monistus ja puhdistus Koettimien spottaus alustaan Valmis cdna siru -koettimet >200 nt Custom Agilent

16 CLID NAME N15 N6dd* N7(2) N13 N10 N9 S 36 N 100 N2(A) N11 N3 N5cc N1aa N4bb N12 IMAGE: STXBP6 syn IMAGE:49227 STXBP6 syn IMAGE: STXBP6 syntaxin binding protein 6 (am IMAGE:51783 FLJ22283 h IMAGE: PCOLCE2 p IMAGE: Homo sapie IMAGE: A2LP ataxin IMAGE: Homo sapie IMAGE: ESTs Hs IMAGE: KIAA0471 K IMAGE: LOC IMAGE: ESTs Hs IMAGE: ESTs, Weak IMAGE: PNUTL1 pea IMAGE: Homo sapie IMAGE: NLK nemo-like kinase IMAGE: CRELD1 cys IMAGE: DECR2 2, IMAGE: Homo sapie IMAGE: LOC IMAGE: NME3 non IMAGE: EGR1 early IMAGE: DCT **dop IMAGE: TBC1D4 TB IMAGE:68818 PP3856 sim IMAGE: ITPR3 inosi IMAGE: NSD1 nucle IMAGE: RABL4 RAB IMAGE: AI IMAGE:34966 ESTs Hs IMAGE:51015 Homo sapie IMAGE:33028 LOC IMAGE: LPXN leupa IMAGE: AI IMAGE: **ESTs H *mitoch. cont. IMAG *mitoch. co *mitoch. cont. IMAG *mitoch. co *mitoch. cont. IMAG *mitoch. co IMAGE: ESTs Hs *mitoch. cont. IMAG *mitoch. cont *mitoch. cont. IMAG *mitoch. co *mitoch. cont. IMAG *mitoch. co IMAGE: EST Hs IMAGE: ERK8 extra IMAGE: FLJ12428 h IMAGE: NPY1R neu IMAGE: GFRA1 GDN IMAGE: Homo sapie IMAGE: TRPS1 trich IMAGE: TRPS1 trich IMAGE: FLJ22269 h IMAGE: IF **I factor (complement) Hs IMAGE: HT021 HT IMAGE: ESTs, Weak IMAGE: TMEPAI tra IMAGE: TMEPAI tra IMAGE: TMEPAI tra IMAGE: FLJ21144 h IMAGE: LOC IMAGE:35807 R IMAGE: KCNS3 pota IMAGE: PPARGC1 p IMAGE: ESTs, Weakly similar to PRO0478 prote IMAGE: C14orf58 chromosome IMAGE: REC8 Rec8p IMAGE: DDX17 DEA IMAGE: ACINUS ap IMAGE: KIAA1273 K IMAGE: TRN2 karyo IMAGE: FLJ14525 h IMAGE: WDR22 WD IMAGE: WDR22 WD WDR22 WD IMAGE: HIST1H2AM IMAGE: HIST1H2AC IMAGE: HIST2H2AA IMAGE: LOC IMAGE: SEPT3 sept IMAGE: ESTs, Weak IMAGE: Homo sapie IMAGE: Homo sapie IMAGE: ESTs Hs IMAGE: SMARCA2 S IMAGE: MLL3 myelo IMAGE: CYP19 cyto IMAGE: ESTs Hs IMAGE: ESTs, Weak IMAGE: FLJ20591 e IMAGE:32146 ESTs Hs IMAGE:24918 PIP5K1B ph IMAGE: GLUL gluta IMAGE: RANBP2L cdna sirut Geeniekspressio analyysi Experimental procedure Patient A Patient B Gene 1: B > A Gene 2: B < A Gene 3: B = A Gene 4: absent Bioinformatics Cy5 Cy3

17

18 Geeninsiirto GMO = muuntogeeninen eliö Siirtogeeninen eliö: siirretty uuden ominaisuuden aiheuttava geeni Poistogeeninen eliö: eliöön siirretty geenirakenne, joka estää eliön oman geenin toiminnan

19 BI5 III Biotekniikan sovelluksia 6.Geeninsiirrolla tuotetaan uudenlaisia eliöitä

20 BI5 III Biotekniikan sovelluksia 6.Geeninsiirrolla tuotetaan uudenlaisia eliöitä

21 BI5 III Biotekniikan sovelluksia 6.Geeninsiirrolla tuotetaan uudenlaisia eliöitä

22 Eläinkokeet Eläinkokeiden tekemiseen vaaditaan aina lupa, jonka myöntää valtakunnallinen eläinkoelautakunta (ELLA) 3R-periaate: Korvaaminen (Replacement): Jos eläinkokeelle on olemassa luotettava vaihtoehto, sitä on käytettävä eläinkokeen sijasta. Vähentäminen (Reduction): Eläinkokeissa tulee käyttää niin vähän eläimiä kuin mahdollista. Parantaminen (Refinement): Eläimille aiheutuva kärsimys ja muut haitat on pidettävä mahdollisimman pienenä. Eläinkokeissa käytetään usein mallieliöitä, joiden toiminta tunnetaan muita eliöitä tarkemmin. Mallieliöitä käyttämällä voidaan tehdä johtopäätöksiä myös eliölle läheistä sukua olevista lajeista. (esim. hiiri ihminen) BI5 III Biotekniikan sovelluksia 6.Geeninsiirrolla tuotetaan uudenlaisia eliöitä

23 Geenin kloonaus = geenin eristäminen, liittäminen vektoriin ja lisääminen kasvatussolussa Vektori on dna:n tai geenin siirtotyökalu esim. bakteerin tai hiivan plasmidi BI5 III Biotekniikan sovelluksia 6.Geeninsiirrolla tuotetaan uudenlaisia eliöitä

24 Dna- ja geenikirjastot Dna-kirjasto = dna-jaksojen kokoelma Genominen kirjasto: sisältää dna-jaksot, jotka on liitetty vektoreihin. Vektorit on siirretty isäntäsoluihin. C-dna eli geenikirjasto: lähetti-rna:t, jotka muutettu c-dna:ksi ja tallennettu vektoreihin.

25 Geeninsiirtomenetelmiä Transformaatio Plasmidien siirto bakteerisoluun Bakteerit ottavat itse sisäänsä vapaan dna:n liuoksesta Geeninsiirto kasvisoluun Agrobakteerin Ti-plasmidin avulla Geenipyssy Yksisirkkaiset kasvit Sähköimpulssit Kemiallinen käsittely

26 Geeninsiirtomenetelmiä Geenin siirto eläinsoluun Mikroinjektio Siirtogeenin tai vektorissa (usein virusvektori) olevan dna:n ruiskutus munasoluun Siirto alkion kantasolujen viljelmään

27 Käytännön sovelluksia

28 Siirtogeeniset valkuaisainetehtaat Valkuaisaineiden tuotto muuntogeenisissä eläimissä ja kasveissa Kasveilla valkuaisaineentuotanto kaikissa solukoissa Eläimillä juuri tietyssä kudoksessa

29 Siirtogeeniset valkuaisainetehtaat

30 Kloonaus Klooni on saman perimän omaavien eliöiden tai solujen joukko luonnollinen tapa: identtiset kaksoset tai perunan mukulat osittain keinotekoinen tapa: alkioiden halkaisu tai solukkoviljely keinotekoinen tapa: tumansiirto, haploidiajalostus tehdään arvokkaiden yksilöiden lisäämiseksi ja yhtenäisen tuotannon saavuttamiseksi

31 Terapeuttinen kloonaus = alkiosta otetaan soluja kasvatetaan kantasoluja kudoksia Reproduktiivinen kloonaus = tumansiirto, sijaiskohtu

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa

Lisätiedot

Geeninsiirron peruskäsitteet

Geeninsiirron peruskäsitteet Geeninsiirron peruskäsitteet GMO = muuntogeeninen eliö, eliö johon on siirretty toisen eliön perimää Käyttö: biologinen perustutkimus, maatalous (esim. tuottavammat lajikkeet), teollisuus (esim. myrkkyjen

Lisätiedot

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli

Lisätiedot

VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen

Lisätiedot

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun

Lisätiedot

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.

Lisätiedot

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi)

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) CHEM-A1310 Biotieteen perusteet Heli Viskari 2017 DNA-harjoitustöiden aikataulu, valitse yksi näistä

Lisätiedot

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...

Lisätiedot

Geneettisesti muunnellut ainekset rehuissa (ja elintarvikkeissa) Annikki Welling Kemian laboratoriopalvelut Evira

Geneettisesti muunnellut ainekset rehuissa (ja elintarvikkeissa) Annikki Welling Kemian laboratoriopalvelut Evira Geneettisesti muunnellut ainekset rehuissa (ja elintarvikkeissa) Annikki Welling Kemian laboratoriopalvelut Evira Sisältö Keskeinen GM lainsäädäntö ja sen sisältö Markkinoilla olevat GM raaka-aineet Tulevaisuuden

Lisätiedot

Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa

Lisätiedot

b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina.

b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina. Bi5 kertaustehtäviä, mallivastauksia 1. Selosta lyhyesti, missä sijaitsevat seuraavat solun osat: a) tumajyvänen b) keskusjyvänen (sentrioli, sentrosomi), c) soluneste, d) mitokondrio, e) solulimakalvosto

Lisätiedot

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus:

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus: Esseekysymyksistä 1 ja 2 voi saada enintään 5 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 4 pistettä. Lisäksi vastaaja saa enintään yhden pisteen, mikäli

Lisätiedot

Avainsanat: BI5 III Biotekniikan sovelluksia 7.Kasvin- ja eläinjalostuksella tehostetaan ravinnontuotantoa.

Avainsanat: BI5 III Biotekniikan sovelluksia 7.Kasvin- ja eläinjalostuksella tehostetaan ravinnontuotantoa. Avainsanat: kasvinjalostus eläinjalostus lajike risteytysjalostus itsepölytteinen ristipölytteinen puhdas linja heteroosi hybridilajike ylläpitojalostus geneettinen eroosio autopolyploidia allopolyploidia

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen

Lisätiedot

Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia

Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Genomi-ilmentyminen Genom expression (uttryckning) DNA RNA 7.12.2017 Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Osaamistavoitteet Lärandemål Luennon jälkeen ymmärrät pääperiaatteet

Lisätiedot

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu

Lisätiedot

Genetiikan perusteiden harjoitustyöt

Genetiikan perusteiden harjoitustyöt Genetiikan perusteiden harjoitustyöt Molekyylien kloonaus ja siihen liittyvät taidot ja temput, osa 1 Restriktioentsyymit, elektroforeesi Moniste sivulta 24-: Geenien kloonaus CELL 491- Isolating, cloning,

Lisätiedot

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat

Lisätiedot

Biologia ylioppilaskoe

Biologia ylioppilaskoe Biologia ylioppilaskoe 12 tehtävää, joista kahdeksaan (8) vastataan Tehtävät vaikeutuvat loppua kohden, jokeritehtävät merkitty +:lla Molempiin jokereihin saa vastata ja ne lasketaan mukaan kahdeksaan

Lisätiedot

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio:

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio: -mesenkyymi-vuorovaikutukset, esimerkkinä hammas ja ihokarva elimiä muodostuu kaikista alkiokerroksista, usein epiteelin ja mesenkyymin vuorovaikutuksesta epiteeli ektodermi kumpi aloittaa elimen kehityksen:

Lisätiedot

GMO-tietopaketti. Kasvinjalostuksen menetelmiä

GMO-tietopaketti. Kasvinjalostuksen menetelmiä GMO-tietopaketti Markku Keinänen Itä-Suomen yliopisto Muuntogeeninen kasvintuotanto, MTK ja BTNK, Kampustalo, Seinäjoki, 13.4.2010 Kasvinjalostuksen menetelmiä Risteytys ja valinta Mutaatiojalostus Lajien

Lisätiedot

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset EU:ssa ei ole yleisesti hyväksyttyä elintarvikepetosten määritelmää. Yleinen ohjeistus löytyy elintarvikelainsäädäntöä

Lisätiedot

UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA

UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA LIITU-päivä 4.5.2006 FT Helena Rintala Kansanterveyslaitos, Ympäristöterveyden osasto Mihin sisäympäristön mikrobien mittauksia tarvitaan? Rakennusten

Lisätiedot

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93.

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93. 1 I) Ovatko väittämät oikein (O) vai väärin (V)? Jos väite on mielestäsi väärin, perustele se lyhyesti väittämän alla oleville riveille. O/V 1.2. Downin oireyhtymä johtuu pistemutaatista fenyylialaniinin

Lisätiedot

Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä

Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Reportterigeenit ja reportterikonstruktiot? Monissa tilanteissa tarvitaan ilmaisinta (proobi, luotain, reportteri) kertomaan, mitä/missä/milloin

Lisätiedot

Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

sosiaaliturvatunnus Tehtävissä tarvittavia atomipainoja: hiili 12,01; vety 1,008; happi 16,00. Toisen asteen yhtälön ratkaisukaava: ax 2 + bx + c = 0;

sosiaaliturvatunnus Tehtävissä tarvittavia atomipainoja: hiili 12,01; vety 1,008; happi 16,00. Toisen asteen yhtälön ratkaisukaava: ax 2 + bx + c = 0; Valintakoe 2012 / Biokemia Nimi sosiaaliturvatunnus Tehtävissä tarvittavia atomipainoja: hiili 12,01; vety 1,008; happi 16,00. Toisen asteen yhtälön ratkaisukaava: ax 2 + bx + c = 0; 1. Kuvassa on esitetty

Lisätiedot

Kukan kehitystä säätelevien geenien molekyylikloonaus

Kukan kehitystä säätelevien geenien molekyylikloonaus Sanna Viitanen Kukan kehitystä säätelevien geenien molekyylikloonaus Opinnäytetyö Metropolia Ammattikorkeakoulu Terveys- ja hoitoala Bioanalytiikka Opinnäytetyö 15.5.2014 Tiivistelmä Tekijä(t) Otsikko

Lisätiedot

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio

Lisätiedot

Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi

Lisätiedot

Biologian kokeellisuuteen liittyvä pienimuotoinen tutkimus tai projekti. Kurssia ei suositella itsenäisesti suoritettavaksi.

Biologian kokeellisuuteen liittyvä pienimuotoinen tutkimus tai projekti. Kurssia ei suositella itsenäisesti suoritettavaksi. Pakolliset kurssit 1. Elämä ja evoluutio (BI01) Kurssilla perehdytään elämän edellytyksiin ja kaikille eliöille tunnusomaisiin piirteisiin. Kurssilla tutustutaan myös biologian tapaan hankkia ja kuvata

Lisätiedot

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,

Lisätiedot

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä

Lisätiedot

Luennon aiheet: GM-eläimet. Geenimuunnellut hiiret. Alkioiden pakastus. Geenimuunnellut eläimet: miksi ja miten?

Luennon aiheet: GM-eläimet. Geenimuunnellut hiiret. Alkioiden pakastus. Geenimuunnellut eläimet: miksi ja miten? Luennon aiheet: GM-eläimet Koe-eläinkurssi 9.11.12 Petra Sipilä Geenimuunnellut hiiret Siirtogeeniset eläimet Poistogeeniset eläimet Alkioiden pakastus Terminologiaa Geenimuunnellut eläimet: miksi ja miten?

Lisätiedot

Kasvinjalostus 2000-luvulla

Kasvinjalostus 2000-luvulla Kasvinjalostus 2000-luvulla (Kirsi Lehto, Biotieteet ja geeniteknologia -seminaari, Turku 10.2.2001) Kasvien jalostus ennen Kasvinjalostuksella on pitkät perinteet: jo varhaiseen kasvinviljelyyn liittyi

Lisätiedot

Mikrosirut ja niiden data-analyysi

Mikrosirut ja niiden data-analyysi Mikrosirut ja niiden data-analyysi S-114.2510 Laskennallinen systeemibiologia 11. Luento: To 24.4.2008 Oppimistavoitteet Mikä on mikrosiru ja miten niitä tehdään Millaisia mikrosiruja on olemassa Kuinka

Lisätiedot

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Mitä tarkoitetaan biopolymeerilla? Mihin kolmeen ryhmään biopolymeerit voidaan jakaa? (1,5 p) Biopolymeerit ovat luonnossa esiintyviä / elävien solujen muodostamia polymeerejä / makromolekyylejä.

Lisätiedot

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 2. Solun perusrakenne

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 2. Solun perusrakenne Solun perusrakenne I Solun perusrakenne 2. Solun perusrakenne 1. Avainsanat 2. Kaikille soluille yhteiset piirteet 3. Kasvisolun rakenne 4. Eläinsolun rakenne 5. Sienisolun rakenne 6. Bakteerisolun rakenne

Lisätiedot

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla 1. Avainsanat 2. Solut lisääntyvät jakautumalla 3. Dna eli deoksiribonukleiinihappo sisältää perimän

Lisätiedot

BI4 IHMISEN BIOLOGIA

BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava

Lisätiedot

Molekyylibiologian perusmenetelmät

Molekyylibiologian perusmenetelmät 2 3 Molekyylibiologian perusmenetelmät 740151P Biokemian menetelmät I 26.9.2017 Juha Kerätär / BMTK Päivän aiheet Mitä on molekyylibiologia? Mitä ovat keskeiset molekyylibiologian menetelmät ja mihin ne

Lisätiedot

Molekyylibiologian perusmenetelmät P Biokemian menetelmät I Juha Kerätär / BMTK

Molekyylibiologian perusmenetelmät P Biokemian menetelmät I Juha Kerätär / BMTK Molekyylibiologian perusmenetelmät 740151P Biokemian menetelmät I 26.9.2017 Juha Kerätär / BMTK Päivän aiheet Mitä on molekyylibiologia? Mitä ovat keskeiset molekyylibiologian menetelmät ja mihin ne perustuvat?

Lisätiedot

BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta

BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen

Lisätiedot

5.7 Biologia. Opetuksen tavoitteet

5.7 Biologia. Opetuksen tavoitteet 5.7 Biologia Biologian opetuksen tehtävänä on tukea opiskelijan luonnontieteellisen ajattelun kehittymistä. Opetus lisää ymmärrystä biologian merkityksestä osana luonnontieteellisen maailmankuvan rakentumista.

Lisätiedot

Minna Karhunen. Muuntogeenisen kasvintuotannon vaikutukset. Uhat, mahdollisuudet ja asenteet

Minna Karhunen. Muuntogeenisen kasvintuotannon vaikutukset. Uhat, mahdollisuudet ja asenteet Minna Karhunen Muuntogeenisen kasvintuotannon vaikutukset Uhat, mahdollisuudet ja asenteet Opinnäytetyö Kevät 2010 Maa- ja metsätalouden yksikkö, Ilmajoki Maaseutuelinkeinojen koulutusohjelma Tuotantotekniikka

Lisätiedot

Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira

Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa Annikki Welling Kemian laboratoriopalvelut Evira Sisältö Elintarvikepetokset Menetelmiä elintarvikepetosten tunnistamiseksi DNA menetelmät DNA viivakoodaus

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

Kantasolututkimuksen etiikasta - uusimmat näkymät. Timo Tuuri HUS, Naistenklinikka Biomedicum kantasolukeskus

Kantasolututkimuksen etiikasta - uusimmat näkymät. Timo Tuuri HUS, Naistenklinikka Biomedicum kantasolukeskus Kantasolututkimuksen etiikasta - uusimmat näkymät Timo Tuuri HUS, Naistenklinikka Biomedicum kantasolukeskus Kantasolut A) Kyky jakautua itsensä kaltaisiksi soluiksi (uusiutumiskyky) B) Kyky erilaistua

Lisätiedot

FIT Biotech Oy - Innovatiivisia lääkehoitoja. Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK

FIT Biotech Oy - Innovatiivisia lääkehoitoja. Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK FIT Biotech Oy - Innovatiivisia lääkehoitoja Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK Tärkeää tietoa Tämä esitys saattaa sisältää tulevaisuutta koskevia lausumia, arvioita ja laskelmia Yhtiöstä

Lisätiedot

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus

Lisätiedot

Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. Valitse listasta kunkin yhdisteen yleiskielessä käytettävä ei-systemaattinen nimi. (pisteet yht. 5p) a) C-vitamiini b) glukoosi c) etikkahappo d) salisyylihappo e) beta-karoteeni a. b. c. d. e. ksylitoli

Lisätiedot

Entsyymit ja niiden tuotanto. Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä

Entsyymit ja niiden tuotanto. Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä Entsyymit ja niiden tuotanto Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä Mitä ovat entsyymit? Entsyymit ovat proteiineja (eli valkuaisaineita), jotka vauhdittavat (katalysoivat) kemiallisia

Lisätiedot

Francis Crick ja James D. Watson

Francis Crick ja James D. Watson Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel-palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän

Lisätiedot

Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien

Lisätiedot

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja

Lisätiedot

"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein

Lisätiedot

II Genetiikka 4.(3) Nukleiinihapot

II Genetiikka 4.(3) Nukleiinihapot II Genetiikka 4.(3) Nukleiinihapot Geenitekniikka - menetelmiä, joiden avulla dna:ta ja rna:ta voidaan eristää, muokata ja siirtää muihin soluihin tai eliöihin kromosomit koostuvat dna-rihmasta ja siihen

Lisätiedot

LUKION OPETUSSUUNNITELMAN PERUSTEET 2003, OPETUSHALLITUKSEN MÄÄRÄYS 33/011/2003

LUKION OPETUSSUUNNITELMAN PERUSTEET 2003, OPETUSHALLITUKSEN MÄÄRÄYS 33/011/2003 LUKION OPETUSSUUNNITELMAN PERUSTEET 2003, OPETUSHALLITUKSEN MÄÄRÄYS 33/011/2003 -BIOLOGIA (s. 1-5) -KEMIA (s. 6-7) BIOLOGIA Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset

Lisätiedot

Käänteistransfektio primäärisiin hermosoluihin

Käänteistransfektio primäärisiin hermosoluihin Käänteistransfektio primäärisiin hermosoluihin Vesa Huusko Pro gradu -tutkielma Biotieteiden koulutusohjelma Itä-Suomen yliopiston luonnontieteiden ja metsätieteiden tiedekunta / biotiede Maaliskuu 2012

Lisätiedot

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.

Lisätiedot

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina

Lisätiedot

Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti

Lisätiedot

Lumarts-laboratorion työt syksyllä 2014

Lumarts-laboratorion työt syksyllä 2014 Lumarts-laboratorion työt syksyllä 2014 Lumarts-laboratorion työt Kemiaa ja biologiaa yhdistävät työt Luonnontieteitä yhdistävät työt Kemian työt Tekniikkaan liittyvät työt Kädentaitoja ja kemiaa yhdistävät

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS:n haasteet diagnostiikassa 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly

Lisätiedot

(12) PATENTTIJULKAISU PATENTSKRIFT (10) F11177898. (45) Patentti myönnetty - Patent beviljats. (51) Kv.lk. - Int.kl.

(12) PATENTTIJULKAISU PATENTSKRIFT (10) F11177898. (45) Patentti myönnetty - Patent beviljats. (51) Kv.lk. - Int.kl. (12) PATENTTIJULKAISU PATENTSKRIFT 1 1 10 111 (10) F18 (45) Patentti myönnetty - Patent beviljats 28.02.2007 SUOMI - FINLAND (FI) PATENTTI- JA REKISTERIHALLITUS PATENT- OCH REGISTERSTYRELSEN (51) Kv.lk.

Lisätiedot

DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri

Lisätiedot

Syto- ja molekyyligeneettisten

Syto- ja molekyyligeneettisten 1831 Katsausartikkeli Sytogenetiikka ja molekyylipatologia syöpätautien diagnostiikassa esimerkkeinä lymfoomat ja sarkoomat SAKARI KNUUTILA Syto- ja molekyyligenetiikka perinteisen patologian tukena täsmentää

Lisätiedot

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does

Lisätiedot

DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit

Lisätiedot

NON-CODING RNA (ncrna)

NON-CODING RNA (ncrna) NON-CODING RNA (ncrna) 1. Yleistä NcRNA eli non-coding RNA tarkoittaa kaikkia proteiinia koodaamattomia rnamolekyylejä. Näistä yleisimmin tunnetut ovat ribosomaalinen RNA (rrna) sekä siirtäjä-rna (trna),

Lisätiedot

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin?

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? 26.3.2015 Kalaterveyspäivät, Tampere Krister Sundell Akvaattisen patobiologian laboratorio Åbo Akademi Flavobacterium psychrophilum Aiheuttaa

Lisätiedot

KOE-ELÄINTEN ASIALLA

KOE-ELÄINTEN ASIALLA KOE-ELÄINTEN ASIALLA Eläinkokeet ovat arkipäivää Maailmassa käytetään vuosittain eläinkokeisiin yli sata miljoonaa eläintä, joista EU:n osuus on runsaat 10 miljoonaa koe-eläintä. Suomessa käytettyjen koe-eläinten

Lisätiedot

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa Kertaus CHEM-C2300 0 Tällä luennolla: - Oletteko lukeneet artikkelia, käydäänkö läpi? - Ehdotuksia tenttikysymyksiin? - Käydään läpi kurssin keskeiset asiakokonaisuudet otsikkotasolla - Extra: PCR-alukkeiden

Lisätiedot

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan

Lisätiedot

GMO-ABC. Markku Keinänen Itä-Suomen yliopisto

GMO-ABC. Markku Keinänen Itä-Suomen yliopisto GMO-ABC Markku Keinänen Itä-Suomen yliopisto Geenimuunnellut elintarvikkeet, BTNK, Tieteiden Talo, Helsinki, 24.3.2010 Kasvinjalostuksen menetelmiä Risteytys ja valinta Mutaatiojalostus Lajien väliset

Lisätiedot

Tuija Solismaa IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS

Tuija Solismaa IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS Tuija Solismaa IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS RAPORTIN NIMIÖSIVU IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS

Lisätiedot

Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa

Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa KOTIELÄINJALOSTUKSEN TIEDOTE No 82 Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa Sampo Sirkkomaa ja Matti Ojala Kotieläinten jalostustieteen laitos Helsinki 1988 Julkaistjat: Kotieläinten

Lisätiedot

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 3. Solujen kemiallinen rakenne

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 3. Solujen kemiallinen rakenne Solun perusrakenne I Solun perusrakenne 3. Solujen kemiallinen rakenne 1. Avainsanat 2. Solut koostuvat molekyyleistä 3. Hiilihydraatit 4. Lipidit eli rasva-aineet 5. Valkuaisaineet eli proteiinit rakentuvat

Lisätiedot

BIOLOGIAN KYSYMYKSET

BIOLOGIAN KYSYMYKSET BIOLOGIAN KYSYMYKSET Biologian osakokeessa on 10 kysymystä. Tarkista, että saamassasi vastausmonisteessa on sivut 1-10 numerojärjestyksessä. Tarkastajien merkintöjä varten 1 2 3 4 5 6 7 8 9 10 max 80p

Lisätiedot

LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä

LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä MITEN MATERIA KOODAA MATERIAA? 1 PROTEIINISYNTEESI DNA SISÄLTÄÄ GENEETTISEN KOODIN EMÄSJÄRJESTYKSEN MUODOSSA DNA:N EMÄSJÄRJESTYS KOPIOIDAAN (TRANSKRIPTIO)

Lisätiedot