Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Koko: px
Aloita esitys sivulta:

Download "Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO"

Transkriptio

1 Muuttumaton genomi? Genomin ylläpito SNP Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen Genomin ilmentyminen Liisa Kauppi The life and death of proteins Marc Baumann Genomi-ilmentymisen säätely Samuel Myllykangas Genomin leimautuminen Tiina Immonen Solukuolema Juha Klefström Mitokondrio-DNA ja mitokondriotaudit Anu Wartiovaara Signaalireitit Juha Klefström Cell cycle regulation Emmy Verschuren Syöpäsolun molekyylibiologia Juha Klefström Lääketieteellinen systeemibiologia Sampsa Hautaniemi Luennon sisältö Genomin ylläpito DNA:n kahdentuminen eli replikaatio Replikaatiossa tapahtuvien virheiden korjaus DNA-vaurioiden korjaus Kromosomien päiden ylläpito Genomin muuntuminen Ihmisellä 3.2 x 10 9 nukleotidia on jakautunut 23 kromosomiin DNA:N KAHDENTUMINEN ELI REPLIKAATIO Haploidi: 23 kromosomia Diploidi: 2 x 23 = 46 kromosomia Genomi Tuman + mitokondrioiden DNA Suppeammin: Haploidi (tuman) kromosomisto vrt. genomin selvittäminen, genomin koko Figure 4-11 Molecular Biology of the Cell ( Garland Science 2008) 1

2 Tuman kromosomit kahdentuvat ennen mitoosia Perimä siirtyy muuttumattomana tytärsoluille vai siirtyykö? Geenivirheet periytyvät ja somaattiset Meioottinen jakautuminen sukusoluissa tekijöiden vaihto Tuma-DNA replikoituu tasan kerran solusyklin aikana: G1 vaihe ORC rekrytoi replikaation aloituskohtaan replikaatiota estävät proteiinikompleksit ja kaksoiskierrettä avaavan helikaasin HUOM. ORC ei ole fosforyloitunut (Cdkkinaasit inaktiivisia) Figure 5-30 Molecular Biology of the Cell ( Garland Science 2008) Figure 5-36 (part 1 of 3) Molecular Biology of the Cell ( Garland Science 2008) Tuma-DNA replikoituu tasan kerran solusyklin aikana: S- vaihe Cdk-kinaasit aktivoituvat pre-replikatiivinen kompleksi hajoaa ORC fosforyloituu prereplikatiivinen kompleksi ei pysty muodostumaan uudestaan samassa syklissä Cyclin-dependent kinase : kinaasi jonka aktiivisuus riippuu solusyklin vaiheesta Figure 5-36 (part 2 of 3) Molecular Biology of the Cell ( Garland Science 2008) Kahdentuminen on semikonservatiivista Emäspariutuminen (A-T, G-C) johtaa siihen, että kopioituva juoste on identtinen templaatin alkuperäisen vastinjuosteen kanssa Uuden juosteen suunta vastakkainen templaatille Replikaatio etenee aloituskohdista kahteen suuntaan DNA:n replikaatio Figure 5-19a Molecular Biology of the Cell ( Garland Science 2008) 2

3 Replikaatiovirheiden korjaus strand-dircted mismatch repair Emäksenpoistokorjaus Nukleotidinpoistokorjaus Katkosten korjaus DNA:N KORJAUSMEKANISMIT DNA-polymeraasi tarkistaa jälkensä : 3 5 eksonukleaasiaktiivisuus Jonkin aikaa replikaation jälkeen voidaan yhteensopimattomista emäksistä päätellä kumpi on uusi (= virheellinen) ja vaihtaa se oikeaan Virheitä / genomi Table 5-1 Molecular Biology of the Cell ( Garland Science 2008) Strand-directed mismatch-repair Spontaanit DNA-vauriot Jonkin aikaa replikaation jälkeen on mahdollista erottaa, kumpi kaksoiskierteen juosteista on uusi Perustuu juosteeseen jääviin katkoksiin (nick s) Laahaavassa juosteessa mekanismi tunnetaan, johtavan juosteen osalta vain hypoteesi Kun korjausentsyymit löytävät väärin pariutuneet emäkset, korjataan uuden juosteen nukleotidi: muuten korjaus olisi sattumanvaraista ja 50% korjauksista johtaisi mutaatioon (alkuperäisen emäsparin vaihtumiseen) depurinaatio deaminaatio depurinaatio Hydrolyysi voi aiheuttaa emäksen irtoamisen (depurinaatio) tai deaminaation Hallitsematon metylaatio Oksidatiiviset vauriot Figure 5-44 Molecular Biology of the Cell ( Garland Science 2008) Emäksenpoistokorjaus Depurinaation seurauksena puuttuvat emäkset Deaminaation tuloksena syntyneet väärät emäkset Tehoton korjaus johtaa muutoksiin geneettisessä koodissa Geenien aktiivisuutta säädellään mm. metyloimalla sytosiineja DNA:ssa paljon metyylisytosiineja 5-metyylisytosiinin deaminaatio tymiini Syntyneen G-T parin korjaus tehotonta replikaatiossa toiseen tytärjuosteeseen A-T N. 1/3 tunnetuista yhden emäksen tautimutaatioista! Figures 5-48a and 5-50a Molecular Biology of the Cell ( Garland Science 2008) Figure 5-50b Molecular Biology of the Cell ( Garland Science 2008) 3

4 Säteilyvauriot: tymidiinidimeerit mutka DNA:ssa UV-säteily Figure 5-48b Molecular Biology of the Cell ( Garland Science 2008) Figure 5-48 Molecular Biology of the Cell ( Garland Science 2008) DNA-katkokset Miksei kromosomeja liitetä yhteen? Somaattisissa soluissa yleinen korjaus DNA-katkosten aiheuttajia Ionisoiva säteily Replikaatiovirheet Hapettimet Muut metaboliatuotteet Tärkeintä on saada katkenneet palat talteen (jos palassa ei ole sentromeeriä, se häviää seuraavassa solunjakautumisessa) Figure 5-51 Molecular Biology of the Cell ( Garland Science 2008) Figure 5-34 Molecular Biology of the Cell ( Garland Science 2008) Replikaatiossa laahaava juoste lyhenee 5 - päästään sillä viimeistä RNA-aluketta ei voida korvata DNA:lla Telomeraasi pidentää yksijuosteista 3 päätä toistojaksoilla Kromosomin päässä erityinen telomeerirakenne: toistojaksot, T-loop ja proteiineja Telomeerit Replikaation jälkeen: homologinen rekombinaatio Figure 5-41 Molecular Biology of the Cell ( Garland Science 2008) Figure 5-59 (part 1 of 2) Molecular Biology of the Cell ( Garland Science 2008) 4

5 DNA:n hybridisaatio parin löytäminen! DNA-katkosten homologisessä korjauksessa sisarkromatidien välillä Jos A=B=C..(DNA-toistojaksot) homologinen pariutuminen voi tapahtua juoponnappiin GENOMIN VARIAATIO: MEIOOTTINEN REKOMBINAATIO Meioottinen rekombinaatio mahdollistaa tekijöiden vaihdon Rekombinaatio vastinkromosomien välillä: emäsjärjestys ei ole identtinen kopiointi epäidenttisestä templaatista Tuloksena joko vastinkromosomien sekvenssien vaihtuminen risteyskohdasta kromosomin päähän asti (crossing over) tai vain lyhyeltä matkalta (gene conversion) Meioottinen rekombinaatio s u k u s o l u t Figure 5-64 Molecular Biology of the Cell ( Garland Science 2008) Figure 5-63 Molecular Biology of the Cell ( Garland Science 2008) Figure 5-66 Molecular Biology of the Cell ( Garland Science 2008) 5

6 Haplotyyppi = haploidi genotyyppi Yksilöllisen genotyypin (haplotyypin) selvittämisellä voi olla merkitystä sairauksien hoidolle Emäskoodin muutokset ja evoluutio Sukusolulinjassa tapahtuvat mutaatiot periytyvät evoluutiokello Somaattisissa soluissa tapahtuvat muutokset solun toiminnan muutokset syöpä Figure 4-75 Molecular Biology of the Cell ( Garland Science 2008) 6

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus

Lisätiedot

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne

Lisätiedot

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne

Lisätiedot

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla 1. Avainsanat 2. Solut lisääntyvät jakautumalla 3. Dna eli deoksiribonukleiinihappo sisältää perimän

Lisätiedot

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays

Lisätiedot

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Perinnöllinen informaatio sijaitsee dna:ssa eli deoksiribonukleiinihapossa

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista

Lisätiedot

Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi

Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Tehtävä 1: Solusykli, 0 9 p. Etsi oppikirjasta (ainakin Lehningeristä ja Albertsista löytyy) tai verkosta kuva solusyklistä (cell

Lisätiedot

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja

Lisätiedot

DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit

Lisätiedot

Francis Crick ja James D. Watson

Francis Crick ja James D. Watson Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel-palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän

Lisätiedot

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,

Lisätiedot

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien

Lisätiedot

Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi

Lisätiedot

? LUCA (Last universal common ancestor) 3.5 miljardia v.

? LUCA (Last universal common ancestor) 3.5 miljardia v. Mitä elämä on? - Geneettinen ohjelma, joka kykenee muuttamaan ainehiukkaset ja molekyylit järjestyneeksi itseään replikoivaksi kokonaisuudeksi. (= geneettistä antientropiaa) ? LUCA (Last universal common

Lisätiedot

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi Tulehduksen osuus syövän synnyssä Ari Ristimäki, professori Patologia Helsingin yliopisto esiasteissa ja useissa eri syöpäkasvaintyypeissä. 1 A Mantovani, et al. NATURE Vol 454 24 July 2008 Figure 15.22d

Lisätiedot

Solun tuman rakenne ja toiminta. Pertti Panula Biolääketieteen laitos 2012

Solun tuman rakenne ja toiminta. Pertti Panula Biolääketieteen laitos 2012 Solun tuman rakenne ja toiminta Pertti Panula Biolääketieteen laitos 2012 Hermosolun rakkulamainen tuma Monenlaisia tumia Valkosolujen tumien monimuotoisuutta Lähde: J.F.Kerr, Atlas of Functional Histology

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio

Lisätiedot

VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen

Lisätiedot

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat

Lisätiedot

SÄTEILYN TERVEYSVAIKUTUKSET

SÄTEILYN TERVEYSVAIKUTUKSET SÄTEILYN TERVEYSVAIKUTUKSET 25 Säteily- ja ydinturvallisuus -kirjasarjan toimituskunta: Sisko Salomaa, Wendla Paile, Tarja K. Ikäheimonen, Roy Pöllänen, Anne Weltner, Olavi Pukkila, Jorma Sandberg, Heidi

Lisätiedot

Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa

Lisätiedot

SÄTEILY JA SOLU. Riitta Mustonen ja Aki Salo

SÄTEILY JA SOLU. Riitta Mustonen ja Aki Salo 2 SÄTEILY JA SOLU Riitta Mustonen ja Aki Salo SISÄLLYSLUETTELO 2.1 Solun toiminta on tarkoin säädeltyä... 28 2.2 Säteilyn fysikaaliset vuorovaikutukset solussa... 28 2.3 Ionisoiva säteily vaurioittaa DNA:ta...

Lisätiedot

Essential Cell Biology

Essential Cell Biology Alberts Bray Hopkin Johnson Lewis Raff Roberts Walter Essential Cell Biology FOURTH EDITION Chapter 18 The Cell-Division Cycle Copyright Garland Science 2014 CHAPTER CONTENTS OVERVIEW OF THE CELL CYCLE

Lisätiedot

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyvaikutuksen synty Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyn ja biologisen materian vuorovaikutus Koska ihmisestä 70% on vettä, todennäköisin (ja tärkein) säteilyn ja biologisen

Lisätiedot

II Genetiikka 4.(3) Nukleiinihapot

II Genetiikka 4.(3) Nukleiinihapot II Genetiikka 4.(3) Nukleiinihapot Geenitekniikka - menetelmiä, joiden avulla dna:ta ja rna:ta voidaan eristää, muokata ja siirtää muihin soluihin tai eliöihin kromosomit koostuvat dna-rihmasta ja siihen

Lisätiedot

Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen

Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen Solun toiminta on tarkoin säädeltyä ja monimutkaista. Solu reagoi ulkoapäin tuleviin ärsykkeisiin - kuten säteilyaltistukseen

Lisätiedot

"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein

Lisätiedot

Solujen viestintäjärjestelmät. Katri Koli, Solu- ja molekyylibiologian dosentti Helsingin Yliopisto 16.04.2014

Solujen viestintäjärjestelmät. Katri Koli, Solu- ja molekyylibiologian dosentti Helsingin Yliopisto 16.04.2014 Solujen viestintäjärjestelmät Katri Koli, Solu- ja molekyylibiologian dosentti Helsingin Yliopisto 16.04.2014 Solujen kasvu Geneettinen koodi Liukoiset viestimolekyylit Kontakti ympäristöön Kantasolut

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 11. Sukusolujen synty 1. Avainsanat 2. Geenien ja ympäristön vaikutus yksilöön 3. Meioosissa kromosomimäärä puolittuu, hedelmöityksessä

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto.

Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto. Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto Juha.Klefstrom@helsinki.fi Nukleiinihapot! kertausta matkan varrella, vähemmän kuitenkin

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

BIOLOGIAN OSIO (45 p.)

BIOLOGIAN OSIO (45 p.) BIOLÄÄKETIETEEN KOULUTUSOHJELMA PÄÄSYKOE 17.5.2017 BIOLOGIAN OSIO (45 p.) HYVÄN VASTAUKSEN PIIRTEET I) Esseetehtävät (2 kpl) a) Selitä perustellen, miten kuvaan merkittyihin kohtiin osuvat mutaatiot voivat

Lisätiedot

465 E MOLEKYYLIBIOLOGIAA

465 E MOLEKYYLIBIOLOGIAA 465 E MOLEKYYLIBIOLOGIAA 466 E1 Geneettinen koodi elämän yhteinen kieli Latvala Juho & Seppälä Mika Solu-ja kehitysbiologian kurssin kirjoitelma Anatomian ja solubiologian laitos, Oulun yliopisto 12.9.2009

Lisätiedot

DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =

Lisätiedot

HOX. Esimerkki geeniperheestä: HOX

HOX. Esimerkki geeniperheestä: HOX Esimerkki geeniperheestä: HOX HOX Barton ym. 2007 Unraveling ancient segmental duplication events in human genome by phylogenetic analysis of multigene families residing on HOXcluster paralogons, Abbasi,

Lisätiedot

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli

Lisätiedot

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset

Lisätiedot

BI4 IHMISEN BIOLOGIA

BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava

Lisätiedot

6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?

Lisätiedot

a) dominoivaan: esiintyy joka sukupolvessa, sairaille vanhemmille voi syntyä terveitä lapsia

a) dominoivaan: esiintyy joka sukupolvessa, sairaille vanhemmille voi syntyä terveitä lapsia 1. Sukupuut Seuraavat ihmisen sukupuut edustavat periytymistä, jossa ominaisuuden määrää yksi alleeli. Päättele sukupuista A-F, mitä periytymistapaa kukin niistä voi edustaa. Vastaa taulukkoon kirjaimin

Lisätiedot

LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä

LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä MITEN MATERIA KOODAA MATERIAA? 1 PROTEIINISYNTEESI DNA SISÄLTÄÄ GENEETTISEN KOODIN EMÄSJÄRJESTYKSEN MUODOSSA DNA:N EMÄSJÄRJESTYS KOPIOIDAAN (TRANSKRIPTIO)

Lisätiedot

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30 Tampereen yliopisto Bioteknologian tutkinto-ohjelma Valintakoe 21.5.2015 Henkilötunnus - Sukunimi Etunimet Tehtävä 3 Pisteet / 30 3. a) Alla on lyhyt jakso dsdna:ta, joka koodaa muutaman aminohappotähteen

Lisätiedot

Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi

Lisätiedot

ENTSYYMIKATA- LYYSIN PERUSTEET (dos. Tuomas Haltia)

ENTSYYMIKATA- LYYSIN PERUSTEET (dos. Tuomas Haltia) ENTSYYMIKATA- LYYSIN PERUSTEET (dos. Tuomas Haltia) Elämän edellytykset: Solun täytyy pystyä (a) replikoitumaan (B) katalysoimaan tarvitsemiaan reaktioita tehokkaasti ja selektiivisesti eli sillä on oltava

Lisätiedot

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 BIOLÄÄKETIETEEN Henkilötunnus: - KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 Kirjoita selvästi nimesi ja muut henkilötietosi niille varattuun

Lisätiedot

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan

Lisätiedot

Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.

Lisätiedot

Seutuviikko 2015, Jämsä Kyösti Ryynänen PROTEIINISYNTEESI LUENTO 3 DNA-RAKENNE DNA SOLUJAKAUTUMINEN DNA-KAKSOISKIERRE

Seutuviikko 2015, Jämsä Kyösti Ryynänen PROTEIINISYNTEESI LUENTO 3 DNA-RAKENNE DNA SOLUJAKAUTUMINEN DNA-KAKSOISKIERRE Seutuviikko 2015, Jämsä Kyösti Ryynänen LUENTO 3 MITEN MATERIA KOODAA MATERIAA? 1 PROTEIINISYNTEESI DNA SISÄLTÄÄ GENEETTISEN KOODIN EMÄSJÄRJESTYKSEN MUODOSSA DNA:N EMÄSJÄRJESTYS KOPIOIDAAN (TRANSKRIPTIO)

Lisätiedot

SIKIÖDIAGNOSTIIKKA SUOMESSA

SIKIÖDIAGNOSTIIKKA SUOMESSA SIKIÖDIAGNOSTIIKKA SUOMESSA Geneettisten tutkimusmenetelmien kehitys Enni Loven Päivi Suorsa Opinnäytetyö Lokakuu 2011 Bioanalytiikan koulutusohjelma Tampereen ammattikorkeakoulu 2 TIIVISTELMÄ Tampereen

Lisätiedot

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa Kertaus CHEM-C2300 0 Tällä luennolla: - Oletteko lukeneet artikkelia, käydäänkö läpi? - Ehdotuksia tenttikysymyksiin? - Käydään läpi kurssin keskeiset asiakokonaisuudet otsikkotasolla - Extra: PCR-alukkeiden

Lisätiedot

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut Hemopoiesis Tuma Mitochondrion Tuma 2 Flagellum Peroxisome Centrioles Microfilaments Microtubules Nuclear envelope Rough endoplasmic reticulum Ribosomes NUCLEUS muoto: pallomainen liuskoittunut (esim.

Lisätiedot

SÄTEILYN GENEETTISET VAIKUTUKSET

SÄTEILYN GENEETTISET VAIKUTUKSET 8 SÄTEILYN GENEETTISET VAIKUTUKSET Sisko Salomaa SISÄLLYSLUETTELO 8.1 Ihmisen perinnölliset sairaudet... 122 8.2 Perinnöllisten sairauksien taustailmaantuvuus... 125 8.3 Perinnöllisen riskin arviointi...

Lisätiedot

Sytosoli eli solulima. Sytosoli. Solunsisäiset rakenteet, kalvostot ja proteiinien lajittelu (Chapter 12 Alberts et al.)

Sytosoli eli solulima. Sytosoli. Solunsisäiset rakenteet, kalvostot ja proteiinien lajittelu (Chapter 12 Alberts et al.) Solunsisäiset rakenteet, kalvostot ja proteiinien lajittelu (Chapter 12 Alberts et al.) Figure 12-1 Molecular Biology of the Cell ( Garland Science 2008) Sytosoli eli solulima Sytosoli määritellään operatiivisesti

Lisätiedot

Solubiologia ja peruskudokset/ Biolääketieteen laitos/ Anatomia TUMA JA SOLUSYKLI HEIKKI HERVONEN

Solubiologia ja peruskudokset/ Biolääketieteen laitos/ Anatomia TUMA JA SOLUSYKLI HEIKKI HERVONEN Solubiologia ja peruskudokset/ Biolääketieteen laitos/ Anatomia TUMA JA SOLUSYKLI HEIKKI HERVONEN Luku 1 TUMA JA SOLUSYKLI Viereinen kuva on otettu maksakudoksesta tehdystä histologisesta valmisteesta.

Lisätiedot

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa

Lisätiedot

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu

Lisätiedot

Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122

Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122 Bioinformatiikan maisteriohjelman infotilaisuus 15.11.2007 Exactum D122 Bio- ja lääketieteiden opiskelu MBImaisteriohjelmassa Outi Monni, Dos, FT Biolääketieteen laitos 15.11.2007 Bioinformatiikan maisteriohjelma

Lisätiedot

Miten letaalialleeleita käsitellään Drosophilalla? Välttämätön taito esimerkiksi alkionkehityksen alkuvaiheiden selvittämisessä

Miten letaalialleeleita käsitellään Drosophilalla? Välttämätön taito esimerkiksi alkionkehityksen alkuvaiheiden selvittämisessä Miten letaalialleeleita käsitellään Drosophilalla? Välttämätön taito esimerkiksi alkionkehityksen alkuvaiheiden selvittämisessä Balansoitu kanta Koejärjestely perustuu ns. balansoidun kannan käyttöön.

Lisätiedot

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA Robert Winqvist SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PROFESSORILIITON SYYSSEMINAARI TUTKIMUSTA KAIKKIEN HYÖDYKSI

Lisätiedot

Biologia ylioppilaskoe

Biologia ylioppilaskoe Biologia ylioppilaskoe 12 tehtävää, joista kahdeksaan (8) vastataan Tehtävät vaikeutuvat loppua kohden, jokeritehtävät merkitty +:lla Molempiin jokereihin saa vastata ja ne lasketaan mukaan kahdeksaan

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

The Plant Cell / Sytoskeleton

The Plant Cell / Sytoskeleton The Plant Cell / Sytoskeleton Sytoskeleton koostuu solulimassa olevista polymeeriverkostoista Informaatiota rakenteiden 3- ulotteisesta järjestäytymisestä. Solubiologian luennot 2003, kasvitiede Sytoskeletonin

Lisätiedot

Populaatiosimulaattori. Petteri Hintsanen HIIT perustutkimusyksikkö Helsingin yliopisto

Populaatiosimulaattori. Petteri Hintsanen HIIT perustutkimusyksikkö Helsingin yliopisto Populaatiosimulaattori Petteri Hintsanen HIIT perustutkimusyksikkö Helsingin yliopisto Kromosomit Ihmisen perimä (genomi) on jakaantunut 23 kromosomipariin Jokaisen parin toinen kromosomi on peritty isältä

Lisätiedot

x _ Miksi elinikä ei ole rajaton? Mediterranean fruitfly (Ceratitis capitata) Eliniän jakautuma

x _ Miksi elinikä ei ole rajaton? Mediterranean fruitfly (Ceratitis capitata) Eliniän jakautuma Vanhenemisen fysiologia 1 Elinikä ja vanheneminen Käsitteet Elinikä - yksilön elinikä Eliniän odotusarvo, aktuaarinen (kirjanpidollinen) elinikä - keskimääräinen odotettavissa oleva elinikä tietylle lajille,

Lisätiedot

Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa

Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa Petter Portin Kysymys siitä, ovatko nykyihminen (Homo sapiens) ja neandertalinihminen (Homo neanderthalensis) kaksi eri lajia vai saman

Lisätiedot

Genetiikan perusteiden toisen jakson kaavailua

Genetiikan perusteiden toisen jakson kaavailua Genetiikan perusteiden toisen jakson kaavailua Tiedämme kaiken siitä, miten geenit siirtyvät sukupolvelta seuraavalle solun ja yksilön tasolla Toisen jakson sisältö: Mitä geenit ovat? Miten geenit toimivat?

Lisätiedot

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.

Lisätiedot

Biopolymeerit. Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä.

Biopolymeerit. Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä. Biopolymeerit Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä. Tärkeimpiä biopolymeerejä ovat hiilihydraatit, proteiinit ja nukleiinihapot. 1 Hiilihydraatit Hiilihydraatit jaetaan mono

Lisätiedot

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa.

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa. 1 1/2011 Parkinsonin taudin perinnöllisyys Geenien ja ympäristötekijöiden vuorovaikutus sairastumisen taustalla Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla

Lisätiedot

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,

Lisätiedot

Oksidatiivinen fosforylaatio = ATP:n tuotto NADH:lta ja FADH2:lta hapelle tapahtuvan elektroninsiirron ja ATP-syntaasin avulla

Oksidatiivinen fosforylaatio = ATP:n tuotto NADH:lta ja FADH2:lta hapelle tapahtuvan elektroninsiirron ja ATP-syntaasin avulla Soluhengitys + ATP-synteesi = Oksidatiivinen fosforylaatio Soluhengitys = Mitokondrioissa tapahtuva (ATP:tä tuottava) prosessi, jossa happi toimii pelkistyneiden ravintomolekyylien elektronien vastaanottajana

Lisätiedot

Genomi- ilmentymisen säätely

Genomi- ilmentymisen säätely Genomi- ilmentymisen säätely Samuel Myllykangas, FT Biolääke

Lisätiedot

Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä

Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen. Mendelistinen g. on sen synonyymi Toisessa osassa ryhdymme

Lisätiedot

Solubiologian luennot Solusykli

Solubiologian luennot Solusykli Solubiologian luennot Solusykli Riitta Julkunen-Tiitto Itä-Suomen yliopisto/ Biologian laitos Joensuun tiedepuisto, Luonnonainetutkimuksen laboratorio rjt@uef.fi Oheislukemisto: Campbell 9. painos: kpl

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

Syövän lääkehoito. Salla Kalsi

Syövän lääkehoito. Salla Kalsi Syövän lääkehoito Salla Kalsi Syöpä Yleisnimitys maligneille (pahanlaatuisille) kasvaimille Karsinogeeninen = syöpää aiheuttava Syövän taustalla voi olla Ympäristötekijät, elintavat, perimä, eräät virus-

Lisätiedot

Miten geenit elelevät populaatioissa, vieläpä pitkiä aikoja?

Miten geenit elelevät populaatioissa, vieläpä pitkiä aikoja? Miten geenit elelevät populaatioissa, vieläpä pitkiä aikoja? Populaatio on lisääntymisyhteisö ja lisääntymisjatkumo Yksilöt ovat geenien tilapäisiä yhteenliittymiä, mutta populaatiossa geenit elelevät

Lisätiedot

Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen

Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Opintori 10.5.2012 Minna Männikkö Biolääketieteen laitos Lääketieteellisen biokemian ja molekyylibiologian kurssi 15 op, 170 opiskelijaa Kemia:

Lisätiedot

ELAHEH MORADI ARABINOOSIPROMOOTTORIN TRANSKRIPTIODYNAMIIKKA KOLIBAKTEERISSA. Kandidaatintyö

ELAHEH MORADI ARABINOOSIPROMOOTTORIN TRANSKRIPTIODYNAMIIKKA KOLIBAKTEERISSA. Kandidaatintyö ELAHEH MORADI ARABINOOSIPROMOOTTORIN TRANSKRIPTIODYNAMIIKKA KOLIBAKTEERISSA Kandidaatintyö Tarkastaja: Lehtori Heikki Huttunen Ohjaajat: Andre S.Ribeiro, Jarno Mäkelä Jätetty tarkastettavaksi 16.12.2011

Lisätiedot

Epigenetiikka, geeninsäätely ja syöpä

Epigenetiikka, geeninsäätely ja syöpä Katsaus Mikko Taipale Epigenetiikka, geeninsäätely ja syöpä Geenitutkimus on totunnaisesti keskittynyt DNA:han. Kuitenkin perimän perusyksikkö kromosomi koostuu DNA:n lisäksi histoneista ja muista proteiineista,

Lisätiedot

Sekvenssievoluutio ja fylogeniat

Sekvenssievoluutio ja fylogeniat Sekvenssievoluutio ja fylogeniat Miksi sekvenssien evoluutionopeus vaihtelee? -erot korvautumisnopeudessa geenien tai geenin eri osien välillä, -erot korvautumisnopeudessa eri fylogeneettisten linjojen

Lisätiedot

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun

Lisätiedot

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien molekyylidiagnostiikkaa 30.8.2013 Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien WHO-luokitus on morfologinen Gradusten I-IV ryhmittelyn perustana on toiminut ennusteen huononeminen

Lisätiedot

CHEM-C2300 Solu- ja molekyylibiologia Luento

CHEM-C2300 Solu- ja molekyylibiologia Luento CHEM-C2300 Solu- ja molekyylibiologia Luento1 31.10.2017 Heli Viskari Tervetuloa kurssille! 1 Kurssin sisältö (Oodista) Mikrobi-, kasvi- ja eläinsolujen solutason rakenteiden ja toiminnan vuorovaikutus

Lisätiedot

DNA, RNA ja proteiinirakenteen ennustaminen

DNA, RNA ja proteiinirakenteen ennustaminen S-114.500 Solubiosysteemien perusteet Harjoitustyö Syksy 2003 DNA, RNA ja proteiinirakenteen ennustaminen Ilpo Tertsonen, 58152p Jaakko Niemi, 55114s Sisällysluettelo 1. Alkusanat... 3 2. Johdanto... 4

Lisätiedot

Soluhengitys + ATP-synteesi = Oksidatiivinen fosforylaatio Tuomas Haltia Elämälle (solulle) välttämättömiä asioita ovat:

Soluhengitys + ATP-synteesi = Oksidatiivinen fosforylaatio Tuomas Haltia Elämälle (solulle) välttämättömiä asioita ovat: Soluhengitys + ATP-synteesi = Oksidatiivinen fosforylaatio Tuomas Haltia 3.12.2012 Soluhengitys = Mitokondrioissa tapahtuva (ATP:tä tuottava) prosessi, jossa happi toimii pelkistyneiden ravintomolekyylien

Lisätiedot

EUROOPAN PARLAMENTTI

EUROOPAN PARLAMENTTI EUROOPAN PARLAMENTTI 1999 2004 Ihmisgenetiikkaa ja nykylääketieteen muita uusia tekniikoita käsittelevä väliaikainen valiokunta VÄLIAIKAINEN 26. heinäkuuta 2001 Par2 KERTOMUSLUONNOS Ihmisgenetiikan sosiaaliset,

Lisätiedot