Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Koko: px
Aloita esitys sivulta:

Download "Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO"


1 Muuttumaton genomi? Genomin ylläpito SNP Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen Genomin ilmentyminen Liisa Kauppi The life and death of proteins Marc Baumann Genomi-ilmentymisen säätely Samuel Myllykangas Genomin leimautuminen Tiina Immonen Solukuolema Juha Klefström Mitokondrio-DNA ja mitokondriotaudit Anu Wartiovaara Signaalireitit Juha Klefström Cell cycle regulation Emmy Verschuren Syöpäsolun molekyylibiologia Juha Klefström Lääketieteellinen systeemibiologia Sampsa Hautaniemi Luennon sisältö Genomin ylläpito DNA:n kahdentuminen eli replikaatio Replikaatiossa tapahtuvien virheiden korjaus DNA-vaurioiden korjaus Kromosomien päiden ylläpito Genomin muuntuminen Ihmisellä 3.2 x 10 9 nukleotidia on jakautunut 23 kromosomiin DNA:N KAHDENTUMINEN ELI REPLIKAATIO Haploidi: 23 kromosomia Diploidi: 2 x 23 = 46 kromosomia Genomi Tuman + mitokondrioiden DNA Suppeammin: Haploidi (tuman) kromosomisto vrt. genomin selvittäminen, genomin koko Figure 4-11 Molecular Biology of the Cell ( Garland Science 2008) 1

2 Tuman kromosomit kahdentuvat ennen mitoosia Perimä siirtyy muuttumattomana tytärsoluille vai siirtyykö? Geenivirheet periytyvät ja somaattiset Meioottinen jakautuminen sukusoluissa tekijöiden vaihto Tuma-DNA replikoituu tasan kerran solusyklin aikana: G1 vaihe ORC rekrytoi replikaation aloituskohtaan replikaatiota estävät proteiinikompleksit ja kaksoiskierrettä avaavan helikaasin HUOM. ORC ei ole fosforyloitunut (Cdkkinaasit inaktiivisia) Figure 5-30 Molecular Biology of the Cell ( Garland Science 2008) Figure 5-36 (part 1 of 3) Molecular Biology of the Cell ( Garland Science 2008) Tuma-DNA replikoituu tasan kerran solusyklin aikana: S- vaihe Cdk-kinaasit aktivoituvat pre-replikatiivinen kompleksi hajoaa ORC fosforyloituu prereplikatiivinen kompleksi ei pysty muodostumaan uudestaan samassa syklissä Cyclin-dependent kinase : kinaasi jonka aktiivisuus riippuu solusyklin vaiheesta Figure 5-36 (part 2 of 3) Molecular Biology of the Cell ( Garland Science 2008) Kahdentuminen on semikonservatiivista Emäspariutuminen (A-T, G-C) johtaa siihen, että kopioituva juoste on identtinen templaatin alkuperäisen vastinjuosteen kanssa Uuden juosteen suunta vastakkainen templaatille Replikaatio etenee aloituskohdista kahteen suuntaan DNA:n replikaatio Figure 5-19a Molecular Biology of the Cell ( Garland Science 2008) 2

3 Replikaatiovirheiden korjaus strand-dircted mismatch repair Emäksenpoistokorjaus Nukleotidinpoistokorjaus Katkosten korjaus DNA:N KORJAUSMEKANISMIT DNA-polymeraasi tarkistaa jälkensä : 3 5 eksonukleaasiaktiivisuus Jonkin aikaa replikaation jälkeen voidaan yhteensopimattomista emäksistä päätellä kumpi on uusi (= virheellinen) ja vaihtaa se oikeaan Virheitä / genomi Table 5-1 Molecular Biology of the Cell ( Garland Science 2008) Strand-directed mismatch-repair Spontaanit DNA-vauriot Jonkin aikaa replikaation jälkeen on mahdollista erottaa, kumpi kaksoiskierteen juosteista on uusi Perustuu juosteeseen jääviin katkoksiin (nick s) Laahaavassa juosteessa mekanismi tunnetaan, johtavan juosteen osalta vain hypoteesi Kun korjausentsyymit löytävät väärin pariutuneet emäkset, korjataan uuden juosteen nukleotidi: muuten korjaus olisi sattumanvaraista ja 50% korjauksista johtaisi mutaatioon (alkuperäisen emäsparin vaihtumiseen) depurinaatio deaminaatio depurinaatio Hydrolyysi voi aiheuttaa emäksen irtoamisen (depurinaatio) tai deaminaation Hallitsematon metylaatio Oksidatiiviset vauriot Figure 5-44 Molecular Biology of the Cell ( Garland Science 2008) Emäksenpoistokorjaus Depurinaation seurauksena puuttuvat emäkset Deaminaation tuloksena syntyneet väärät emäkset Tehoton korjaus johtaa muutoksiin geneettisessä koodissa Geenien aktiivisuutta säädellään mm. metyloimalla sytosiineja DNA:ssa paljon metyylisytosiineja 5-metyylisytosiinin deaminaatio tymiini Syntyneen G-T parin korjaus tehotonta replikaatiossa toiseen tytärjuosteeseen A-T N. 1/3 tunnetuista yhden emäksen tautimutaatioista! Figures 5-48a and 5-50a Molecular Biology of the Cell ( Garland Science 2008) Figure 5-50b Molecular Biology of the Cell ( Garland Science 2008) 3

4 Säteilyvauriot: tymidiinidimeerit mutka DNA:ssa UV-säteily Figure 5-48b Molecular Biology of the Cell ( Garland Science 2008) Figure 5-48 Molecular Biology of the Cell ( Garland Science 2008) DNA-katkokset Miksei kromosomeja liitetä yhteen? Somaattisissa soluissa yleinen korjaus DNA-katkosten aiheuttajia Ionisoiva säteily Replikaatiovirheet Hapettimet Muut metaboliatuotteet Tärkeintä on saada katkenneet palat talteen (jos palassa ei ole sentromeeriä, se häviää seuraavassa solunjakautumisessa) Figure 5-51 Molecular Biology of the Cell ( Garland Science 2008) Figure 5-34 Molecular Biology of the Cell ( Garland Science 2008) Replikaatiossa laahaava juoste lyhenee 5 - päästään sillä viimeistä RNA-aluketta ei voida korvata DNA:lla Telomeraasi pidentää yksijuosteista 3 päätä toistojaksoilla Kromosomin päässä erityinen telomeerirakenne: toistojaksot, T-loop ja proteiineja Telomeerit Replikaation jälkeen: homologinen rekombinaatio Figure 5-41 Molecular Biology of the Cell ( Garland Science 2008) Figure 5-59 (part 1 of 2) Molecular Biology of the Cell ( Garland Science 2008) 4

5 DNA:n hybridisaatio parin löytäminen! DNA-katkosten homologisessä korjauksessa sisarkromatidien välillä Jos A=B=C..(DNA-toistojaksot) homologinen pariutuminen voi tapahtua juoponnappiin GENOMIN VARIAATIO: MEIOOTTINEN REKOMBINAATIO Meioottinen rekombinaatio mahdollistaa tekijöiden vaihdon Rekombinaatio vastinkromosomien välillä: emäsjärjestys ei ole identtinen kopiointi epäidenttisestä templaatista Tuloksena joko vastinkromosomien sekvenssien vaihtuminen risteyskohdasta kromosomin päähän asti (crossing over) tai vain lyhyeltä matkalta (gene conversion) Meioottinen rekombinaatio s u k u s o l u t Figure 5-64 Molecular Biology of the Cell ( Garland Science 2008) Figure 5-63 Molecular Biology of the Cell ( Garland Science 2008) Figure 5-66 Molecular Biology of the Cell ( Garland Science 2008) 5

6 Haplotyyppi = haploidi genotyyppi Yksilöllisen genotyypin (haplotyypin) selvittämisellä voi olla merkitystä sairauksien hoidolle Emäskoodin muutokset ja evoluutio Sukusolulinjassa tapahtuvat mutaatiot periytyvät evoluutiokello Somaattisissa soluissa tapahtuvat muutokset solun toiminnan muutokset syöpä Figure 4-75 Molecular Biology of the Cell ( Garland Science 2008) 6

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Perinnöllinen informaatio sijaitsee dna:ssa eli deoksiribonukleiinihapossa


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista


Laskuharjoitus 4 selitykset Juha-Matti Alakoskela,

Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, Tehtävä 1: Solusykli, 0 9 p. Etsi oppikirjasta (ainakin Lehningeristä ja Albertsista löytyy) tai verkosta kuva solusyklistä (cell


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit


Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi


? LUCA (Last universal common ancestor) 3.5 miljardia v.

? LUCA (Last universal common ancestor) 3.5 miljardia v. Mitä elämä on? - Geneettinen ohjelma, joka kykenee muuttamaan ainehiukkaset ja molekyylit järjestyneeksi itseään replikoivaksi kokonaisuudeksi. (= geneettistä antientropiaa) ? LUCA (Last universal common


Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi Tulehduksen osuus syövän synnyssä Ari Ristimäki, professori Patologia Helsingin yliopisto esiasteissa ja useissa eri syöpäkasvaintyypeissä. 1 A Mantovani, et al. NATURE Vol 454 24 July 2008 Figure 15.22d


Solun tuman rakenne ja toiminta. Pertti Panula Biolääketieteen laitos 2012

Solun tuman rakenne ja toiminta. Pertti Panula Biolääketieteen laitos 2012 Solun tuman rakenne ja toiminta Pertti Panula Biolääketieteen laitos 2012 Hermosolun rakkulamainen tuma Monenlaisia tumia Valkosolujen tumien monimuotoisuutta Lähde: J.F.Kerr, Atlas of Functional Histology


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat



SÄTEILYN TERVEYSVAIKUTUKSET SÄTEILYN TERVEYSVAIKUTUKSET 25 Säteily- ja ydinturvallisuus -kirjasarjan toimituskunta: Sisko Salomaa, Wendla Paile, Tarja K. Ikäheimonen, Roy Pöllänen, Anne Weltner, Olavi Pukkila, Jorma Sandberg, Heidi


Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa


II Genetiikka 4.(3) Nukleiinihapot

II Genetiikka 4.(3) Nukleiinihapot II Genetiikka 4.(3) Nukleiinihapot Geenitekniikka - menetelmiä, joiden avulla dna:ta ja rna:ta voidaan eristää, muokata ja siirtää muihin soluihin tai eliöihin kromosomit koostuvat dna-rihmasta ja siihen


Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto.

Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto. Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto Nukleiinihapot! kertausta matkan varrella, vähemmän kuitenkin


SÄTEILY JA SOLU. Riitta Mustonen ja Aki Salo

SÄTEILY JA SOLU. Riitta Mustonen ja Aki Salo 2 SÄTEILY JA SOLU Riitta Mustonen ja Aki Salo SISÄLLYSLUETTELO 2.1 Solun toiminta on tarkoin säädeltyä... 28 2.2 Säteilyn fysikaaliset vuorovaikutukset solussa... 28 2.3 Ionisoiva säteily vaurioittaa DNA:ta...


Essential Cell Biology

Essential Cell Biology Alberts Bray Hopkin Johnson Lewis Raff Roberts Walter Essential Cell Biology FOURTH EDITION Chapter 18 The Cell-Division Cycle Copyright Garland Science 2014 CHAPTER CONTENTS OVERVIEW OF THE CELL CYCLE


Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen

Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen Solun toiminta on tarkoin säädeltyä ja monimutkaista. Solu reagoi ulkoapäin tuleviin ärsykkeisiin - kuten säteilyaltistukseen


Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyvaikutuksen synty Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyn ja biologisen materian vuorovaikutus Koska ihmisestä 70% on vettä, todennäköisin (ja tärkein) säteilyn ja biologisen


III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 11. Sukusolujen synty 1. Avainsanat 2. Geenien ja ympäristön vaikutus yksilöön 3. Meioosissa kromosomimäärä puolittuu, hedelmöityksessä


"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein


Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä


Solujen viestintäjärjestelmät. Katri Koli, Solu- ja molekyylibiologian dosentti Helsingin Yliopisto 16.04.2014

Solujen viestintäjärjestelmät. Katri Koli, Solu- ja molekyylibiologian dosentti Helsingin Yliopisto 16.04.2014 Solujen viestintäjärjestelmät Katri Koli, Solu- ja molekyylibiologian dosentti Helsingin Yliopisto 16.04.2014 Solujen kasvu Geneettinen koodi Liukoiset viestimolekyylit Kontakti ympäristöön Kantasolut



465 E MOLEKYYLIBIOLOGIAA 465 E MOLEKYYLIBIOLOGIAA 466 E1 Geneettinen koodi elämän yhteinen kieli Latvala Juho & Seppälä Mika Solu-ja kehitysbiologian kurssin kirjoitelma Anatomian ja solubiologian laitos, Oulun yliopisto 12.9.2009


DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =



BIOLOGIAN OSIO (45 p.) BIOLÄÄKETIETEEN KOULUTUSOHJELMA PÄÄSYKOE 17.5.2017 BIOLOGIAN OSIO (45 p.) HYVÄN VASTAUKSEN PIIRTEET I) Esseetehtävät (2 kpl) a) Selitä perustellen, miten kuvaan merkittyihin kohtiin osuvat mutaatiot voivat


KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli


Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset



BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava


6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?


a) dominoivaan: esiintyy joka sukupolvessa, sairaille vanhemmille voi syntyä terveitä lapsia

a) dominoivaan: esiintyy joka sukupolvessa, sairaille vanhemmille voi syntyä terveitä lapsia 1. Sukupuut Seuraavat ihmisen sukupuut edustavat periytymistä, jossa ominaisuuden määrää yksi alleeli. Päättele sukupuista A-F, mitä periytymistapaa kukin niistä voi edustaa. Vastaa taulukkoon kirjaimin


LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä



Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30 Tampereen yliopisto Bioteknologian tutkinto-ohjelma Valintakoe 21.5.2015 Henkilötunnus - Sukunimi Etunimet Tehtävä 3 Pisteet / 30 3. a) Alla on lyhyt jakso dsdna:ta, joka koodaa muutaman aminohappotähteen


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi



ENTSYYMIKATA- LYYSIN PERUSTEET (dos. Tuomas Haltia) ENTSYYMIKATA- LYYSIN PERUSTEET (dos. Tuomas Haltia) Elämän edellytykset: Solun täytyy pystyä (a) replikoitumaan (B) katalysoimaan tarvitsemiaan reaktioita tehokkaasti ja selektiivisesti eli sillä on oltava


KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 BIOLÄÄKETIETEEN Henkilötunnus: - KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 Kirjoita selvästi nimesi ja muut henkilötietosi niille varattuun


Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä


Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.


HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan






SIKIÖDIAGNOSTIIKKA SUOMESSA SIKIÖDIAGNOSTIIKKA SUOMESSA Geneettisten tutkimusmenetelmien kehitys Enni Loven Päivi Suorsa Opinnäytetyö Lokakuu 2011 Bioanalytiikan koulutusohjelma Tampereen ammattikorkeakoulu 2 TIIVISTELMÄ Tampereen


PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto



Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut Hemopoiesis Tuma Mitochondrion Tuma 2 Flagellum Peroxisome Centrioles Microfilaments Microtubules Nuclear envelope Rough endoplasmic reticulum Ribosomes NUCLEUS muoto: pallomainen liuskoittunut (esim.


- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa Kertaus CHEM-C2300 0 Tällä luennolla: - Oletteko lukeneet artikkelia, käydäänkö läpi? - Ehdotuksia tenttikysymyksiin? - Käydään läpi kurssin keskeiset asiakokonaisuudet otsikkotasolla - Extra: PCR-alukkeiden



SÄTEILYN GENEETTISET VAIKUTUKSET 8 SÄTEILYN GENEETTISET VAIKUTUKSET Sisko Salomaa SISÄLLYSLUETTELO 8.1 Ihmisen perinnölliset sairaudet... 122 8.2 Perinnöllisten sairauksien taustailmaantuvuus... 125 8.3 Perinnöllisen riskin arviointi...


Sytosoli eli solulima. Sytosoli. Solunsisäiset rakenteet, kalvostot ja proteiinien lajittelu (Chapter 12 Alberts et al.)

Sytosoli eli solulima. Sytosoli. Solunsisäiset rakenteet, kalvostot ja proteiinien lajittelu (Chapter 12 Alberts et al.) Solunsisäiset rakenteet, kalvostot ja proteiinien lajittelu (Chapter 12 Alberts et al.) Figure 12-1 Molecular Biology of the Cell ( Garland Science 2008) Sytosoli eli solulima Sytosoli määritellään operatiivisesti


Solubiologia ja peruskudokset/ Biolääketieteen laitos/ Anatomia TUMA JA SOLUSYKLI HEIKKI HERVONEN

Solubiologia ja peruskudokset/ Biolääketieteen laitos/ Anatomia TUMA JA SOLUSYKLI HEIKKI HERVONEN Solubiologia ja peruskudokset/ Biolääketieteen laitos/ Anatomia TUMA JA SOLUSYKLI HEIKKI HERVONEN Luku 1 TUMA JA SOLUSYKLI Viereinen kuva on otettu maksakudoksesta tehdystä histologisesta valmisteesta.


Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa

Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa Petter Portin Kysymys siitä, ovatko nykyihminen (Homo sapiens) ja neandertalinihminen (Homo neanderthalensis) kaksi eri lajia vai saman


Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa


Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu


Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122

Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122 Bioinformatiikan maisteriohjelman infotilaisuus 15.11.2007 Exactum D122 Bio- ja lääketieteiden opiskelu MBImaisteriohjelmassa Outi Monni, Dos, FT Biolääketieteen laitos 15.11.2007 Bioinformatiikan maisteriohjelma


PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


Biologia ylioppilaskoe

Biologia ylioppilaskoe Biologia ylioppilaskoe 12 tehtävää, joista kahdeksaan (8) vastataan Tehtävät vaikeutuvat loppua kohden, jokeritehtävät merkitty +:lla Molempiin jokereihin saa vastata ja ne lasketaan mukaan kahdeksaan


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Populaatiosimulaattori. Petteri Hintsanen HIIT perustutkimusyksikkö Helsingin yliopisto

Populaatiosimulaattori. Petteri Hintsanen HIIT perustutkimusyksikkö Helsingin yliopisto Populaatiosimulaattori Petteri Hintsanen HIIT perustutkimusyksikkö Helsingin yliopisto Kromosomit Ihmisen perimä (genomi) on jakaantunut 23 kromosomipariin Jokaisen parin toinen kromosomi on peritty isältä


The Plant Cell / Sytoskeleton

The Plant Cell / Sytoskeleton The Plant Cell / Sytoskeleton Sytoskeleton koostuu solulimassa olevista polymeeriverkostoista Informaatiota rakenteiden 3- ulotteisesta järjestäytymisestä. Solubiologian luennot 2003, kasvitiede Sytoskeletonin


x _ Miksi elinikä ei ole rajaton? Mediterranean fruitfly (Ceratitis capitata) Eliniän jakautuma

x _ Miksi elinikä ei ole rajaton? Mediterranean fruitfly (Ceratitis capitata) Eliniän jakautuma Vanhenemisen fysiologia 1 Elinikä ja vanheneminen Käsitteet Elinikä - yksilön elinikä Eliniän odotusarvo, aktuaarinen (kirjanpidollinen) elinikä - keskimääräinen odotettavissa oleva elinikä tietylle lajille,


Genetiikan perusteiden toisen jakson kaavailua

Genetiikan perusteiden toisen jakson kaavailua Genetiikan perusteiden toisen jakson kaavailua Tiedämme kaiken siitä, miten geenit siirtyvät sukupolvelta seuraavalle solun ja yksilön tasolla Toisen jakson sisältö: Mitä geenit ovat? Miten geenit toimivat?


VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.


Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,


Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa.

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa. 1 1/2011 Parkinsonin taudin perinnöllisyys Geenien ja ympäristötekijöiden vuorovaikutus sairastumisen taustalla Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla


Oksidatiivinen fosforylaatio = ATP:n tuotto NADH:lta ja FADH2:lta hapelle tapahtuvan elektroninsiirron ja ATP-syntaasin avulla

Oksidatiivinen fosforylaatio = ATP:n tuotto NADH:lta ja FADH2:lta hapelle tapahtuvan elektroninsiirron ja ATP-syntaasin avulla Soluhengitys + ATP-synteesi = Oksidatiivinen fosforylaatio Soluhengitys = Mitokondrioissa tapahtuva (ATP:tä tuottava) prosessi, jossa happi toimii pelkistyneiden ravintomolekyylien elektronien vastaanottajana


Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä

Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen. Mendelistinen g. on sen synonyymi Toisessa osassa ryhdymme


Solubiologian luennot Solusykli

Solubiologian luennot Solusykli Solubiologian luennot Solusykli Riitta Julkunen-Tiitto Itä-Suomen yliopisto/ Biologian laitos Joensuun tiedepuisto, Luonnonainetutkimuksen laboratorio Oheislukemisto: Campbell 9. painos: kpl


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Syövän lääkehoito. Salla Kalsi

Syövän lääkehoito. Salla Kalsi Syövän lääkehoito Salla Kalsi Syöpä Yleisnimitys maligneille (pahanlaatuisille) kasvaimille Karsinogeeninen = syöpää aiheuttava Syövän taustalla voi olla Ympäristötekijät, elintavat, perimä, eräät virus-


Miten geenit elelevät populaatioissa, vieläpä pitkiä aikoja?

Miten geenit elelevät populaatioissa, vieläpä pitkiä aikoja? Miten geenit elelevät populaatioissa, vieläpä pitkiä aikoja? Populaatio on lisääntymisyhteisö ja lisääntymisjatkumo Yksilöt ovat geenien tilapäisiä yhteenliittymiä, mutta populaatiossa geenit elelevät


Epigenetiikka, geeninsäätely ja syöpä

Epigenetiikka, geeninsäätely ja syöpä Katsaus Mikko Taipale Epigenetiikka, geeninsäätely ja syöpä Geenitutkimus on totunnaisesti keskittynyt DNA:han. Kuitenkin perimän perusyksikkö kromosomi koostuu DNA:n lisäksi histoneista ja muista proteiineista,


Sekvenssievoluutio ja fylogeniat

Sekvenssievoluutio ja fylogeniat Sekvenssievoluutio ja fylogeniat Miksi sekvenssien evoluutionopeus vaihtelee? -erot korvautumisnopeudessa geenien tai geenin eri osien välillä, -erot korvautumisnopeudessa eri fylogeneettisten linjojen


9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun


Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto

Glioomien molekyylidiagnostiikkaa Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien molekyylidiagnostiikkaa 30.8.2013 Maria Gardberg TYKS-Sapa Patologia / Turun Yliopisto Glioomien WHO-luokitus on morfologinen Gradusten I-IV ryhmittelyn perustana on toiminut ennusteen huononeminen


DNA, RNA ja proteiinirakenteen ennustaminen

DNA, RNA ja proteiinirakenteen ennustaminen S-114.500 Solubiosysteemien perusteet Harjoitustyö Syksy 2003 DNA, RNA ja proteiinirakenteen ennustaminen Ilpo Tertsonen, 58152p Jaakko Niemi, 55114s Sisällysluettelo 1. Alkusanat... 3 2. Johdanto... 4


Soluhengitys + ATP-synteesi = Oksidatiivinen fosforylaatio Tuomas Haltia Elämälle (solulle) välttämättömiä asioita ovat:

Soluhengitys + ATP-synteesi = Oksidatiivinen fosforylaatio Tuomas Haltia Elämälle (solulle) välttämättömiä asioita ovat: Soluhengitys + ATP-synteesi = Oksidatiivinen fosforylaatio Tuomas Haltia 3.12.2012 Soluhengitys = Mitokondrioissa tapahtuva (ATP:tä tuottava) prosessi, jossa happi toimii pelkistyneiden ravintomolekyylien



EUROOPAN PARLAMENTTI EUROOPAN PARLAMENTTI 1999 2004 Ihmisgenetiikkaa ja nykylääketieteen muita uusia tekniikoita käsittelevä väliaikainen valiokunta VÄLIAIKAINEN 26. heinäkuuta 2001 Par2 KERTOMUSLUONNOS Ihmisgenetiikan sosiaaliset,






PROTEIINIEN MUOKKAUS JA KULJETUS PROTEIINIEN MUOKKAUS JA KULJETUS 1.1 Endoplasmakalvosto Endoplasmakalvosto on organelli joka sijaitsee tumakalvossa kiinni. Se on topologisesti siis yhtä tumakotelon kanssa. Se koostuu kahdesta osasta:


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri


Geeninsiirron peruskäsitteet

Geeninsiirron peruskäsitteet Geeninsiirron peruskäsitteet GMO = muuntogeeninen eliö, eliö johon on siirretty toisen eliön perimää Käyttö: biologinen perustutkimus, maatalous (esim. tuottavammat lajikkeet), teollisuus (esim. myrkkyjen


Säteilyn biologiset vaikutukset

Säteilyn biologiset vaikutukset Säteilyn biologiset vaikutukset Sisältö: Luento 1- Säteilylle altistuminen - Säteilyn biologisten vaikutusten fysikaalista ja biokemiallista perustaa Luento 2- Säteilyn biologiset vaikutukset - Solujen


Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi

Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi 19.05.2014 DNA:n sekvensointi DNA:n pilkotaan lyhyiksi mallipalasiksi, templaateiksi, joiden emäsjärjestys selvitetään.


Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen

Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Opintori 10.5.2012 Minna Männikkö Biolääketieteen laitos Lääketieteellisen biokemian ja molekyylibiologian kurssi 15 op, 170 opiskelijaa Kemia:


Genetiikan perusteiden harjoitustyöt

Genetiikan perusteiden harjoitustyöt Genetiikan perusteiden harjoitustyöt Molekyylien kloonaus ja siihen liittyvät taidot ja temput, osa 1 Restriktioentsyymit, elektroforeesi Moniste sivulta 24-: Geenien kloonaus CELL 491- Isolating, cloning,


Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow Genomi Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta Hannu Sariola, Irma Thesleff ja Marja Makarow Malliorganismeiksi kutsutaan lajeja, joita tutkijat käyttävät
