Genomi- ilmentymisen säätely

Save this PDF as:

Koko: px
Aloita esitys sivulta:

Download "Genomi- ilmentymisen säätely"


1 Genomi- ilmentymisen säätely Samuel Myllykangas, FT Biolääke<eteen laitos Helsingin yliopisto Geeni- ilmentyminen Johdanto Säätely Tutkimusmenetelmät Luennon runko 1

2 Johdanto Monisoluisen organismin kaikissa soluissa on sama DNA Johdanto Monisoluisen organismin kaikissa soluissa on sama DNA 2

3 Johdanto Eri solutyypeissä ilmentyvät eri geenit RNA:n ilmentyminen (mikroarray) Proteiinien ilmentyminen (2D gel electrophoresis) Yleiset prosessit (RNA polymeraasi) Erityiset prosessit (Hemoglobiini) 30-60% geeneistä ilmentyy soluissa Geeni- ilmentymisen taso vaihtelee Proteiini- ilmentymisen erot ovat suuria Figure 7-3 Molecular Biology of the Cell ( Garland Science 2008) Johdanto Ympäristö vaikutaa geenien ilmentymiseen Sisäises=: - Kasvutekijät - Hormonit - Metabolii<t - Signaaliproteiinit - Kemikaalit Ulkoises=: - Kemikaalit - Lääkkeet - Lämpö<la - Valo 3

4 Johdanto Geeni- ilmentymistä säädellään useilla mekanismeilla Johdanto Monisoluisen organismin kaikissa soluissa on sama DNA Eri solutyypeissä ilmentyvät eri geenit Ympäristö vaikutaa geenien ilmentymiseen Geeni- ilmentymistä säädellään useilla mekanismeilla 4

5 Geeni- ilmentymisen säätely 1. Transkrip=o 2. RNA:n prosessoinnin säätely 3. RNA:n kuljetuksen säätely 4. Translaa<on säätely 5. mrna:n hajotuksen säätely 6. Proteiinin ak<ivisuuden säätely Transkrip=on jälkeinen säätely Geenien säätelyproteiinit sitoutuvat DNA:han DNA heliksi DNA sekvenssi Proteiinirakennetunnistus Sp1: 5 - GGGCGG 3 3 CCGGCC 5 GATA1: 5 TGATAG 3 3 ACTATC P53: 5 GGGCAAGTCT 3 3 CCCGTTCAGA 5 5

6 1/22/13 Transkrip<on säätely Geenien säätelyproteiinit sitoutuvat DNA:han Heliksi- mutka- heliksi Homeodomain Sinkki- sormiproteiinit Heliksi- luuppi- heliksi B- laskos Transkrip<on säätely Geeni- ilmentymistä säädellään kytkimien avulla E. colin tryptofaanikytkin - Tryptofaanin synteesin geenien operoni - Yksi promootori - Säätelyelemen\ OperaaTori - Tryptofaanirepressori 6

7 Geeni- ilmentymistä säädellään kytkimien avulla Geeni- ilmentymistä säädellään kytkimien avulla DNA- luupit lisäävät säätelyproteiinien välistä vuorovaikutusta Bakteereissa säätely toimii yksinkertaisten DNA luuppien välityksellä 7

8 Eukaryoo\nen transkrip<on säätely on monimutkaista DNA sekvenssi - PromooTori - Säätelyalueet - Enhancer- alueet Proteiinit - Yleiset transkrip<otekijät - Ak<vaaTorit - RNA pol II - MediaaTorit Synergia Eukaryoo\nen transkrip<on säätely on monimutkaista Transkrip<on aloitus (enhancers, repressors) Yksilönkehitys (mm. HOX- geenit) Tumareseptorit (estrogeenireseptori) Reagoin< ympäristötekijöihin, esim. solustressi (heat shock faktori) Solusyklin säätely (onkogeenit, kasvaimenestäjägeenit, esim. MYC, p53) 1/3 ihmisen kehityshäiriöistä johtuu transkrip<ofaktoreiden häiriintyneestä toiminnasta 8

9 Eukaryoo\nen transkrip<on säätely on monimutkaista DNA on pakaku histoneihin - Säätelyproteiinit eivät sitoudu DNA:han - Kroma<inia muokataan aukaisemalla pakkaus - Pakkaus palautuu vaihtelevas< transkrip<on jälkeen - RNA pol II avaa histonipakkausta edellä ja sulkee jäljessä Erikoistuneiden solujen muodostuminen vaa<i tarkkaa geeni- ilmentymisen säätelyä Prokaryooteilla useita genee\siä mekanismeja Phase variaa<o Ma<ng Two- protein circuits (lambda phage prophage- >ly<c) 9

10 Erikoistuneiden solujen muodostuminen vaa<i tarkkaa geeni- ilmentymisen säätelyä Feedback loopit Ajallisia muutoksia Erikoistuneiden solujen muodostuminen vaa<i tarkkaa geeni- ilmentymisen säätelyä Proteiinit säätelevät useiden geenien ilmentymistä Yksi proteiini voi aloikaa lihassolun erilaistumisen 10

11 Erikoistuneiden solujen muodostuminen vaa<i tarkkaa geeni- ilmentymisen säätelyä EpigeneeOset merkit muukuvat elämän aikana EpigeneOset muutokset Erilaiset solut Muutostekijät Erikoistuneiden solujen muodostuminen vaa<i tarkkaa geeni- ilmentymisen säätelyä EpigeneeOset mekanismit 11

12 Geenien säätelyproteiinit sitoutuvat DNA:han Geeni- ilmentymistä säädellään kytkimien avulla Eukaryoo\nen transkrip<on säätely on monimutkaista Erikoistuneiden solujen muodostuminen vaa<i tarkkaa geeni- ilmentymisen säätelyä Transkrip<on jälkeinen säätely 12

13 Transkrip<on jälkeinen säätely RNA:n prosessoinnin säätely Ribokytkimet Transkrip<o pysähtyy Transkrip<on jälkeinen säätely RNA:n prosessoinnin säätely Vaihtoehtoinen RNA:n silmukoin< 13

14 Transkrip<on jälkeinen säätely RNA:n prosessoinnin säätely Pilkkominen Vasta- aine- erityksen säätely Membraaniproteiini (pitkä) EriteTy proteiini (lyhyt) CstF alayksikkö Transkrip<on jälkeinen säätely RNA:n prosessoinnin säätely Editoin< Lukuraamin ja sekvenssin muutokset U nukleo<dejä voidaan lisätä mitokondrion RNA:han Emäsmuutokset Adeniinin deaminaa<o - > Inosine Cytosiinin deaminaa<o - > Uracil 14

15 Transkrip<on jälkeinen säätely RNA:n kuljetuksen säätely Transkrip<on jälkeinen säätely Translaa<on säätely UTR säätely Lämpösensori Ribokytkin An=sense RNA 15

16 Transkrip<on jälkeinen säätely RNA:n hajotuksen säätely Transkrip<on jälkeinen säätely RNA:n prosessoin< RNA:n kuljetus Translaa<on säätely RNA:n hajotuksen säätely 16

17 Geeni- ilmentymisen tutkimusmenetelmät RNA- DNA hybridisaa<o PCR Kroma<ini immunopresipitaa<on DNA mikroarray Uuden polven sekvensoin< RNA häirintä (RNAi) RNA- DNA hybridisaa<o Northern blot Hybridisaa=o (A- T/U, C- G) RNA:n tunnistaminen - Leimatuilla DNA- koe\milla - Elektroforeesi - Nucleiinihappojen siirto kalvolle - Visualisoin< 17

18 Polymeraasiketjureak<o (PCR) Exponen=al amplifica=on of targets - Heat- stable DNA polymerase - Specific primers (fwd and rev) - Thermal cycling - dntps Kroma<ini- immunopresipitaa<o DNA:n ja proteiinien vuorovaikutusten tutkiminen - Transkrip<otekijät - > promootori - RNA polymeraasi - > geeni - Histone - > DNA - Perustuu spesifisiin vasta- aineisiin 18

19 DNA- DNA hybridisaa=o DNA mikroarray DNA mikroarray Geeni- ilmentyminen DNA mikroarraykoe Uuden polven sekvensoin< Sanger DNA sekvensoin< Geeli- elektroforeesisekvensoin= Genomic DNA Fragmented DNA Sequencing library Kapillaarisekvensoin= Immobilization Polony array Cycles Next-generation sequencing A C C G T A T G C T G T A A G C Illumina Genome Analyzer sequencing Library immobilization Bridge amplification *T TTTT Dye termina=on sequencing - Single reac<on - Fluorescent dyes - Capillary electrophoresis *T Reversible terminator nucleotides *T *T TTTTTTTTTTTTT TTTT *T TTTTTTTTTTTTT TTTT T TTTTTTTTTTTTT 19

20 Uuden polven sekvensoin< Sekvensoin<kapasitee\ on lisääntynyt massiivisen parallelisoinnin ansiosta Prepara<on Genomic DNA Fragmented DNA Cloning Amplification Capillary electrophoresis Sanger sequencing Sekvensoin=keskus - Robo<ikkaa - 3 M emästä/päivä Uuden polven sekvensoin< Sekvensoin<kapasitee\ on lisääntynyt massiivisen parallelisoinnin ansiosta Prepara<on Genomic DNA Fragmented DNA Cloning Amplification Capillary electrophoresis Sanger sequencing Genomic DNA Fragmented DNA Sequencing library Immobiliza<on Polony array Cycles Next-generation sequencing Laboratorio: M/päivä A C C G T A T G C T G T A A G C 20

21 Uuden polven sekvensoin< Sekvensoin<kapasitee\ on lisääntynyt massiivisen parallelisoinnin ansiosta Light microscopy Single molecule Nonop=c Available In progress R&D phase Gnubio Stratos Genomics Halcyon ZS Gene<cs Bionanomatrix Lightspeed Nanophotonics Biosci Base4Innova<on GenizonBioSci LaserGen GE Global Genovoxx Visigen/Starlight Genapsys Mobius Genomics Raveo Nanopore sequencing Nabsys Oxford Nanopore Electronic Biosciences IBM- Roche Genia NobleGen Uuden polven sekvensoin< Sekvensoin<kapasitee\ on lisääntynyt massiivisen parallelisoinnin ansiosta Menetelmät parantuvat ja kustannukset alenevat Illumina MiSeq Virtauskenno (flow cell) 21

22 Uuden polven sekvensoin< Sekvensoinnin avulla voidaan tutkia geenien ilmentymistä RNA häirintä (RNAi) Mekanismi RNAi = RNA interference, RNA:n hiljentäminen Molekyylit, jotka hiljentävät RNA:n sirna = small interfering RNA Täydellinen pariutuminen kohde mrna- molekyylin kanssa johtaa mrna:n hajoamiseen mirna = microrna Täydellinen tai epätäydellinen pariutuminen kohde mrna:n kanssa johtaa mrna:n hajoamiseen tai proteiinisynteesin estoon Kokeelliset työvälineet laboratoriossa geenien hiljentämiseen sirna = small interfering RNA shrna = small hairpin RNA 22

23 RNA häirintä (RNAi) Geenin hiljentäminen RNAi:n avulla Green and red lines show cell index values for two different sirnas the light blue line shows the control without sirna the dark blue and pink lines show controls with inac<ve sirnas. Geeni- ilmentymisen tutkimusmenetelmät RNA- DNA hybridisaa=on avulla voidaan tunnistaa transkripteja PCR:n avulla pystytään monistamaan ja eristämään <etyjä sekvenssejä genomista Kroma=ini- immunoprosipitaa=o mahdollistaa proteiinien ja DNA:n välisten vuorovaikutusten tutkimuksen DNA mikroarrayn avulla voidaan tutkia kaikkien ihmisen geenien RNA- tason ilmentymistä Uuden polven sekvensoin= on kehitynyt viime vuosina huimas< ja on syrjäytämässä DNA mikroarrayn RNAi mahdollistaa <etyjen geenien hiljentämisen koe- eläimessä 23

Genomi- ilmentymisen säätely

Genomi- ilmentymisen säätely Genomi- ilmentymisen säätely Samuel Myllykangas, FT Biolääke=eteen laitos Helsingin yliopisto 21.1.2014 Geeni- ilmentyminen Johdanto Säätely Tutkimusmenetelmät Luennon runko 1 Johdanto Monisoluisen organismin


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia

Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Genomi-ilmentyminen Genom expression (uttryckning) DNA RNA 7.12.2017 Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Osaamistavoitteet Lärandemål Luennon jälkeen ymmärrät pääperiaatteet


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30 Tampereen yliopisto Bioteknologian tutkinto-ohjelma Valintakoe 21.5.2015 Henkilötunnus - Sukunimi Etunimet Tehtävä 3 Pisteet / 30 3. a) Alla on lyhyt jakso dsdna:ta, joka koodaa muutaman aminohappotähteen


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja


Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi


Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen


Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi)

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) CHEM-A1310 Biotieteen perusteet Heli Viskari 2017 DNA-harjoitustöiden aikataulu, valitse yksi näistä


Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1 1) Tunnista molekyylit (1 piste) ja täytä seuraava taulukko (2 pistettä) a) b) c) d) a) Syklinen AMP (camp) (0.25) b) Beta-karoteeni (0.25 p) c) Sakkaroosi (0.25 p) d) -D-Glukopyranoosi (0.25 p) 2 Taulukko.


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein


DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit


Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi

Tulehdus ja karsinogeneesi. Tulehduksen osuus syövän synnyssä. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi. Tulehdus ja karsinogeneesi Tulehduksen osuus syövän synnyssä Ari Ristimäki, professori Patologia Helsingin yliopisto esiasteissa ja useissa eri syöpäkasvaintyypeissä. 1 A Mantovani, et al. NATURE Vol 454 24 July 2008 Figure 15.22d


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio:

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio: -mesenkyymi-vuorovaikutukset, esimerkkinä hammas ja ihokarva elimiä muodostuu kaikista alkiokerroksista, usein epiteelin ja mesenkyymin vuorovaikutuksesta epiteeli ektodermi kumpi aloittaa elimen kehityksen:


Solun tuman rakenne ja toiminta. Pertti Panula Biolääketieteen laitos 2012

Solun tuman rakenne ja toiminta. Pertti Panula Biolääketieteen laitos 2012 Solun tuman rakenne ja toiminta Pertti Panula Biolääketieteen laitos 2012 Hermosolun rakkulamainen tuma Monenlaisia tumia Valkosolujen tumien monimuotoisuutta Lähde: J.F.Kerr, Atlas of Functional Histology



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin


Ribosomit 1. Ribosomit 2. Ribosomit 3

Ribosomit 1. Ribosomit 2. Ribosomit 3 Ribosomit 1 Palade & Siekevitz eristivät jaottelusentrifugaatiolla ns. mikrosomeja radioakt. aminohapot kertyivät mikrosomeihin, jotka peräisin rer:ää sisältävistä soluista proteiinisynteesi soluliman



NON-CODING RNA (ncrna) NON-CODING RNA (ncrna) 1. Yleistä NcRNA eli non-coding RNA tarkoittaa kaikkia proteiinia koodaamattomia rnamolekyylejä. Näistä yleisimmin tunnetut ovat ribosomaalinen RNA (rrna) sekä siirtäjä-rna (trna),


Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä


Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä

Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Reportterigeenit ja reportterikonstruktiot? Monissa tilanteissa tarvitaan ilmaisinta (proobi, luotain, reportteri) kertomaan, mitä/missä/milloin


Tuberkuloosin diagnostiikka

Tuberkuloosin diagnostiikka Tuberkuloosin diagnostiikka 30. Valtakunnalliset Tartuntatautipäivät, Helsinki 13.11.2017 Jussi Eskola, dosentti (ei sidonnaisuuksia) Tuberkuloosidiagnostiikan kehittyminen 1910-luku: tuberkuliinikoe 1920-


PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä



ENTSYYMIKATA- LYYSIN PERUSTEET (dos. Tuomas Haltia) ENTSYYMIKATA- LYYSIN PERUSTEET (dos. Tuomas Haltia) Elämän edellytykset: Solun täytyy pystyä (a) replikoitumaan (B) katalysoimaan tarvitsemiaan reaktioita tehokkaasti ja selektiivisesti eli sillä on oltava


T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...


- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa Kertaus CHEM-C2300 0 Tällä luennolla: - Oletteko lukeneet artikkelia, käydäänkö läpi? - Ehdotuksia tenttikysymyksiin? - Käydään läpi kurssin keskeiset asiakokonaisuudet otsikkotasolla - Extra: PCR-alukkeiden


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat


Biotieteiden perusteet farmasiassa, syksy 2017

Biotieteiden perusteet farmasiassa, syksy 2017 Biotieteiden perusteet farmasiassa, syksy 2017 Maarit Kortesoja Farmaseuttisten biotieteiden osasto 23.8.2017 1 Opintojakson tavoitteet Opintojakson suoritettuaan opiskelija Osaa kuvata entsyymien rakenteen


Essential Cell Biology

Essential Cell Biology Alberts Bray Hopkin Johnson Lewis Raff Roberts Walter Essential Cell Biology FOURTH EDITION Chapter 16 Cell Signaling Copyright Garland Science 2014 1 GENERAL PRINCIPLES OF CELL SIGNALING Signals Can Act


9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun


6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto.

Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto. Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto Nukleiinihapot! kertausta matkan varrella, vähemmän kuitenkin


Genetiikan perusteiden harjoitustyöt

Genetiikan perusteiden harjoitustyöt Genetiikan perusteiden harjoitustyöt Molekyylien kloonaus ja siihen liittyvät taidot ja temput, osa 1 Restriktioentsyymit, elektroforeesi Moniste sivulta 24-: Geenien kloonaus CELL 491- Isolating, cloning,


Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se



PROTEIINIEN MUOKKAUS JA KULJETUS PROTEIINIEN MUOKKAUS JA KULJETUS 1.1 Endoplasmakalvosto Endoplasmakalvosto on organelli joka sijaitsee tumakalvossa kiinni. Se on topologisesti siis yhtä tumakotelon kanssa. Se koostuu kahdesta osasta:


Sytosoli eli solulima. Sytosoli. Solunsisäiset rakenteet, kalvostot ja proteiinien lajittelu (Chapter 12 Alberts et al.)

Sytosoli eli solulima. Sytosoli. Solunsisäiset rakenteet, kalvostot ja proteiinien lajittelu (Chapter 12 Alberts et al.) Solunsisäiset rakenteet, kalvostot ja proteiinien lajittelu (Chapter 12 Alberts et al.) Figure 12-1 Molecular Biology of the Cell ( Garland Science 2008) Sytosoli eli solulima Sytosoli määritellään operatiivisesti


LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä



Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa


Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset


Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä



BIOLOGIAN OSIO (45 p.) BIOLÄÄKETIETEEN KOULUTUSOHJELMA PÄÄSYKOE 17.5.2017 BIOLOGIAN OSIO (45 p.) HYVÄN VASTAUKSEN PIIRTEET I) Esseetehtävät (2 kpl) a) Selitä perustellen, miten kuvaan merkittyihin kohtiin osuvat mutaatiot voivat


Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93.

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93. 1 I) Ovatko väittämät oikein (O) vai väärin (V)? Jos väite on mielestäsi väärin, perustele se lyhyesti väittämän alla oleville riveille. O/V 1.2. Downin oireyhtymä johtuu pistemutaatista fenyylialaniinin


Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien


? LUCA (Last universal common ancestor) 3.5 miljardia v.

? LUCA (Last universal common ancestor) 3.5 miljardia v. Mitä elämä on? - Geneettinen ohjelma, joka kykenee muuttamaan ainehiukkaset ja molekyylit järjestyneeksi itseään replikoivaksi kokonaisuudeksi. (= geneettistä antientropiaa) ? LUCA (Last universal common


Oligonukleotidi-lääkevalmisteet ja niiden turvallisuuden tutkiminen - Sic!

Oligonukleotidi-lääkevalmisteet ja niiden turvallisuuden tutkiminen - Sic! Page 1 of 5 JULKAISTU NUMEROSSA 3-4/2017 EX TEMPORE Oligonukleotidi-lääkevalmisteet ja niiden turvallisuuden tutkiminen Enni-Kaisa Mustonen / Kirjoitettu 18.12.2017 / Julkaistu Oligonukleotidit ovat nukleotideista


Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa


Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.


Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015 Katekoli-O-metyylitransferaasi ja kipu Oleg Kambur Kipu Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 1 Katekoli-O-metyylitransferaasi (COMT) proteiini tuotetaan


Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset EU:ssa ei ole yleisesti hyväksyttyä elintarvikepetosten määritelmää. Yleinen ohjeistus löytyy elintarvikelainsäädäntöä


DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri


Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna Ihmisen keho muodostuu miljardeista soluista. Vaikka nämä solut ovat tietyssä mielessä meidän omiamme, ne polveutuvat itsenäisistä yksisoluisista elämänmuodoista, jotka ovat säilyttäneet monia itsenäisen





Francis Crick ja James D. Watson

Francis Crick ja James D. Watson Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel-palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän


DNA, RNA ja proteiinirakenteen ennustaminen

DNA, RNA ja proteiinirakenteen ennustaminen S-114.500 Solubiosysteemien perusteet Harjoitustyö Syksy 2003 DNA, RNA ja proteiinirakenteen ennustaminen Ilpo Tertsonen, 58152p Jaakko Niemi, 55114s Sisällysluettelo 1. Alkusanat... 3 2. Johdanto... 4


VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.


Syvien biosfäärien geomikrobiologia - Molekyylibiologiset monitorointimenetelmät, GEOMOL

Syvien biosfäärien geomikrobiologia - Molekyylibiologiset monitorointimenetelmät, GEOMOL Syvien biosfäärien geomikrobiologia - Molekyylibiologiset monitorointimenetelmät, GEOMOL KYT seminaari 26.9.2008 Merja Itävaara Projektin tausta Miksi geomikrobiologiaa tutkitaan? Loppusijoitusalueen hydrogeokemiallinen





Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


II Genetiikka 4.(3) Nukleiinihapot

II Genetiikka 4.(3) Nukleiinihapot II Genetiikka 4.(3) Nukleiinihapot Geenitekniikka - menetelmiä, joiden avulla dna:ta ja rna:ta voidaan eristää, muokata ja siirtää muihin soluihin tai eliöihin kromosomit koostuvat dna-rihmasta ja siihen



Ma > GENERAL PRINCIPLES OF CELL SIGNALING Ma 5.12. -> GENERAL PRINCIPLES OF CELL SIGNALING Cell-Surface Receptors Relay Extracellular Signals via Intracellular Signaling Pathways Some Intracellular Signaling Proteins Act as Molecular Switches


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Virukset lääketieteen apuvälineinä. Veijo Hukkanen, Veli-Matti Kähäri ja Timo Hyypiä

Virukset lääketieteen apuvälineinä. Veijo Hukkanen, Veli-Matti Kähäri ja Timo Hyypiä Kuvat kertovat Veijo Hukkanen, Veli-Matti Kähäri ja Timo Hyypiä Virusten molekyylitasoinen tuntemus on tehnyt mahdolliseksi hyödyntää viruksia niiden luonnollisessa tehtävässä geenien kuljettimina eli


Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina


5.2.2 IGF-I / MGF... 39 5.2.3 Insuliini... 41 5.2.4 Kasvuhormoni... 41 5.2.5 Androgeenit - testosteroni... 42 5.2.6 Kortisoli... 43 5.

5.2.2 IGF-I / MGF... 39 5.2.3 Insuliini... 41 5.2.4 Kasvuhormoni... 41 5.2.5 Androgeenit - testosteroni... 42 5.2.6 Kortisoli... 43 5. HERAPROTEIININ VAIKUTUS MYOSTATIININ JA SOLUSYKLIÄ SÄÄTELEVIEN GEENIEN ILMENTYMISEEN SEKÄ NÄIDEN YHTEYS ANDROGEENEIHIN VOIMA- HARJOITUKSEN YHTEYDESSÄ IKÄÄNTYNEILLÄ MIEHILLÄ Inna Lisko Pro gradu -tutkielma


Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet


Käänteistransfektio primäärisiin hermosoluihin

Käänteistransfektio primäärisiin hermosoluihin Käänteistransfektio primäärisiin hermosoluihin Vesa Huusko Pro gradu -tutkielma Biotieteiden koulutusohjelma Itä-Suomen yliopiston luonnontieteiden ja metsätieteiden tiedekunta / biotiede Maaliskuu 2012


Oksidatiivinen fosforylaatio = ATP:n tuotto NADH:lta ja FADH2:lta hapelle tapahtuvan elektroninsiirron ja ATP-syntaasin avulla

Oksidatiivinen fosforylaatio = ATP:n tuotto NADH:lta ja FADH2:lta hapelle tapahtuvan elektroninsiirron ja ATP-syntaasin avulla Soluhengitys + ATP-synteesi = Oksidatiivinen fosforylaatio Soluhengitys = Mitokondrioissa tapahtuva (ATP:tä tuottava) prosessi, jossa happi toimii pelkistyneiden ravintomolekyylien elektronien vastaanottajana


Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut Hemopoiesis Tuma Mitochondrion Tuma 2 Flagellum Peroxisome Centrioles Microfilaments Microtubules Nuclear envelope Rough endoplasmic reticulum Ribosomes NUCLEUS muoto: pallomainen liuskoittunut (esim.


Nimi sosiaaliturvatunnus

Nimi sosiaaliturvatunnus Valintakoe 2013 / Biokemia Nimi sosiaaliturvatunnus 1. Selitä: (3,0 p) a) Mitä ovat eksonit ja intronit ja miten ne eroavat toisistaan? b) Mitä eläinsolulle tapahtuu, jos se laitetaan sen sisällä olevaa


Ei yksin geeneistä ja elintavoista

Ei yksin geeneistä ja elintavoista Mielenterveysmessut 2016 Wanha Satama 22.11. Ei yksin geeneistä ja elintavoista Mitä bio;eteet sanovat toisen ihmisen merkityksestä terveydelle Vienna Setälä- Pynnönen VTT, FL bioe;ikka, terveysvies;nnän


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia



BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava


Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira

Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa Annikki Welling Kemian laboratoriopalvelut Evira Sisältö Elintarvikepetokset Menetelmiä elintarvikepetosten tunnistamiseksi DNA menetelmät DNA viivakoodaus


(Jatkotutkinto-opiskelija, Helsingin yliopisto: eläinlääketieteen tohtorin tutkinto 2.6.2007 )

(Jatkotutkinto-opiskelija, Helsingin yliopisto: eläinlääketieteen tohtorin tutkinto 2.6.2007 ) CURRICULUM VITAE Opetustehtävät Tuija Kantala, yliopisto-opettaja (sijainen), jatkotutkinto-opiskelija KOULUTUS Eläinlääketieteen lisensiaatti, Helsingin yliopisto, 2006 (Jatkotutkinto-opiskelija, Helsingin


Ribosomit 1. Ribosomit 4. Ribosomit 2. Ribosomit 3. Proteiinisynteesin periaate 1

Ribosomit 1. Ribosomit 4. Ribosomit 2. Ribosomit 3. Proteiinisynteesin periaate 1 Ribosomit 1 Ribosomit 4 Palade & Siekevitz eristivät jaottelusentrifugaatiolla ns. mikrosomeja radioakt. aminohapot kertyivät mikrosomeihin, jotka peräisin rer:ää sisältävistä soluista proteiinisynteesi


Miksi tutkia kasveja?

Miksi tutkia kasveja? Miksi tutkia kasveja? Why Study Plants From the Teaching Tools in Plant Biology Created by the American Society for Plant Biology and published on the website of The Plant Cell (


Yoshinori Ohsumille Syntymäpaikka Fukuoka, Japani 2009 Professori, Tokyo Institute of Technology

Yoshinori Ohsumille Syntymäpaikka Fukuoka, Japani 2009 Professori, Tokyo Institute of Technology Lääketieteen Nobel-palkinto 2016 Yoshinori Ohsumille hänen autofagian mekanismeja koskevista löydöistään. Yoshinori Ohsumi 1945 Syntymäpaikka Fukuoka, Japani 2009 Professori, Tokyo Institute of Technology


FIMM Technology Services FIMM:n teknologiapalvelut 1

FIMM Technology Services FIMM:n teknologiapalvelut 1 FIMM Technology Services FIMM:n teknologiapalvelut 1 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based


Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan. Minna Äikäs. Metropolia Ammattikorkeakoulu. Bioanalyytikko (AMK)

Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan. Minna Äikäs. Metropolia Ammattikorkeakoulu. Bioanalyytikko (AMK) Minna Äikäs Koko genomin monistamiseen tarkoitettujen kittien soveltuvuus alkiodiagnostiikkaan Metropolia Ammattikorkeakoulu Bioanalyytikko (AMK) Koulutusohjelma Opinnäytetyö 23.4.2014 Tiivistelmä Tekijä


Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki


MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta)

MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta) Tehtävä Pisteet a) Mitkä ovat solussa DNA:n, mitkä RNA:n tehtäviä? Miksi mielestäsi DNA on valikoitunut kaikkien solullisten organismien perintöainekseksi? max 5 DNA: perinnöllisen tiedon säilyttäminen


Biologia ylioppilaskoe

Biologia ylioppilaskoe Biologia ylioppilaskoe 12 tehtävää, joista kahdeksaan (8) vastataan Tehtävät vaikeutuvat loppua kohden, jokeritehtävät merkitty +:lla Molempiin jokereihin saa vastata ja ne lasketaan mukaan kahdeksaan


FIMM Technology Services FIMM:n teknologiapalvelut 1

FIMM Technology Services FIMM:n teknologiapalvelut 1 FIMM Technology Services FIMM:n teknologiapalvelut 1 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based


Massaspektrometria ja kliiniset proteiinibiomarkkerit

Massaspektrometria ja kliiniset proteiinibiomarkkerit Massaspektrometria ja kliiniset proteiinibiomarkkerit 1 Leena Valmu FT, Dosentti, R&D Manager The world leader in serving science MS ja kliiniset proteiinibiomarkkerit Biomarkkereiden massaspektrometria


Anatomia ja fysiologia 1 Peruselintoiminnat

Anatomia ja fysiologia 1 Peruselintoiminnat Anatomia ja fysiologia 1 Peruselintoiminnat Solu Laura Partanen Yleistä Elimistö koostuu soluista ja soluväliaineesta Makroskooppinen mikroskooppinen Mm. liikkumiskyky, reagointi ärsykkeisiin, aineenvaihdunta


Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan?

Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Antipodidiversiteetin generointi Robert Koch (TB) 1905 Niels K. Jerne



