T Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

Koko: px
Aloita esitys sivulta:

Download "T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa"

Transkriptio

1 T Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E

2

3 Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA MOLEKYYLIBIOLOGIAN PERUSTEET DNA-MIKROSIRUTEKNOLOGIA SIGNAALINKÄSITTELYN MENETELMÄT MIKROSIRUDATAN PROSESSOINNISSA KUVASTA DATAKSI TILASTOLLINEN ANALYYSI KUNNIAAN AIKASARJADATA YHTEENVETO LÄHTEITÄ JA LISÄTIETOA... 4

4

5 11/24/ Johdanto DNA-mikrosiruteknologia on mullistanut molekyylibiologian tutkimuksen. Aikaisemmin tutkijat tutkivat yhtä molekyyliä kerrallaan. Nyt voidaan yhdestä kudosnäytteestä mitata tuhansien geenien yhtäaikaista toimintaa. Mikrosirudatan myötä on biologisen tiedon määrä ja luonne kuitenkin kasvanut valtavasti. Aikaisemmin pärjättiin visuaalisella tarkastelulla, ja hypoteeseihin saatiin kyllä ja ei -tyyppisiä vastauksia. Nyt numeerista dataa on enemmän kuin ihmissilmä ja -aivot kykenevät kerralla prosessoimaan, joten laskennalliset menetelmät ovat välttämättömiä myös perinteisesti ei-matemaattisessa biologiassa. Tässä tutkielmassa tarkastellaan DNA-mikrosirudatan analysointia signaalinkäsittelyn menetelmien avulla. Aiheesta ei ole mitään yksittäistä lähdeteosta, koska ala on vielä niin uusi. Lähteenä toimivat useat erilaiset tieteelliset artikkelit, koulusivistys ja vuoden työkokemus alalta. Tämä tutkielma on pikemminkin tekijänsä tulkinta aikaisempien tietojensa ja signaalinkäsittelyn kurssilla oppimansa materiaalin yhdistämisestä. Luvussa 2 kuvaillaan DNA-mikrosiruteknologian perusteet ja sitä millaisiin kysymyksiin sillä etsitään vastauksia. Luvussa 3 käydään läpi mikrosiruanalyysissä käytetyimpiä ja välttämättömimpiä signaalinkäsittelyn menetelmiä. Luvussa 4 esitetään vielä yhteenveto ja loppusanat. 2 Biologiaa DNA-mikrosiruteknologialla 2.1 Molekyylibiologian perusteet Elollinen aine koostuu itsenäisistä yksiköistä, soluista. Solun tuma on sen komentokeskus, jossa sijaitsee elämän ohjekirja, DNA-molekyylit. DNA koodaa bioaktiivisia makromolekyylejä, proteiineja, jotka osallistuvat lähes kaikkeen elävässä aineessa tapahtuvaan toimintaan. Ihmisen solun DNA koostuu noin 3 miljardista neljän erilaisen nukleotidiemäksen muodostamasta ketjusta. Geeni on lyhyt ( emäsparia pitkä) proteiinia koodaava pätkä DNA:ta. Ihmisen genomin arvioidaan koostuvan noin geenistä. Solu vastaa ympäristöstä saamiinsa ärsykkeisiin esimerkiksi valmistamalla proteiineja eli expressoimalla geenejään. DNA-mikrosiruteknologialla voidaan mitata geenin ekspressiotasoa. Molekyylibiologian keskusdogman mukaan DNA makes RNA makes protein eli DNA tekee RNA:n (DNA:n tyyppinen molekyyli), joka tekee proteiinin. Tämän hetkisen käsityksen mukaan geenin korkea ekspressiotaso johtaa sitä geeniä vastaavan proteiinin suureen tuotantoon. Tämän hetkinen molekyylibiologian suurimpia haaste on ymmärtää solun toimintaa ja geenien säätelyverkkoja geeniekspressiodatan avulla. Tällä hetkellä kahden organismin, hiivan (Saccharomycces cerecisiae) ja banaanikärpäsen (Drosophila melanogaster) geenisäätelyverkot tunnetaan pääpiirteittäin. Näiden eliöiden genomit koostuvat reilusti alle :sta geenistä. Geenisäätelyverkkojen tunteminen on vain yksi askel matkalla solun toiminnan selvittämiseen. Ei nimittäin riitä, että tiedetään geenin A aktivoivan geeniä B. Voi nimittäin olla, että geeni B aktivoituu vain silloin, kun geenin A ekspressio ylittää tietyn kynnysarvon. Toisaalta geeni C saattaa deaktivoitua silloin, kun geeni A aktivoi geenin B. Pitää muistaa,

6 11/24/ että ihmisen genomissa on noin muuttujaa, joista jotkut voivat vuorovaikuttaa useammankin kohteen kanssa. Molekyylibiologisen tiedon uskotaan tuottavan tulevaisuudessa uusia hoitomuotoja ja lääkkeitä perinöllisten sairauksien hoitoon. Puhutaan ns. räätälöidyistä lääkkeistä, myös siitä, että samaan vaivaan voidaan määrätä kahdelle eri henkilölle täysin erilaista lääkettä näiden henkilöiden geneettisen sormenjäljen, eli perimän, perusteella. Jo nyt on näyttöä siitä, että esimerkiksi sydän- ja verisuonitaudeilla on geneettisiä alttiustekijöitä ja että ihmiset, joilla on geenimuoto A eräästä geenistä hyötyvät olemassa olevasta lääkkeestä, kun taas potilaat, joilla on geenimuoto B, eivät hyödy samasta kalliista hoidosta mitenkään, koska heidän solunsa eivät kykene hyödyntämään sitä. 2.2 DNA-mikrosiruteknologia DNA-mikrosiruteknologia on yksinkertaisuudessaan sitä, että mitataan kuinka paljon mikrosirulle laitettua DNA-koetinta vastaavaa geeniä on tutkittavassa näytteessä. Fyysisesti mikrosiru on noin neliösenttimetrin kokoinen lasilevy, jolle sijoitetaan eri geeniä vastaavia koettimia. Esimerkiksi ihmisen geenejä mittaavissa siruissa on noin erilaista mittauspistettä, koetinsekvenssityyppiä, yhden neliösenttimetrin alueella. Lisäksi jokaisesta koetinsekvenssistä on miljoonia replikaatteja yhdessä mittauspisteessä. Käytännössä tutkittava DNA-näyte uutetaan perinteisillä molekyylibiologian tekniikoilla solusta. Koska yhdestä solusta ei voida saada tarpeeksi suurta määrää DNA:ta, otetaan näyte kudoksesta, joka on samankaltaisten solujen muodostama funktionaalinen kokonaisuus. Näyte leimataan fluoresoivalla aineella ja pipetoidaan mikrosirulle sekä annetaan näytteen DNA:n hybridisoitua eli liittyä koettimiin (Kuva 1). Tämän jälkeen siru skannataan laser-skannerilla. Laser saa näytteen fluoresenssileiman emittoimaan valoa ja skanneri vastaanottaa tuon valon intensiteetin. Tämän vaiheen jälkeen mikrosirudata on sähköisessä muodossa ja datan prosessointi alkaa. Kuva 1DNA-näyte otetaan soluryhmistä. Näytteen annetaan tarttua mikrosirun koettimiin. Näytteen emittoima fluoresenssivalo havaitaan skannerilla. Tuloksena on kuva geeniekspressioiden intensiteeteistä.[1]

7 11/24/ Signaalinkäsittelyn menetelmät mikrosirudatan prosessoinnissa 3.1 Kuvasta dataksi Skannauksen tuloksena on harmaaväripikselikuva, jossa kutakin mittauspistettä vastaa 16 pikseliä. Yleensä näiden 16 pikselin intensiteeteissä on hajontaa. Ensimmäinen tehtävä on siis määrittää, mikä on oikeasta geenin ekspressiosta tulevaa signaalia ja mikä taustakohinaa. Tämä on vaativa hahmontunnistustehtävä. Tarkoitus kun on erottaa viereiset mittauspisteet toisistaan ja tämän jälkeen vielä päättää mittauspisteiden sisäisen hajonnan tarkastelun jälkeen kompromissiarvo mittauspisteen geeniekspressiolle. Mittana voidaan käyttää mittauspisteen pikseleiden keskiarvoa, mediaania tai jotain muuta sopivaa arvoa. Mikrosiruja käytettäessä taustakohinan erottaminenkin on toisinaan ongelma. Käytännön teknisten ongelmien vuoksi taustakohina on erilaista sirun eri kohdissa. Esimerkiksi sirun reunoilla kohinaongelma on yleensä suurempi. Siksi taustakohinan poistamiseksi ei ole yhtä ja ainoata oikeaa ratkaisua. Tavoitteena olisi kuitenkin, että taustakohina, jos sitä ei voida poistaa kokonaan, ei olisi paikkariippuva. Skannatusta kuvasta lasketaan kohinanpoiston jälkeen geeniekspressiointensiteetit eli kuinka paljon kutakin geeniä ilmentyy tutkittavassa kudoksessa sillä ajan hetkellä ( lukumäärä ). Näitä intensiteettiarvoja käytetään, kun dataa aletaan tutkia tiedon löytämiseksi. Kuva 2 esittää kohinapoistettua ja false colour -värjättyä ekspressiodataa, josta ei vielä sinällään saada kunnollista tietoa, mutta voidaan osoittaa silmämääräiset ekspressiotasot. Vihreät ja punaiset pisteet osoittavat, että näytteistä joko vihreällä tai punaisella leimatut molekyylit dominoivat mittauspisteen geenin ilmentymistä. Keltainen väri indikoi, että molempien näytteiden geenien ekspressiot ovat kutakuinkin samat. Mustilta alueilta ei olla saatu mittausdataa. Joko siinä ei edes ole ollut koetinta mittaamaan geenin ekspressiota tai sitten ekspressiotaso ei ole yltänyt skannerin resoluutiotasolle. Kuva 2Geeniekspressiodata kuvana: hiivan geeniekspressio. [1], modifioitu

8 3.2 Tilastollinen analyysi kunniaan 11/24/2003 On muistettava, että mikrosirulla mitattu DNA on peräisin useista tuhansista soluista. Koska solut ovat itsenäisiä ympäristöönsä reagoivia yksiköitä, niiden geeniekspressiot eivät ole identtisiä. Voidaan kuitenkin olettaa, että kukin näytteen solu on osallisena yhtä suurella painolla ja siksi tulkita datapiste näytteen geeniekspressioiden keskiarvoksi. Tämä koskee siis vain yhtä datakuvan pikseliä. 3.3 Aikasarjadata Lienee helpointa tarkastella mikrosirudatan tulkintaa ja analyysiä signaalinkäsittelyn kannalta aikasarjojen avulla. DNA-mikrosiruista saadaan aikasarjadataa vain silloin, kun näytteitä otetaan tietyin aikavälein ja kustakin näytteestä tehdään oma sirunsa. Biologiset aikasarjat eroavat kuitenkin monista muista aikasarjoista. Ensinnäkin näytteitä on vaikea saada juuri tietyllä ajanhetkellä, koska näytteiden kanssa on oltava hyvin varovainen. Toisekseen DNA-analytiikka on hyvin kallista. Yksi sirukoe maksaa noin 1000 euroa. Toisin sanoen dataa ja taustatietoa on vähän ja aikasarjan näytteenottoajankohdat saattavat olla hieman epämääräiset. Useat biologiset prosessit ovat luonteeltaan syklisiä. Myös solun elämä on jatkuvaa kiertoa: solu jakaantuu, ylläpitää toimintojaan, valmistautuu jakaantumaan ja jakaantuu uudelleen. On hyvin tyypillistä, että tietoa etsiessä halutaan löytää geenit, joiden ekspressiot muuttuvat solusyklin mukana. Olettaen, että datassa on jotain jaksollisia komponentteja, ne pitäisi pystyä löytämään Fourier-muunnoksen avulla. Samalla nähdään minkä pituisia jaksoja ja kuinka voimakkaasti näitä jaksoja on olemassa. Joskus voidaan haluta selvittää jonkin geeniperheen reagointia tiettyyn ärsykkeeseen, esimerkiksi sitä miten koivuallergisen ihmisen silmäluomen epiteelisolut reagoivat koivun siitepölyyn. Tämän jälkeen voidaan seurata näiden geenien ekspressiotasojen muutoksia. Hyvänä apuna on risti- ja autokorrelaatiofunktiot, koska ihmissilmä näkee mieluusti korrelaatioita ja riippuvuuksia myös siellä, missä niitä ei oikeasti ole. 4 Yhteenveto Tässä tutkielmassa tarkasteltiin lyhyesti tavallisimpia signaalinkäsittelyn työkaluja mikrosiruanalytiikassa. Huomattiin, että ongelma on vaikea ja että vastauksia on vähemmän kuin kysymyksiä. Ymmärrettävien lähteiden vähyys on yksi ongelmista, joten asian käsittämisksi tarvitsee yhdistellä omia kokemuksia koulussa opittuihin asioihin. Kirjallisuudesta saa hyviä ideoita, ongelmaksi muodostuu kuitenkin se, että julkaisuissa mennään hyvin nopeasti niin syvälle, että ymmärryksen taso laskee eksponentiaalisesti luettujen sanojen määrän kasvaessa. Tässä tutkielmassa on lisäksi jätetty tilastolliset analyysimenetelmät kokonaan käsittelemättä, koska niiden käytössä on kyse jo muustakin kuin signaalinkäsittelystä. Lienee kuitenkin aiheellista muistaa ja korostaa vielä sitä, että signaalinkäsittely on kaiken DNA-mikrosiruanalyysin perusta, jota ilman ei koko dataa edes olisi olemassa. 4 5 Lähteitä ja lisätietoa Tässä tutkielmassa on käytetty lähteinä lähinnä tekijän omaa käytännön työkokemusta ja koulusivistystä aihealueen piiristä. Aihealueen kirjallisuus biologian osalta on laajaa. Datan

9 11/24/ analyysistä on olemassa lukuisia tieteellisiä artikkeleita, mutta sirun skannauksen ja mittauspisteiden erottelemisen osalta kirjallisuudessa on aukko ja tietoa on erittäin vaikea löytää. Ohessa kuitenkin viitteitä taustojen hahmottamisen helpottamiseksi. Googlen avulla voi kiinnostunut etsiä lisätietoa esimerkiksi hakusanoilla DNA microarray, systems biology ja gene expression. 1. European Bioinformatics Institute: A quick introduction to elements of biology - cells, molecules, genes, functional genomics, microarrays. Sivusto tarjoaa erinomaisen tiivistelmän siitä, mistä molekyylibiologiassa on kyse ja mitä mikrosiruilla voidaan tehdä. 2. Lähdesmäki H. et al.: Using signal processing tools to improve the quality of microarray time-series measurements. Technical report, Tampere University of Technology, Tamperelaiset ovat edelläkäviöitä systeemibiologisessa tutkimuksessa ja mikrosirudatan signaalinkäsittelyssä. 3. Flash-animaatio siitä, miten mikrosirukoe suoritetaan. Suosittelen katsomaan. Tällä pätkällä on viihdearvoa ja ääniefektit mukana.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa

Lisätiedot

Matemaatikot ja tilastotieteilijät

Matemaatikot ja tilastotieteilijät Matemaatikot ja tilastotieteilijät Matematiikka/tilastotiede ammattina Tilastotiede on matematiikan osa-alue, lähinnä todennäköisyyslaskentaa, mutta se on myös itsenäinen tieteenala. Tilastotieteen tutkijat

Lisätiedot

Rahastosalkun faktorimallin rakentaminen

Rahastosalkun faktorimallin rakentaminen Teknillinen korkeakoulu Mat 2.177 Operaatiotutkimuksen projektityöseminaari Kevät 2007 Evli Pankki Oyj Väliraportti 28.3.2007 Kristian Nikinmaa Markus Ehrnrooth Matti Ollila Richard Nordström Ville Niskanen

Lisätiedot

Taulukot. Jukka Harju, Jukka Juslin 2006 1

Taulukot. Jukka Harju, Jukka Juslin 2006 1 Taulukot Jukka Harju, Jukka Juslin 2006 1 Taulukot Taulukot ovat olioita, jotka auttavat organisoimaan suuria määriä tietoa. Käsittelylistalla on: Taulukon tekeminen ja käyttö Rajojen tarkastus ja kapasiteetti

Lisätiedot

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,

Lisätiedot

Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016

Lisätiedot

Hiirten ja rottien sydännäytteistä tuotetun mikrosirudatan analysointi

Hiirten ja rottien sydännäytteistä tuotetun mikrosirudatan analysointi Hiirten ja rottien sydännäytteistä tuotetun mikrosirudatan analysointi Tiedonlouhinnan harjoitustyö 9.6.2013 Antti Kurronen Irene Pöllänen antti.kurronen@student.uef.fi 1 YLEISKUVAUS (ANTTI KURRONEN) Tutkimuksessa

Lisätiedot

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä

Lisätiedot

Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen

Lisätiedot

Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista

Lisätiedot

KEESHONDIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,

Lisätiedot

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina

Lisätiedot

Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä

Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä Evoluutio ja luominen Mian tekemä esitys Jannen esittämänä Väite: tiedemiehet ovat todistaneet evoluutioteorian todeksi Evoluutioteorialla tässä tarkoitan teoriaa, jonka mukaan kaikki elollinen on kehittynyt

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2. 21.2. 2006, Nisse Suutarinen

Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2. 21.2. 2006, Nisse Suutarinen Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2 21.2. 2006, Nisse Suutarinen Aivoalueen monimutkaistuminen eriytymällä Eriytyminen (segregation) aivojen evoluutiosta puhuttaessa on tapahtuma, jossa

Lisätiedot

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan?

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? 2012-2013 Lasse Lensu 2 Ihmisen, eläinten ja kasvien hyvinvoinnin kannalta nykyaikaiset mittaus-,

Lisätiedot

Mitä on laadullinen tutkimus? Pertti Alasuutari Tampereen yliopisto

Mitä on laadullinen tutkimus? Pertti Alasuutari Tampereen yliopisto Mitä on laadullinen tutkimus? Pertti Alasuutari Tampereen yliopisto Määritelmiä Laadullinen tutkimus voidaan määritellä eri tavoin eri lähtökohdista Voidaan esimerkiksi korostaa sen juuria antropologiasta

Lisätiedot

Mikrosirut ja niiden data-analyysi

Mikrosirut ja niiden data-analyysi Mikrosirut ja niiden data-analyysi S-114.2510 Laskennallinen systeemibiologia 11. Luento: To 24.4.2008 Oppimistavoitteet Mikä on mikrosiru ja miten niitä tehdään Millaisia mikrosiruja on olemassa Kuinka

Lisätiedot

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow Genomi Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta Hannu Sariola, Irma Thesleff ja Marja Makarow Malliorganismeiksi kutsutaan lajeja, joita tutkijat käyttävät

Lisätiedot

Geeniekspressioiden klusterointi

Geeniekspressioiden klusterointi Geeniekspressioiden klusterointi Katja Saarela Katja.Saarela@cs.helsinki.fi Klusterointimenetelmät-seminaari Helsingin yliopisto, tietojenkäsittelytieteen laitos Raportti C-2002-54, s. 64-75, marraskuu

Lisätiedot

Materiaalinäytteiden qpcr-tulosten tulkinnasta

Materiaalinäytteiden qpcr-tulosten tulkinnasta Materiaalinäytteiden qpcr-tulosten tulkinnasta Helena Rintala ja Teija Meklin Sisäilmastoseminaari 13.3.2014 Taustaa qpcr (kvantitatiivinen PCR) on nopea menetelmä mikrobien toteamiseen Käytetty paljon

Lisätiedot

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten

Lisätiedot

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun

Lisätiedot

NÄYTTEENLUOVUTTAJIEN TIEDOTTAMINEN JA KÄYTTÖTARKOITUKSEN MUUTOKSET 20.9.2004 ARPO AROMAA

NÄYTTEENLUOVUTTAJIEN TIEDOTTAMINEN JA KÄYTTÖTARKOITUKSEN MUUTOKSET 20.9.2004 ARPO AROMAA NÄYTTEENLUOVUTTAJIEN TIEDOTTAMINEN JA KÄYTTÖTARKOITUKSEN MUUTOKSET TILANTEEN KUVAUS Vuosi 0 Tutkimus tavoitteineen Suostumus Näytteet Muut tiedot Vuosi 10-30 Tutkimus: uusi vai entinen käyttötarkoitus

Lisätiedot

Mat 2.4177 Operaatiotutkimuksen projektityöseminaari

Mat 2.4177 Operaatiotutkimuksen projektityöseminaari Mat 2.4177 Operaatiotutkimuksen projektityöseminaari Kemira GrowHow: Paikallisen vaihtelun korjaaminen kasvatuskokeiden tuloksissa 21.2.2008 Ilkka Anttila Mikael Bruun Antti Ritala Olli Rusanen Timo Tervola

Lisätiedot

- MIKSI TUTKIMUSNÄYTTÖÖN PERUSTUVAA TIETOA? - MISTÄ ETSIÄ?

- MIKSI TUTKIMUSNÄYTTÖÖN PERUSTUVAA TIETOA? - MISTÄ ETSIÄ? THM M Mustajoki Sairaanhoitajan käsikirjan päätoimittaja - MIKSI TUTKIMUSNÄYTTÖÖN PERUSTUVAA TIETOA? - MISTÄ ETSIÄ? M Mustajoki 290506 1 Miksi? Kaikilla potilas(!) ja sairaanhoitaja - sama tieto Perustelut

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä

Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä Huippuyksikköseminaari 12.11.2013 Leena Vähäkylä Menestystarinat Akatemian viestinnässä Akatemian pitkäjänteinen rahoitus laadukkaaseen tutkimukseen näkyy rahoitettujen ja menestyneiden tutkijoiden tutkijanurasta

Lisätiedot

PIKSELIT JA RESOLUUTIO

PIKSELIT JA RESOLUUTIO PIKSELIT JA RESOLUUTIO 22.2.2015 ATK Seniorit Mukanetti ry / Tuula P 2 Pikselit ja resoluutio Outoja sanoja Outoja käsitteitä Mikä resoluutio? Mikä pikseli? Mitä tarkoittavat? Miksi niitä on? Milloin tarvitaan?

Lisätiedot

Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä?

Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Antti Latvala Sosiaalilääketieteen päivät 28.11.2012 Esityksen teemat Miksi ja miten huomioida geneettisten

Lisätiedot

Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa

Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa 1 Sisältö - Sisäympäristön laatu kouluissa - Tutkimuksen taustaa - Siivouksen arviointiin liittyvien

Lisätiedot

HMM ja geenien etsintä

HMM ja geenien etsintä Kuten makovin mallien yhteydessä, niin HMM halutulla topologialla voidaan opettaa tunnistamaan geenejä. Ohessa eäs geenitunnistukseen käytetty topologia, joka tunnistaa ihmisen geenit (5 -> 3 ). Edellä

Lisätiedot

SUDOKU - ratkaisuohjeet. Jarno Tuimala 18.9.2005

SUDOKU - ratkaisuohjeet. Jarno Tuimala 18.9.2005 SUDOKU - ratkaisuohjeet Jarno Tuimala 18.9.2005 Japanilainen sudoku Seuraavassa on esitetty ohjeet japanilaistyyppisten sudoku-ristikoiden ratkontaan. Japanilaisia ristikoita luonnehtivat seuraavat piirteet:

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

ALKUSANAT... 4 ALKUSANAT E-KIRJA VERSIOON... 5 SISÄLLYSLUETTELO... 6

ALKUSANAT... 4 ALKUSANAT E-KIRJA VERSIOON... 5 SISÄLLYSLUETTELO... 6 Sisällysluettelo ALKUSANAT 4 ALKUSANAT E-KIRJA VERSIOON 5 SISÄLLYSLUETTELO 6 1 PERUSASIOITA JA AINEISTON SYÖTTÖ 8 11 PERUSNÄKYMÄ 8 12 AINEISTON SYÖTTÖ VERSIOSSA 9 8 Muuttujan määrittely versiossa 9 11

Lisätiedot

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

SoberIT Software Business and Engineering Institute T-121.110. Testaussuunnitelma paperiprototyyppi ja Kevät 2003 HELSINKI UNIVERSITY OF TECHNOLOGY

SoberIT Software Business and Engineering Institute T-121.110. Testaussuunnitelma paperiprototyyppi ja Kevät 2003 HELSINKI UNIVERSITY OF TECHNOLOGY T-121.110 Testaussuunnitelma paperiprototyyppi ja Kevät 2003 Yleistä Palautus viikolla 10 Vaiheessa palautetaan Prototyypin testaussuunnitelma Prototyypin navigaatiokartta Prototyyppi 1. Paperiprototyyppi

Lisätiedot

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio:

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio: -mesenkyymi-vuorovaikutukset, esimerkkinä hammas ja ihokarva elimiä muodostuu kaikista alkiokerroksista, usein epiteelin ja mesenkyymin vuorovaikutuksesta epiteeli ektodermi kumpi aloittaa elimen kehityksen:

Lisätiedot

Leo Lahti Vertaileva toiminnallinen genomianalyysi assosiatiivisella ryhmittelymenetelmällä

Leo Lahti Vertaileva toiminnallinen genomianalyysi assosiatiivisella ryhmittelymenetelmällä TEKNILLINEN KORKEAKOULU Teknillisen fysiikan ja matematiikan osasto Leo Lahti Vertaileva toiminnallinen genomianalyysi assosiatiivisella ryhmittelymenetelmällä Diplomi-insinöörin tutkintoa varten tarkastettavaksi

Lisätiedot

Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa

Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Maria Valkonen, Kaisa Jalkanen, Martin Täubel, Anne Hyvärinen 31.3.2014 Sisäilmastoseminaari 2014 1 Tausta Asumisterveysoppaan mukaiset sisäympäristön

Lisätiedot

UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA

UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA LIITU-päivä 4.5.2006 FT Helena Rintala Kansanterveyslaitos, Ympäristöterveyden osasto Mihin sisäympäristön mikrobien mittauksia tarvitaan? Rakennusten

Lisätiedot

SELVITYS SIITÄ MITEN ERÄÄT PERINNÖLLISET SAIRAUDET (KUTEN GPRA JA FUCOSIDOSIS) PERIYTYVÄT ENGLANNINSPRINGERSPANIELEISSA

SELVITYS SIITÄ MITEN ERÄÄT PERINNÖLLISET SAIRAUDET (KUTEN GPRA JA FUCOSIDOSIS) PERIYTYVÄT ENGLANNINSPRINGERSPANIELEISSA SELVITYS SIITÄ MITEN ERÄÄT PERINNÖLLISET SAIRAUDET (KUTEN GPRA JA FUCOSIDOSIS) PERIYTYVÄT ENGLANNINSPRINGERSPANIELEISSA Kaikki koiran perimät geenit sisältyvät 39 erilliseen kromosomipariin. Geenejä arvellaan

Lisätiedot

S-114.2720 Havaitseminen ja toiminta

S-114.2720 Havaitseminen ja toiminta S-114.2720 Havaitseminen ja toiminta Heikki Hyyti 60451P Harjoitustyö 2 visuaalinen prosessointi Treismanin FIT Kuva 1. Kuvassa on Treismanin kokeen ensimmäinen osio, jossa piti etsiä vihreätä T kirjainta.

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Ennaltaehkäisevien sosiaalipalvelujen kustannusvaikutusten osoittaminen rekisteritutkimuksella: Case Espoo

Ennaltaehkäisevien sosiaalipalvelujen kustannusvaikutusten osoittaminen rekisteritutkimuksella: Case Espoo Ennaltaehkäisevien sosiaalipalvelujen kustannusvaikutusten osoittaminen rekisteritutkimuksella: Case Espoo KÄPI-seminaari 16.6.2014 Tutkimuksen tavoitteet ja aineistot Perheelliset asunnottomat Espoossa

Lisätiedot

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia

Lisätiedot

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna Ihmisen keho muodostuu miljardeista soluista. Vaikka nämä solut ovat tietyssä mielessä meidän omiamme, ne polveutuvat itsenäisistä yksisoluisista elämänmuodoista, jotka ovat säilyttäneet monia itsenäisen

Lisätiedot

Entsyymit ja niiden tuotanto. Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä

Entsyymit ja niiden tuotanto. Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä Entsyymit ja niiden tuotanto Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä Mitä ovat entsyymit? Entsyymit ovat proteiineja (eli valkuaisaineita), jotka vauhdittavat (katalysoivat) kemiallisia

Lisätiedot

Professori Esa Saarinen & Prof. Raimo P. Hämäläinen Systeeminalyysin laboratorio

Professori Esa Saarinen & Prof. Raimo P. Hämäläinen Systeeminalyysin laboratorio Professori Esa Saarinen & Systeemiäly Prof. Raimo P. Hämäläinen Systeeminalyysin laboratorio Systeemitieteet Systeemi- ja operaatiotutkimus Paremmaksi tekemisen tiede Ongelmanratkaisua monimutkaisissa

Lisätiedot

Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi

Lisätiedot

Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa

Lisätiedot

Projektisuunnitelma. Projektin tavoitteet

Projektisuunnitelma. Projektin tavoitteet Projektisuunnitelma Projektin tavoitteet Projektin tarkoituksena on tunnistaa erilaisia esineitä Kinect-kameran avulla. Kinect-kamera on kytkettynä tietokoneeseen, johon projektissa tehdään tunnistuksen

Lisätiedot

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan

Lisätiedot

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,

Lisätiedot

Basic Raster Styling and Analysis

Basic Raster Styling and Analysis Basic Raster Styling and Analysis QGIS Tutorials and Tips Author Ujaval Gandhi http://google.com/+ujavalgandhi Translations by Kari Salovaara This work is licensed under a Creative Commons Attribution

Lisätiedot

BIOSÄHKÖISET MITTAUKSET

BIOSÄHKÖISET MITTAUKSET TEKSTIN NIMI sivu 1 / 1 BIOSÄHKÖISET MITTAUKSET ELEKTROENKEFALOGRAFIA EEG Elektroenkegfalografialla tarkoitetaan aivojen sähköisen toiminnan rekisteröintiä. Mittaus tapahtuu tavallisesti ihon pinnalta,

Lisätiedot

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä

Lisätiedot

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2)

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2) 5.7 Biologia Biologia tutkii elämää ja sen edellytyksiä. Opetus syventää aikuisopiskelijan luonnontuntemusta ja auttaa ymmärtämään luonnon perusilmiöitä. Biologian opiskelu kehittää opiskelijan luonnontieteellistä

Lisätiedot

5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin

Lisätiedot

Potilastietojärjestelmän kouluttajan osaaminen ja asiantuntijuus

Potilastietojärjestelmän kouluttajan osaaminen ja asiantuntijuus Potilastietojärjestelmän kouluttajan osaaminen ja asiantuntijuus Pro gradu -tutkielma TtM Jaana Luostarinen TtM Silja Ässämäki 11.05.2004 Tampere Luostarinen & Ässämäki 1 Miksi tämä aihe? Käyttöönottoprojekteissa

Lisätiedot

Higgsin bosonin etsintä CMS-kokeessa LHC:n vuosien 2010 ja 2011 datasta CERN, 13 joulukuuta 2011

Higgsin bosonin etsintä CMS-kokeessa LHC:n vuosien 2010 ja 2011 datasta CERN, 13 joulukuuta 2011 Higgsin bosonin etsintä CMS-kokeessa LHC:n vuosien 2010 ja 2011 datasta CERN, 13 joulukuuta 2011 Higgsin bosoni on ainoa hiukkasfysiikan standardimallin (SM) ennustama hiukkanen, jota ei ole vielä löydetty

Lisätiedot

4G LTE-verkkojen sisätilakuuluvuusvertailu 1H2014

4G LTE-verkkojen sisätilakuuluvuusvertailu 1H2014 4G LTE-verkkojen sisätilakuuluvuusvertailu 1H2014 27. kesäkuuta 2014 Omnitele Ltd. Mäkitorpantie 3B P.O. Box 969, 00101 Helsinki Finland Puh: +358 9 695991 Fax: +358 9 177182 E-mail: contact@omnitele.fi

Lisätiedot

Kansainvälinen rahatalous Matti Estola. Termiinikurssit ja swapit valuuttariskien hallinnassa

Kansainvälinen rahatalous Matti Estola. Termiinikurssit ja swapit valuuttariskien hallinnassa Kansainvälinen rahatalous Matti Estola ermiinikurssit ja swapit valuuttariskien hallinnassa 1. Valuuttariskien suojauskeinot Rahoitusalan yritykset tekevät asiakkailleen valuuttojen välisiä termiinisopimuksia

Lisätiedot

Suunnitelma Perinnöllisyys T9

Suunnitelma Perinnöllisyys T9 Suunnitelma Perinnöllisyys T9 Oppimistavoitteet Järjestelmällisten biologisten laboratoriotutkimuksien tekeminen. Perinnöllisyyteen liittyvien käsitteiden, mallien ja teorioiden ymmärtäminen ja käyttäminen

Lisätiedot

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki

Lisätiedot

Aineistokoko ja voima-analyysi

Aineistokoko ja voima-analyysi TUTKIMUSOPAS Aineistokoko ja voima-analyysi Johdanto Aineisto- eli otoskoon arviointi ja tutkimuksen voima-analyysi ovat tilastollisen tutkimuksen suunnittelussa keskeisimpiä asioita. Otoskoon arvioinnilla

Lisätiedot

KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN

KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN Suomen Ympäristösairauskeskus perustettiin viime vuonna ajantasaisen ympäristösairaustiedon asiantuntijakeskukseksi. Tavoitteena on ajantasaisen,

Lisätiedot

VAPAAEHTOISILLA TEHTY TESTIMITTAUS HARMONIFIN TM SUOJAAVIEN VAIKUTUKSIEN SELVITTÄMISEKSI SÄHKÖMAGNEETTISEN KENTÄN MILLIMETRIN AALLONPITUUSALUEELLA

VAPAAEHTOISILLA TEHTY TESTIMITTAUS HARMONIFIN TM SUOJAAVIEN VAIKUTUKSIEN SELVITTÄMISEKSI SÄHKÖMAGNEETTISEN KENTÄN MILLIMETRIN AALLONPITUUSALUEELLA VAPAAEHTOISILLA TEHTY TESTIMITTAUS HARMONIFIN TM SUOJAAVIEN VAIKUTUKSIEN SELVITTÄMISEKSI SÄHKÖMAGNEETTISEN KENTÄN MILLIMETRIN AALLONPITUUSALUEELLA ELIMISTÖSI HARMONIASSA Email: info@nanosmart.fi Web: www.nanosmart.fi

Lisätiedot

Luento 6: 3-D koordinaatit

Luento 6: 3-D koordinaatit Maa-57.300 Fotogrammetrian perusteet Luento-ohjelma 1 2 3 4 5 6 7 8 9 10 11 12 13 Luento 6: 3-D koordinaatit AIHEITA (Alkuperäinen luento: Henrik Haggrén, 16.2.2003, Päivityksiä: Katri Koistinen 5.2.2004

Lisätiedot

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyvaikutuksen synty Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyn ja biologisen materian vuorovaikutus Koska ihmisestä 70% on vettä, todennäköisin (ja tärkein) säteilyn ja biologisen

Lisätiedot

EVTEK/ Antti Piironen & Pekka Valtonen 1/6 TM01S/ Elektroniikan komponentit ja järjestelmät Laboraatiot, Syksy 2003

EVTEK/ Antti Piironen & Pekka Valtonen 1/6 TM01S/ Elektroniikan komponentit ja järjestelmät Laboraatiot, Syksy 2003 EVTEK/ Antti Piironen & Pekka Valtonen 1/6 TM01S/ Elektroniikan komponentit ja järjestelmät Laboraatiot, Syksy 2003 LABORATORIOTÖIDEN OHJEET (Mukaillen työkirjaa "Teknillisten oppilaitosten Elektroniikka";

Lisätiedot

Teema 3: Tilastollisia kuvia ja tunnuslukuja

Teema 3: Tilastollisia kuvia ja tunnuslukuja Teema 3: Tilastollisia kuvia ja tunnuslukuja Tilastoaineiston peruselementit: havainnot ja muuttujat havainto: yhtä havaintoyksikköä koskevat tiedot esim. henkilön vastaukset kyselylomakkeen kysymyksiin

Lisätiedot

DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri

Lisätiedot

Operaattorivertailu SELVITYS PÄÄKAUPUNKISEUDULLA TOIMIVIEN 3G MATKAVIESTINVERKKOJEN DATANOPEUKSISTA

Operaattorivertailu SELVITYS PÄÄKAUPUNKISEUDULLA TOIMIVIEN 3G MATKAVIESTINVERKKOJEN DATANOPEUKSISTA Operaattorivertailu SELVITYS PÄÄKAUPUNKISEUDULLA TOIMIVIEN 3G MATKAVIESTINVERKKOJEN DATANOPEUKSISTA SISÄLLYSLUETTELO TIIVISTELMÄ... 3 YLEISTÄ... 4 TAVOITE... 4 PAIKKAKUNNAT... 5 MITATUT SUUREET JA MITTAUSJÄRJESTELMÄ...

Lisätiedot

Evoluutiopuu. Aluksi. Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot. Luokkataso: 6.-9. luokka, lukio

Evoluutiopuu. Aluksi. Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot. Luokkataso: 6.-9. luokka, lukio Evoluutiopuu Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot Luokkataso: 6.-9. luokka, lukio Välineet: loogiset palat, paperia, kyniä Kuvaus: Tehtävässä tutkitaan bakteerien evoluutiota.

Lisätiedot

Eye tracking. analysoimalla viestintääsi voit lisätä myyntiäsi

Eye tracking. analysoimalla viestintääsi voit lisätä myyntiäsi Eye tracking analysoimalla viestintääsi voit lisätä myyntiäsi 1 2 Lisää myyntiä luomalla katseen vangitsevaa viestintää Näkevätkö asiakkaasi todellakin ne asiat, jotka haluat heidän laskussa, web sivuilla

Lisätiedot

Sisällysluettelo ESIPUHE... 4 ALKUSANAT E-KIRJA VERSIOON... 5 SISÄLLYSLUETTELO... 6 1. JOHDANTO TILASTOLLISEEN PÄÄTTELYYN... 8 2. TODENNÄKÖISYYS...

Sisällysluettelo ESIPUHE... 4 ALKUSANAT E-KIRJA VERSIOON... 5 SISÄLLYSLUETTELO... 6 1. JOHDANTO TILASTOLLISEEN PÄÄTTELYYN... 8 2. TODENNÄKÖISYYS... Sisällysluettelo ESIPUHE... 4 ALKUSANAT E-KIRJA VERSIOON... 5 SISÄLLYSLUETTELO... 6 1. JOHDANTO TILASTOLLISEEN PÄÄTTELYYN... 8 1.1 INDUKTIO JA DEDUKTIO... 9 1.2 SYYT JA VAIKUTUKSET... 11 TEHTÄVIÄ... 13

Lisätiedot

TUTKIMUSAINEISTON ANALYYSI. LTKY012 Timo Törmäkangas

TUTKIMUSAINEISTON ANALYYSI. LTKY012 Timo Törmäkangas TUTKIMUSAINEISTON ANALYYSI LTKY012 Timo Törmäkangas LUENNOT Luento Paikka Vko Päivä Pvm Klo 1 L 304 8 Pe 21.2. 08:15-10:00 2 L 304 9 To 27.2. 12:15-14:00 3 L 304 9 Pe 28.2. 08:15-10:00 4 L 304 10 Ke 5.3.

Lisätiedot

Virukset Materiaalitieteiden Rakennusaineina Suomalainen Tiedeakatemia

Virukset Materiaalitieteiden Rakennusaineina Suomalainen Tiedeakatemia Virukset Materiaalitieteiden Rakennusaineina Suomalainen Tiedeakatemia Mauri Kostiainen Molekyylimateriaalit-ryhmä Teknillisen fysiikan osasto Aalto-yliopisto Virukset materiaaleina Virus on isäntäsolussa

Lisätiedot

YLEISKUVA - Kysymykset

YLEISKUVA - Kysymykset INSIGHT Käyttöopas YLEISKUVA - Kysymykset 1. Insight - analysointityökalun käytön mahdollistamiseksi täytyy kyselyn raportti avata Beta - raportointityökalulla 1. Klikkaa Insight välilehteä raportilla

Lisätiedot

Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa

Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa Suurten genomisten tietomassojen hallinta ja analyysi tutkimuksessa ja yksilöidyssä hoidossa Timo Kanninen, Biocomputing Platforms Oy 2012 all rights reserved BC Platforms genomisen datan hallintaa Geneettisen

Lisätiedot

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut Hemopoiesis Tuma Mitochondrion Tuma 2 Flagellum Peroxisome Centrioles Microfilaments Microtubules Nuclear envelope Rough endoplasmic reticulum Ribosomes NUCLEUS muoto: pallomainen liuskoittunut (esim.

Lisätiedot

DNA mikrosirutekniikka. Oligonukleotidisirut. Sirujen valmistus. Siruanalyysi. Oligonukleotidisirut

DNA mikrosirutekniikka. Oligonukleotidisirut. Sirujen valmistus. Siruanalyysi. Oligonukleotidisirut DNA mikrosirutekniikka Monta nimeä: geenisiru, DNA mikrosiru, DNA siru, DNA lastu Mahdollistaa tutkia samanaikaisesti kymmenien tuhansien geenien ilmenemistasot solu- ja kudosnäytteissä Pystyy keräämään

Lisätiedot

811312A Tietorakenteet ja algoritmit 2015-2016. I Johdanto

811312A Tietorakenteet ja algoritmit 2015-2016. I Johdanto 811312A Tietorakenteet ja algoritmit 2015-2016 I Johdanto Sisältö 1. Algoritmeista ja tietorakenteista 2. Algoritmien analyysistä 811312A TRA, Johdanto 2 I.1. Algoritmeista ja tietorakenteista I.1.1. Algoritmien

Lisätiedot

Probabilistiset mallit (osa 2) Matemaattisen mallinnuksen kurssi Kevät 2002, luento 10, osa 2 Jorma Merikoski Tampereen yliopisto

Probabilistiset mallit (osa 2) Matemaattisen mallinnuksen kurssi Kevät 2002, luento 10, osa 2 Jorma Merikoski Tampereen yliopisto Probabilistiset mallit (osa 2) Matemaattisen mallinnuksen kurssi Kevät 2002, luento 10, osa 2 Jorma Merikoski Tampereen yliopisto Esimerkki Tarkastelemme ilmiötä I, joka on a) tiettyyn kauppaan tulee asiakkaita

Lisätiedot

Tähtitieteen käytännön menetelmiä Kevät 2009

Tähtitieteen käytännön menetelmiä Kevät 2009 Tähtitieteen käytännön menetelmiä Kevät 2009 2009-01-12 Yleistä Luennot Luennoija hannu.p.parviainen@helsinki.fi Aikataulu Observatoriolla Maanantaisin 10.00-12.00 Ohjattua harjoittelua maanantaisin 9.00-10.00

Lisätiedot

NASTOLAN KUNTA UUDENKYLÄN OSAYLEISKAAVA HIEKKATIEN JA HIETATIEN ALUEEN PÖLY. Vastaanottaja Nastolan kunta. Asiakirjatyyppi Lausunto

NASTOLAN KUNTA UUDENKYLÄN OSAYLEISKAAVA HIEKKATIEN JA HIETATIEN ALUEEN PÖLY. Vastaanottaja Nastolan kunta. Asiakirjatyyppi Lausunto Vastaanottaja Nastolan kunta Asiakirjatyyppi Lausunto Päivämäärä 5.2.2014 NASTOLAN KUNTA UUDENKYLÄN OSAYLEISKAAVA HIEKKATIEN JA HIETATIEN ALUEEN PÖLY NASTOLAN KUNTA PÖLY Tarkastus Päivämäärä 5.2.2014 Laatija

Lisätiedot

Sosiaalisten verkostojen data

Sosiaalisten verkostojen data Sosiaalisten verkostojen data Hypermedian jatko-opintoseminaari 2008-09 2. luento - 17.10.2008 Antti Kortemaa, TTY/Hlab Wasserman, S. & Faust, K.: Social Network Analysis. Methods and Applications. 1 Mitä

Lisätiedot

Mitä suomen intonaatiosta tiedetään

Mitä suomen intonaatiosta tiedetään Mitä suomen intonaatiosta tiedetään ja mitä ehkä tulisi tietää? Tommi Nieminen Itä-Suomen yliopisto AFinLAn syyssymposium Helsinki 13. 14. 11. 2015 Johdanto Jäsennys 1 Johdanto 2 Mitä intonaatiosta tiedetään?

Lisätiedot

Järvitesti Ympäristöteknologia T571SA 7.5.2013

Järvitesti Ympäristöteknologia T571SA 7.5.2013 Hans Laihia Mika Tuukkanen 1 LASKENNALLISET JA TILASTOLLISET MENETELMÄT Järvitesti Ympäristöteknologia T571SA 7.5.2013 Sarkola Eino JÄRVITESTI Johdanto Järvien kuntoa tutkitaan monenlaisilla eri menetelmillä.

Lisätiedot