T Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

Koko: px
Aloita esitys sivulta:

Download "T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa"


1 T Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E




5 11/24/ Johdanto DNA-mikrosiruteknologia on mullistanut molekyylibiologian tutkimuksen. Aikaisemmin tutkijat tutkivat yhtä molekyyliä kerrallaan. Nyt voidaan yhdestä kudosnäytteestä mitata tuhansien geenien yhtäaikaista toimintaa. Mikrosirudatan myötä on biologisen tiedon määrä ja luonne kuitenkin kasvanut valtavasti. Aikaisemmin pärjättiin visuaalisella tarkastelulla, ja hypoteeseihin saatiin kyllä ja ei -tyyppisiä vastauksia. Nyt numeerista dataa on enemmän kuin ihmissilmä ja -aivot kykenevät kerralla prosessoimaan, joten laskennalliset menetelmät ovat välttämättömiä myös perinteisesti ei-matemaattisessa biologiassa. Tässä tutkielmassa tarkastellaan DNA-mikrosirudatan analysointia signaalinkäsittelyn menetelmien avulla. Aiheesta ei ole mitään yksittäistä lähdeteosta, koska ala on vielä niin uusi. Lähteenä toimivat useat erilaiset tieteelliset artikkelit, koulusivistys ja vuoden työkokemus alalta. Tämä tutkielma on pikemminkin tekijänsä tulkinta aikaisempien tietojensa ja signaalinkäsittelyn kurssilla oppimansa materiaalin yhdistämisestä. Luvussa 2 kuvaillaan DNA-mikrosiruteknologian perusteet ja sitä millaisiin kysymyksiin sillä etsitään vastauksia. Luvussa 3 käydään läpi mikrosiruanalyysissä käytetyimpiä ja välttämättömimpiä signaalinkäsittelyn menetelmiä. Luvussa 4 esitetään vielä yhteenveto ja loppusanat. 2 Biologiaa DNA-mikrosiruteknologialla 2.1 Molekyylibiologian perusteet Elollinen aine koostuu itsenäisistä yksiköistä, soluista. Solun tuma on sen komentokeskus, jossa sijaitsee elämän ohjekirja, DNA-molekyylit. DNA koodaa bioaktiivisia makromolekyylejä, proteiineja, jotka osallistuvat lähes kaikkeen elävässä aineessa tapahtuvaan toimintaan. Ihmisen solun DNA koostuu noin 3 miljardista neljän erilaisen nukleotidiemäksen muodostamasta ketjusta. Geeni on lyhyt ( emäsparia pitkä) proteiinia koodaava pätkä DNA:ta. Ihmisen genomin arvioidaan koostuvan noin geenistä. Solu vastaa ympäristöstä saamiinsa ärsykkeisiin esimerkiksi valmistamalla proteiineja eli expressoimalla geenejään. DNA-mikrosiruteknologialla voidaan mitata geenin ekspressiotasoa. Molekyylibiologian keskusdogman mukaan DNA makes RNA makes protein eli DNA tekee RNA:n (DNA:n tyyppinen molekyyli), joka tekee proteiinin. Tämän hetkisen käsityksen mukaan geenin korkea ekspressiotaso johtaa sitä geeniä vastaavan proteiinin suureen tuotantoon. Tämän hetkinen molekyylibiologian suurimpia haaste on ymmärtää solun toimintaa ja geenien säätelyverkkoja geeniekspressiodatan avulla. Tällä hetkellä kahden organismin, hiivan (Saccharomycces cerecisiae) ja banaanikärpäsen (Drosophila melanogaster) geenisäätelyverkot tunnetaan pääpiirteittäin. Näiden eliöiden genomit koostuvat reilusti alle :sta geenistä. Geenisäätelyverkkojen tunteminen on vain yksi askel matkalla solun toiminnan selvittämiseen. Ei nimittäin riitä, että tiedetään geenin A aktivoivan geeniä B. Voi nimittäin olla, että geeni B aktivoituu vain silloin, kun geenin A ekspressio ylittää tietyn kynnysarvon. Toisaalta geeni C saattaa deaktivoitua silloin, kun geeni A aktivoi geenin B. Pitää muistaa,

6 11/24/ että ihmisen genomissa on noin muuttujaa, joista jotkut voivat vuorovaikuttaa useammankin kohteen kanssa. Molekyylibiologisen tiedon uskotaan tuottavan tulevaisuudessa uusia hoitomuotoja ja lääkkeitä perinöllisten sairauksien hoitoon. Puhutaan ns. räätälöidyistä lääkkeistä, myös siitä, että samaan vaivaan voidaan määrätä kahdelle eri henkilölle täysin erilaista lääkettä näiden henkilöiden geneettisen sormenjäljen, eli perimän, perusteella. Jo nyt on näyttöä siitä, että esimerkiksi sydän- ja verisuonitaudeilla on geneettisiä alttiustekijöitä ja että ihmiset, joilla on geenimuoto A eräästä geenistä hyötyvät olemassa olevasta lääkkeestä, kun taas potilaat, joilla on geenimuoto B, eivät hyödy samasta kalliista hoidosta mitenkään, koska heidän solunsa eivät kykene hyödyntämään sitä. 2.2 DNA-mikrosiruteknologia DNA-mikrosiruteknologia on yksinkertaisuudessaan sitä, että mitataan kuinka paljon mikrosirulle laitettua DNA-koetinta vastaavaa geeniä on tutkittavassa näytteessä. Fyysisesti mikrosiru on noin neliösenttimetrin kokoinen lasilevy, jolle sijoitetaan eri geeniä vastaavia koettimia. Esimerkiksi ihmisen geenejä mittaavissa siruissa on noin erilaista mittauspistettä, koetinsekvenssityyppiä, yhden neliösenttimetrin alueella. Lisäksi jokaisesta koetinsekvenssistä on miljoonia replikaatteja yhdessä mittauspisteessä. Käytännössä tutkittava DNA-näyte uutetaan perinteisillä molekyylibiologian tekniikoilla solusta. Koska yhdestä solusta ei voida saada tarpeeksi suurta määrää DNA:ta, otetaan näyte kudoksesta, joka on samankaltaisten solujen muodostama funktionaalinen kokonaisuus. Näyte leimataan fluoresoivalla aineella ja pipetoidaan mikrosirulle sekä annetaan näytteen DNA:n hybridisoitua eli liittyä koettimiin (Kuva 1). Tämän jälkeen siru skannataan laser-skannerilla. Laser saa näytteen fluoresenssileiman emittoimaan valoa ja skanneri vastaanottaa tuon valon intensiteetin. Tämän vaiheen jälkeen mikrosirudata on sähköisessä muodossa ja datan prosessointi alkaa. Kuva 1DNA-näyte otetaan soluryhmistä. Näytteen annetaan tarttua mikrosirun koettimiin. Näytteen emittoima fluoresenssivalo havaitaan skannerilla. Tuloksena on kuva geeniekspressioiden intensiteeteistä.[1]

7 11/24/ Signaalinkäsittelyn menetelmät mikrosirudatan prosessoinnissa 3.1 Kuvasta dataksi Skannauksen tuloksena on harmaaväripikselikuva, jossa kutakin mittauspistettä vastaa 16 pikseliä. Yleensä näiden 16 pikselin intensiteeteissä on hajontaa. Ensimmäinen tehtävä on siis määrittää, mikä on oikeasta geenin ekspressiosta tulevaa signaalia ja mikä taustakohinaa. Tämä on vaativa hahmontunnistustehtävä. Tarkoitus kun on erottaa viereiset mittauspisteet toisistaan ja tämän jälkeen vielä päättää mittauspisteiden sisäisen hajonnan tarkastelun jälkeen kompromissiarvo mittauspisteen geeniekspressiolle. Mittana voidaan käyttää mittauspisteen pikseleiden keskiarvoa, mediaania tai jotain muuta sopivaa arvoa. Mikrosiruja käytettäessä taustakohinan erottaminenkin on toisinaan ongelma. Käytännön teknisten ongelmien vuoksi taustakohina on erilaista sirun eri kohdissa. Esimerkiksi sirun reunoilla kohinaongelma on yleensä suurempi. Siksi taustakohinan poistamiseksi ei ole yhtä ja ainoata oikeaa ratkaisua. Tavoitteena olisi kuitenkin, että taustakohina, jos sitä ei voida poistaa kokonaan, ei olisi paikkariippuva. Skannatusta kuvasta lasketaan kohinanpoiston jälkeen geeniekspressiointensiteetit eli kuinka paljon kutakin geeniä ilmentyy tutkittavassa kudoksessa sillä ajan hetkellä ( lukumäärä ). Näitä intensiteettiarvoja käytetään, kun dataa aletaan tutkia tiedon löytämiseksi. Kuva 2 esittää kohinapoistettua ja false colour -värjättyä ekspressiodataa, josta ei vielä sinällään saada kunnollista tietoa, mutta voidaan osoittaa silmämääräiset ekspressiotasot. Vihreät ja punaiset pisteet osoittavat, että näytteistä joko vihreällä tai punaisella leimatut molekyylit dominoivat mittauspisteen geenin ilmentymistä. Keltainen väri indikoi, että molempien näytteiden geenien ekspressiot ovat kutakuinkin samat. Mustilta alueilta ei olla saatu mittausdataa. Joko siinä ei edes ole ollut koetinta mittaamaan geenin ekspressiota tai sitten ekspressiotaso ei ole yltänyt skannerin resoluutiotasolle. Kuva 2Geeniekspressiodata kuvana: hiivan geeniekspressio. [1], modifioitu

8 3.2 Tilastollinen analyysi kunniaan 11/24/2003 On muistettava, että mikrosirulla mitattu DNA on peräisin useista tuhansista soluista. Koska solut ovat itsenäisiä ympäristöönsä reagoivia yksiköitä, niiden geeniekspressiot eivät ole identtisiä. Voidaan kuitenkin olettaa, että kukin näytteen solu on osallisena yhtä suurella painolla ja siksi tulkita datapiste näytteen geeniekspressioiden keskiarvoksi. Tämä koskee siis vain yhtä datakuvan pikseliä. 3.3 Aikasarjadata Lienee helpointa tarkastella mikrosirudatan tulkintaa ja analyysiä signaalinkäsittelyn kannalta aikasarjojen avulla. DNA-mikrosiruista saadaan aikasarjadataa vain silloin, kun näytteitä otetaan tietyin aikavälein ja kustakin näytteestä tehdään oma sirunsa. Biologiset aikasarjat eroavat kuitenkin monista muista aikasarjoista. Ensinnäkin näytteitä on vaikea saada juuri tietyllä ajanhetkellä, koska näytteiden kanssa on oltava hyvin varovainen. Toisekseen DNA-analytiikka on hyvin kallista. Yksi sirukoe maksaa noin 1000 euroa. Toisin sanoen dataa ja taustatietoa on vähän ja aikasarjan näytteenottoajankohdat saattavat olla hieman epämääräiset. Useat biologiset prosessit ovat luonteeltaan syklisiä. Myös solun elämä on jatkuvaa kiertoa: solu jakaantuu, ylläpitää toimintojaan, valmistautuu jakaantumaan ja jakaantuu uudelleen. On hyvin tyypillistä, että tietoa etsiessä halutaan löytää geenit, joiden ekspressiot muuttuvat solusyklin mukana. Olettaen, että datassa on jotain jaksollisia komponentteja, ne pitäisi pystyä löytämään Fourier-muunnoksen avulla. Samalla nähdään minkä pituisia jaksoja ja kuinka voimakkaasti näitä jaksoja on olemassa. Joskus voidaan haluta selvittää jonkin geeniperheen reagointia tiettyyn ärsykkeeseen, esimerkiksi sitä miten koivuallergisen ihmisen silmäluomen epiteelisolut reagoivat koivun siitepölyyn. Tämän jälkeen voidaan seurata näiden geenien ekspressiotasojen muutoksia. Hyvänä apuna on risti- ja autokorrelaatiofunktiot, koska ihmissilmä näkee mieluusti korrelaatioita ja riippuvuuksia myös siellä, missä niitä ei oikeasti ole. 4 Yhteenveto Tässä tutkielmassa tarkasteltiin lyhyesti tavallisimpia signaalinkäsittelyn työkaluja mikrosiruanalytiikassa. Huomattiin, että ongelma on vaikea ja että vastauksia on vähemmän kuin kysymyksiä. Ymmärrettävien lähteiden vähyys on yksi ongelmista, joten asian käsittämisksi tarvitsee yhdistellä omia kokemuksia koulussa opittuihin asioihin. Kirjallisuudesta saa hyviä ideoita, ongelmaksi muodostuu kuitenkin se, että julkaisuissa mennään hyvin nopeasti niin syvälle, että ymmärryksen taso laskee eksponentiaalisesti luettujen sanojen määrän kasvaessa. Tässä tutkielmassa on lisäksi jätetty tilastolliset analyysimenetelmät kokonaan käsittelemättä, koska niiden käytössä on kyse jo muustakin kuin signaalinkäsittelystä. Lienee kuitenkin aiheellista muistaa ja korostaa vielä sitä, että signaalinkäsittely on kaiken DNA-mikrosiruanalyysin perusta, jota ilman ei koko dataa edes olisi olemassa. 4 5 Lähteitä ja lisätietoa Tässä tutkielmassa on käytetty lähteinä lähinnä tekijän omaa käytännön työkokemusta ja koulusivistystä aihealueen piiristä. Aihealueen kirjallisuus biologian osalta on laajaa. Datan

9 11/24/ analyysistä on olemassa lukuisia tieteellisiä artikkeleita, mutta sirun skannauksen ja mittauspisteiden erottelemisen osalta kirjallisuudessa on aukko ja tietoa on erittäin vaikea löytää. Ohessa kuitenkin viitteitä taustojen hahmottamisen helpottamiseksi. Googlen avulla voi kiinnostunut etsiä lisätietoa esimerkiksi hakusanoilla DNA microarray, systems biology ja gene expression. 1. European Bioinformatics Institute: A quick introduction to elements of biology - cells, molecules, genes, functional genomics, microarrays. Sivusto tarjoaa erinomaisen tiivistelmän siitä, mistä molekyylibiologiassa on kyse ja mitä mikrosiruilla voidaan tehdä. 2. Lähdesmäki H. et al.: Using signal processing tools to improve the quality of microarray time-series measurements. Technical report, Tampere University of Technology, Tamperelaiset ovat edelläkäviöitä systeemibiologisessa tutkimuksessa ja mikrosirudatan signaalinkäsittelyssä. 3. Flash-animaatio siitä, miten mikrosirukoe suoritetaan. Suosittelen katsomaan. Tällä pätkällä on viihdearvoa ja ääniefektit mukana.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien


Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


Perinnöllinen informaatio ja geneettinen koodi.

Perinnöllinen informaatio ja geneettinen koodi. Tehtävä A1 Kirjoita essee aiheesta: Perinnöllinen informaatio ja geneettinen koodi. Vastaa esseemuotoisesti, älä käytä ranskalaisia viivoja. Piirroksia voi käyttää. Vastauksessa luetaan ansioksi selkeä


Matemaatikot ja tilastotieteilijät

Matemaatikot ja tilastotieteilijät Matemaatikot ja tilastotieteilijät Matematiikka/tilastotiede ammattina Tilastotiede on matematiikan osa-alue, lähinnä todennäköisyyslaskentaa, mutta se on myös itsenäinen tieteenala. Tilastotieteen tutkijat


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


Taulukot. Jukka Harju, Jukka Juslin 2006 1

Taulukot. Jukka Harju, Jukka Juslin 2006 1 Taulukot Jukka Harju, Jukka Juslin 2006 1 Taulukot Taulukot ovat olioita, jotka auttavat organisoimaan suuria määriä tietoa. Käsittelylistalla on: Taulukon tekeminen ja käyttö Rajojen tarkastus ja kapasiteetti


Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,


Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016


Rahastosalkun faktorimallin rakentaminen

Rahastosalkun faktorimallin rakentaminen Teknillinen korkeakoulu Mat 2.177 Operaatiotutkimuksen projektityöseminaari Kevät 2007 Evli Pankki Oyj Väliraportti 28.3.2007 Kristian Nikinmaa Markus Ehrnrooth Matti Ollila Richard Nordström Ville Niskanen


Hiirten ja rottien sydännäytteistä tuotetun mikrosirudatan analysointi

Hiirten ja rottien sydännäytteistä tuotetun mikrosirudatan analysointi Hiirten ja rottien sydännäytteistä tuotetun mikrosirudatan analysointi Tiedonlouhinnan harjoitustyö 9.6.2013 Antti Kurronen Irene Pöllänen antti.kurronen@student.uef.fi 1 YLEISKUVAUS (ANTTI KURRONEN) Tutkimuksessa


Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä


Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen


Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien


DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla



KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,


Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä

Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä Evoluutio ja luominen Mian tekemä esitys Jannen esittämänä Väite: tiedemiehet ovat todistaneet evoluutioteorian todeksi Evoluutioteorialla tässä tarkoitan teoriaa, jonka mukaan kaikki elollinen on kehittynyt



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


Otannasta ja mittaamisesta

Otannasta ja mittaamisesta Otannasta ja mittaamisesta Tilastotiede käytännön tutkimuksessa - kurssi, kesä 2001 Reijo Sund Aineistot Kvantitatiivisen tutkimuksen aineistoksi kelpaa periaatteessa kaikki havaintoihin perustuva informaatio,





Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2. 21.2. 2006, Nisse Suutarinen

Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2. 21.2. 2006, Nisse Suutarinen Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2 21.2. 2006, Nisse Suutarinen Aivoalueen monimutkaistuminen eriytymällä Eriytyminen (segregation) aivojen evoluutiosta puhuttaessa on tapahtuma, jossa


Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan?

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? 2012-2013 Lasse Lensu 2 Ihmisen, eläinten ja kasvien hyvinvoinnin kannalta nykyaikaiset mittaus-,


Mikrosirut ja niiden data-analyysi

Mikrosirut ja niiden data-analyysi Mikrosirut ja niiden data-analyysi S-114.2510 Laskennallinen systeemibiologia 11. Luento: To 24.4.2008 Oppimistavoitteet Mikä on mikrosiru ja miten niitä tehdään Millaisia mikrosiruja on olemassa Kuinka


Mitä on laadullinen tutkimus? Pertti Alasuutari Tampereen yliopisto

Mitä on laadullinen tutkimus? Pertti Alasuutari Tampereen yliopisto Mitä on laadullinen tutkimus? Pertti Alasuutari Tampereen yliopisto Määritelmiä Laadullinen tutkimus voidaan määritellä eri tavoin eri lähtökohdista Voidaan esimerkiksi korostaa sen juuria antropologiasta


Geeniekspressioiden klusterointi

Geeniekspressioiden klusterointi Geeniekspressioiden klusterointi Katja Saarela Katja.Saarela@cs.helsinki.fi Klusterointimenetelmät-seminaari Helsingin yliopisto, tietojenkäsittelytieteen laitos Raportti C-2002-54, s. 64-75, marraskuu


Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow Genomi Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta Hannu Sariola, Irma Thesleff ja Marja Makarow Malliorganismeiksi kutsutaan lajeja, joita tutkijat käyttävät


Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten


9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun


SUDOKU - ratkaisuohjeet. Jarno Tuimala 18.9.2005

SUDOKU - ratkaisuohjeet. Jarno Tuimala 18.9.2005 SUDOKU - ratkaisuohjeet Jarno Tuimala 18.9.2005 Japanilainen sudoku Seuraavassa on esitetty ohjeet japanilaistyyppisten sudoku-ristikoiden ratkontaan. Japanilaisia ristikoita luonnehtivat seuraavat piirteet:


Mat 2.4177 Operaatiotutkimuksen projektityöseminaari

Mat 2.4177 Operaatiotutkimuksen projektityöseminaari Mat 2.4177 Operaatiotutkimuksen projektityöseminaari Kemira GrowHow: Paikallisen vaihtelun korjaaminen kasvatuskokeiden tuloksissa 21.2.2008 Ilkka Anttila Mikael Bruun Antti Ritala Olli Rusanen Timo Tervola


Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina



- MIKSI TUTKIMUSNÄYTTÖÖN PERUSTUVAA TIETOA? - MISTÄ ETSIÄ? THM M Mustajoki Sairaanhoitajan käsikirjan päätoimittaja - MIKSI TUTKIMUSNÄYTTÖÖN PERUSTUVAA TIETOA? - MISTÄ ETSIÄ? M Mustajoki 290506 1 Miksi? Kaikilla potilas(!) ja sairaanhoitaja - sama tieto Perustelut


Round table -neuvottelu eduskunnassa

Round table -neuvottelu eduskunnassa 1 Round table -neuvottelu eduskunnassa 31.05.2005 STM:n visio biopankkilainsäädännöstä ja sen nykytila ministeriössä Apulaisosastopäällikkö Marja-Liisa Partanen, STM 2 Professori Juhani Eskola: Molekyylibiologiasta


Materiaalinäytteiden qpcr-tulosten tulkinnasta

Materiaalinäytteiden qpcr-tulosten tulkinnasta Materiaalinäytteiden qpcr-tulosten tulkinnasta Helena Rintala ja Teija Meklin Sisäilmastoseminaari 13.3.2014 Taustaa qpcr (kvantitatiivinen PCR) on nopea menetelmä mikrobien toteamiseen Käytetty paljon


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja


Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä

Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä Huippuyksikköseminaari 12.11.2013 Leena Vähäkylä Menestystarinat Akatemian viestinnässä Akatemian pitkäjänteinen rahoitus laadukkaaseen tutkimukseen näkyy rahoitettujen ja menestyneiden tutkijoiden tutkijanurasta


Toimittaja Sovellusarkkitehtuuritason pilkkominen. Kalle Launiala, ProtonIT Oy

Toimittaja Sovellusarkkitehtuuritason pilkkominen. Kalle Launiala, ProtonIT Oy Toimittaja Sovellusarkkitehtuuritason pilkkominen Kalle Launiala, ProtonIT Oy kalle.launiala@protonit.net +358445575665 Sisällön rakenne Tekninen ratkaisu vs. Looginen ratkaisu Looginen ratkaisu ja sen



PIKSELIT JA RESOLUUTIO PIKSELIT JA RESOLUUTIO 22.2.2015 ATK Seniorit Mukanetti ry / Tuula P 2 Pikselit ja resoluutio Outoja sanoja Outoja käsitteitä Mikä resoluutio? Mikä pikseli? Mitä tarkoittavat? Miksi niitä on? Milloin tarvitaan?


epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio:

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio: -mesenkyymi-vuorovaikutukset, esimerkkinä hammas ja ihokarva elimiä muodostuu kaikista alkiokerroksista, usein epiteelin ja mesenkyymin vuorovaikutuksesta epiteeli ektodermi kumpi aloittaa elimen kehityksen:


Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa

Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa 1 Sisältö - Sisäympäristön laatu kouluissa - Tutkimuksen taustaa - Siivouksen arviointiin liittyvien


Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä?

Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Antti Latvala Sosiaalilääketieteen päivät 28.11.2012 Esityksen teemat Miksi ja miten huomioida geneettisten





PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna Ihmisen keho muodostuu miljardeista soluista. Vaikka nämä solut ovat tietyssä mielessä meidän omiamme, ne polveutuvat itsenäisistä yksisoluisista elämänmuodoista, jotka ovat säilyttäneet monia itsenäisen


SoberIT Software Business and Engineering Institute T-121.110. Testaussuunnitelma paperiprototyyppi ja Kevät 2003 HELSINKI UNIVERSITY OF TECHNOLOGY

SoberIT Software Business and Engineering Institute T-121.110. Testaussuunnitelma paperiprototyyppi ja Kevät 2003 HELSINKI UNIVERSITY OF TECHNOLOGY T-121.110 Testaussuunnitelma paperiprototyyppi ja Kevät 2003 Yleistä Palautus viikolla 10 Vaiheessa palautetaan Prototyypin testaussuunnitelma Prototyypin navigaatiokartta Prototyyppi 1. Paperiprototyyppi


Kun älykkäät koneet ja muu teknologinen kehitys yhdistyvät asiantuntijatyössä

Kun älykkäät koneet ja muu teknologinen kehitys yhdistyvät asiantuntijatyössä Kun älykkäät koneet ja muu teknologinen kehitys yhdistyvät asiantuntijatyössä Dosentti Osmo Kuusi Aalto-yliopisto, Turun Yliopisto 11/15/16 Professiot asiantuntevuuden ydinryhmä Perinteisesti professiolla



UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA LIITU-päivä 4.5.2006 FT Helena Rintala Kansanterveyslaitos, Ympäristöterveyden osasto Mihin sisäympäristön mikrobien mittauksia tarvitaan? Rakennusten


HMM ja geenien etsintä

HMM ja geenien etsintä Kuten makovin mallien yhteydessä, niin HMM halutulla topologialla voidaan opettaa tunnistamaan geenejä. Ohessa eäs geenitunnistukseen käytetty topologia, joka tunnistaa ihmisen geenit (5 -> 3 ). Edellä


S-114.2720 Havaitseminen ja toiminta

S-114.2720 Havaitseminen ja toiminta S-114.2720 Havaitseminen ja toiminta Heikki Hyyti 60451P Harjoitustyö 2 visuaalinen prosessointi Treismanin FIT Kuva 1. Kuvassa on Treismanin kokeen ensimmäinen osio, jossa piti etsiä vihreätä T kirjainta.





Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se



NÄYTÖN ARVIOINTI: SYSTEMAATTINEN KIRJALLISUUSKATSAUS JA META-ANALYYSI. EHL Starck Susanna & EHL Palo Katri Vaasan kaupunki 22.9. NÄYTÖN ARVIOINTI: SYSTEMAATTINEN KIRJALLISUUSKATSAUS JA META-ANALYYSI EHL Starck Susanna & EHL Palo Katri Vaasan kaupunki 22.9.2016 Näytön arvioinnista Monissa yksittäisissä tieteellisissä tutkimuksissa


PSY181 Psykologisen tutkimuksen perusteet, kirjallinen harjoitustyö ja kirjatentti

PSY181 Psykologisen tutkimuksen perusteet, kirjallinen harjoitustyö ja kirjatentti PSY181 Psykologisen tutkimuksen perusteet, kirjallinen harjoitustyö ja kirjatentti Harjoitustyön ohje Tehtävänäsi on laatia tutkimussuunnitelma. Itse tutkimusta ei toteuteta, mutta suunnitelman tulisi


Suunnitelma Perinnöllisyys T9

Suunnitelma Perinnöllisyys T9 Suunnitelma Perinnöllisyys T9 Oppimistavoitteet Järjestelmällisten biologisten laboratoriotutkimuksien tekeminen. Perinnöllisyyteen liittyvien käsitteiden, mallien ja teorioiden ymmärtäminen ja käyttäminen


6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?


Entsyymit ja niiden tuotanto. Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä

Entsyymit ja niiden tuotanto. Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä Entsyymit ja niiden tuotanto Niklas von Weymarn, VTT Erikoistutkija ja tiiminvetäjä Mitä ovat entsyymit? Entsyymit ovat proteiineja (eli valkuaisaineita), jotka vauhdittavat (katalysoivat) kemiallisia


Teema 3: Tilastollisia kuvia ja tunnuslukuja

Teema 3: Tilastollisia kuvia ja tunnuslukuja Teema 3: Tilastollisia kuvia ja tunnuslukuja Tilastoaineiston peruselementit: havainnot ja muuttujat havainto: yhtä havaintoyksikköä koskevat tiedot esim. henkilön vastaukset kyselylomakkeen kysymyksiin


Kansainvälinen rahatalous Matti Estola. Termiinikurssit ja swapit valuuttariskien hallinnassa

Kansainvälinen rahatalous Matti Estola. Termiinikurssit ja swapit valuuttariskien hallinnassa Kansainvälinen rahatalous Matti Estola ermiinikurssit ja swapit valuuttariskien hallinnassa 1. Valuuttariskien suojauskeinot Rahoitusalan yritykset tekevät asiakkailleen valuuttojen välisiä termiinisopimuksia


Aineistokoko ja voima-analyysi

Aineistokoko ja voima-analyysi TUTKIMUSOPAS Aineistokoko ja voima-analyysi Johdanto Aineisto- eli otoskoon arviointi ja tutkimuksen voima-analyysi ovat tilastollisen tutkimuksen suunnittelussa keskeisimpiä asioita. Otoskoon arvioinnilla


Leo Lahti Vertaileva toiminnallinen genomianalyysi assosiatiivisella ryhmittelymenetelmällä

Leo Lahti Vertaileva toiminnallinen genomianalyysi assosiatiivisella ryhmittelymenetelmällä TEKNILLINEN KORKEAKOULU Teknillisen fysiikan ja matematiikan osasto Leo Lahti Vertaileva toiminnallinen genomianalyysi assosiatiivisella ryhmittelymenetelmällä Diplomi-insinöörin tutkintoa varten tarkastettavaksi


Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi


Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa



BIOLOGIAN KYSYMYKSET BIOLOGIAN KYSYMYKSET Biologian osakokeessa on 10 kysymystä. Tarkista, että saamassasi vastausmonisteessa on sivut 1-10 numerojärjestyksessä. Tarkastajien merkintöjä varten 1 2 3 4 5 6 7 8 9 10 max 80p


Mitä on konvoluutio? Tutustu kuvankäsittelyyn

Mitä on konvoluutio? Tutustu kuvankäsittelyyn Mitä on konvoluutio? Tutustu kuvankäsittelyyn Tieteenpäivät 2015, Työohje Sami Varjo Johdanto Digitaalinen signaalienkäsittely on tullut osaksi arkipäiväämme niin, ettemme yleensä edes huomaa sen olemassa


Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa

Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Maria Valkonen, Kaisa Jalkanen, Martin Täubel, Anne Hyvärinen 31.3.2014 Sisäilmastoseminaari 2014 1 Tausta Asumisterveysoppaan mukaiset sisäympäristön


Projektisuunnitelma. Projektin tavoitteet

Projektisuunnitelma. Projektin tavoitteet Projektisuunnitelma Projektin tavoitteet Projektin tarkoituksena on tunnistaa erilaisia esineitä Kinect-kameran avulla. Kinect-kamera on kytkettynä tietokoneeseen, johon projektissa tehdään tunnistuksen


HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan


Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,


Ennaltaehkäisevien sosiaalipalvelujen kustannusvaikutusten osoittaminen rekisteritutkimuksella: Case Espoo

Ennaltaehkäisevien sosiaalipalvelujen kustannusvaikutusten osoittaminen rekisteritutkimuksella: Case Espoo Ennaltaehkäisevien sosiaalipalvelujen kustannusvaikutusten osoittaminen rekisteritutkimuksella: Case Espoo KÄPI-seminaari 16.6.2014 Tutkimuksen tavoitteet ja aineistot Perheelliset asunnottomat Espoossa


Tehdään laadukas painotuote

Tehdään laadukas painotuote Tehdään laadukas painotuote 8 vinkkiä valokuvien ottamisesta ja toimittamiseen painotuotteisiin 1. Kuvaa kameran parhailla asetuksilla Kuvien tarkkuuden ja tiedostopakkauksen vaikutukset ovat korostuneet



BIOSÄHKÖISET MITTAUKSET TEKSTIN NIMI sivu 1 / 1 BIOSÄHKÖISET MITTAUKSET ELEKTROENKEFALOGRAFIA EEG Elektroenkegfalografialla tarkoitetaan aivojen sähköisen toiminnan rekisteröintiä. Mittaus tapahtuu tavallisesti ihon pinnalta,


Basic Raster Styling and Analysis

Basic Raster Styling and Analysis Basic Raster Styling and Analysis QGIS Tutorials and Tips Author Ujaval Gandhi http://google.com/+ujavalgandhi Translations by Kari Salovaara This work is licensed under a Creative Commons Attribution


Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä


5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2)

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2) 5.7 Biologia Biologia tutkii elämää ja sen edellytyksiä. Opetus syventää aikuisopiskelijan luonnontuntemusta ja auttaa ymmärtämään luonnon perusilmiöitä. Biologian opiskelu kehittää opiskelijan luonnontieteellistä


Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia


- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa Kertaus CHEM-C2300 0 Tällä luennolla: - Oletteko lukeneet artikkelia, käydäänkö läpi? - Ehdotuksia tenttikysymyksiin? - Käydään läpi kurssin keskeiset asiakokonaisuudet otsikkotasolla - Extra: PCR-alukkeiden


5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin


LOPPURAPORTTI. DNA Kaupan henkilöstön kehittämishanke

LOPPURAPORTTI. DNA Kaupan henkilöstön kehittämishanke 1 2016 LOPPURAPORTTI DNA Kaupan henkilöstön kehittämishanke DNA Kauppa järjesti yhdessä valmennusyritys Kaswun kanssa henkilöstön kehittämishankkeen. Tästä syntyi oppimisen iloa, sitoutumista ja tuloksia.


Say it again, kid! - peli ja puheteknologia lasten vieraan kielen oppimisessa

Say it again, kid! - peli ja puheteknologia lasten vieraan kielen oppimisessa Say it again, kid! - peli ja puheteknologia lasten vieraan kielen oppimisessa Sari Ylinen, Kognitiivisen aivotutkimuksen yksikkö, käyttäytymistieteiden laitos, Helsingin yliopisto & Mikko Kurimo, signaalinkäsittelyn


Tiedon louhinnan teoria (ja käytäntö) OUGF kevätseminaari 2004 Hannu Toivonen

Tiedon louhinnan teoria (ja käytäntö) OUGF kevätseminaari 2004 Hannu Toivonen Tiedon louhinnan teoria (ja käytäntö) OUGF kevätseminaari 2004 Hannu Toivonen hannu.toivonen@cs.helsinki.fi 1 2 A 1 4 8 2 2 1 2 6 2 A 2 4 3 7 3 2 8 4 2 A 4 5 2 4 5 5 2 6 4 A 7 2 3 7 5 4 5 2 2 A 5 2 4 6


Higgsin bosonin etsintä CMS-kokeessa LHC:n vuosien 2010 ja 2011 datasta CERN, 13 joulukuuta 2011

Higgsin bosonin etsintä CMS-kokeessa LHC:n vuosien 2010 ja 2011 datasta CERN, 13 joulukuuta 2011 Higgsin bosonin etsintä CMS-kokeessa LHC:n vuosien 2010 ja 2011 datasta CERN, 13 joulukuuta 2011 Higgsin bosoni on ainoa hiukkasfysiikan standardimallin (SM) ennustama hiukkanen, jota ei ole vielä löydetty


4G LTE-verkkojen sisätilakuuluvuusvertailu 1H2014

4G LTE-verkkojen sisätilakuuluvuusvertailu 1H2014 4G LTE-verkkojen sisätilakuuluvuusvertailu 1H2014 27. kesäkuuta 2014 Omnitele Ltd. Mäkitorpantie 3B P.O. Box 969, 00101 Helsinki Finland Puh: +358 9 695991 Fax: +358 9 177182 E-mail: contact@omnitele.fi


Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki



KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN Suomen Ympäristösairauskeskus perustettiin viime vuonna ajantasaisen ympäristösairaustiedon asiantuntijakeskukseksi. Tavoitteena on ajantasaisen,


Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyvaikutuksen synty Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyn ja biologisen materian vuorovaikutus Koska ihmisestä 70% on vettä, todennäköisin (ja tärkein) säteilyn ja biologisen





Luento 6: 3-D koordinaatit

Luento 6: 3-D koordinaatit Maa-57.300 Fotogrammetrian perusteet Luento-ohjelma 1 2 3 4 5 6 7 8 9 10 11 12 13 Luento 6: 3-D koordinaatit AIHEITA (Alkuperäinen luento: Henrik Haggrén, 16.2.2003, Päivityksiä: Katri Koistinen 5.2.2004


Lakeja yms. Tässä luennossa. Millaista tietoa? Tietoon perustuva suostumus siirretäänkö vastuu tutkittavalle?

Lakeja yms. Tässä luennossa. Millaista tietoa? Tietoon perustuva suostumus siirretäänkö vastuu tutkittavalle? Lakeja yms. Tietoon perustuva suostumus siirretäänkö vastuu tutkittavalle? Helena Kääriäinen TY/TYKS Laki lääketieteellisestä tutkimuksesta 488/1999 (2004) Potilaslaki 785/1992, henkilötietolaki 523/1999


EVTEK/ Antti Piironen & Pekka Valtonen 1/6 TM01S/ Elektroniikan komponentit ja järjestelmät Laboraatiot, Syksy 2003

EVTEK/ Antti Piironen & Pekka Valtonen 1/6 TM01S/ Elektroniikan komponentit ja järjestelmät Laboraatiot, Syksy 2003 EVTEK/ Antti Piironen & Pekka Valtonen 1/6 TM01S/ Elektroniikan komponentit ja järjestelmät Laboraatiot, Syksy 2003 LABORATORIOTÖIDEN OHJEET (Mukaillen työkirjaa "Teknillisten oppilaitosten Elektroniikka";
