T Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

Koko: px
Aloita esitys sivulta:

Download "T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa"


1 T Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E




5 11/24/ Johdanto DNA-mikrosiruteknologia on mullistanut molekyylibiologian tutkimuksen. Aikaisemmin tutkijat tutkivat yhtä molekyyliä kerrallaan. Nyt voidaan yhdestä kudosnäytteestä mitata tuhansien geenien yhtäaikaista toimintaa. Mikrosirudatan myötä on biologisen tiedon määrä ja luonne kuitenkin kasvanut valtavasti. Aikaisemmin pärjättiin visuaalisella tarkastelulla, ja hypoteeseihin saatiin kyllä ja ei -tyyppisiä vastauksia. Nyt numeerista dataa on enemmän kuin ihmissilmä ja -aivot kykenevät kerralla prosessoimaan, joten laskennalliset menetelmät ovat välttämättömiä myös perinteisesti ei-matemaattisessa biologiassa. Tässä tutkielmassa tarkastellaan DNA-mikrosirudatan analysointia signaalinkäsittelyn menetelmien avulla. Aiheesta ei ole mitään yksittäistä lähdeteosta, koska ala on vielä niin uusi. Lähteenä toimivat useat erilaiset tieteelliset artikkelit, koulusivistys ja vuoden työkokemus alalta. Tämä tutkielma on pikemminkin tekijänsä tulkinta aikaisempien tietojensa ja signaalinkäsittelyn kurssilla oppimansa materiaalin yhdistämisestä. Luvussa 2 kuvaillaan DNA-mikrosiruteknologian perusteet ja sitä millaisiin kysymyksiin sillä etsitään vastauksia. Luvussa 3 käydään läpi mikrosiruanalyysissä käytetyimpiä ja välttämättömimpiä signaalinkäsittelyn menetelmiä. Luvussa 4 esitetään vielä yhteenveto ja loppusanat. 2 Biologiaa DNA-mikrosiruteknologialla 2.1 Molekyylibiologian perusteet Elollinen aine koostuu itsenäisistä yksiköistä, soluista. Solun tuma on sen komentokeskus, jossa sijaitsee elämän ohjekirja, DNA-molekyylit. DNA koodaa bioaktiivisia makromolekyylejä, proteiineja, jotka osallistuvat lähes kaikkeen elävässä aineessa tapahtuvaan toimintaan. Ihmisen solun DNA koostuu noin 3 miljardista neljän erilaisen nukleotidiemäksen muodostamasta ketjusta. Geeni on lyhyt ( emäsparia pitkä) proteiinia koodaava pätkä DNA:ta. Ihmisen genomin arvioidaan koostuvan noin geenistä. Solu vastaa ympäristöstä saamiinsa ärsykkeisiin esimerkiksi valmistamalla proteiineja eli expressoimalla geenejään. DNA-mikrosiruteknologialla voidaan mitata geenin ekspressiotasoa. Molekyylibiologian keskusdogman mukaan DNA makes RNA makes protein eli DNA tekee RNA:n (DNA:n tyyppinen molekyyli), joka tekee proteiinin. Tämän hetkisen käsityksen mukaan geenin korkea ekspressiotaso johtaa sitä geeniä vastaavan proteiinin suureen tuotantoon. Tämän hetkinen molekyylibiologian suurimpia haaste on ymmärtää solun toimintaa ja geenien säätelyverkkoja geeniekspressiodatan avulla. Tällä hetkellä kahden organismin, hiivan (Saccharomycces cerecisiae) ja banaanikärpäsen (Drosophila melanogaster) geenisäätelyverkot tunnetaan pääpiirteittäin. Näiden eliöiden genomit koostuvat reilusti alle :sta geenistä. Geenisäätelyverkkojen tunteminen on vain yksi askel matkalla solun toiminnan selvittämiseen. Ei nimittäin riitä, että tiedetään geenin A aktivoivan geeniä B. Voi nimittäin olla, että geeni B aktivoituu vain silloin, kun geenin A ekspressio ylittää tietyn kynnysarvon. Toisaalta geeni C saattaa deaktivoitua silloin, kun geeni A aktivoi geenin B. Pitää muistaa,

6 11/24/ että ihmisen genomissa on noin muuttujaa, joista jotkut voivat vuorovaikuttaa useammankin kohteen kanssa. Molekyylibiologisen tiedon uskotaan tuottavan tulevaisuudessa uusia hoitomuotoja ja lääkkeitä perinöllisten sairauksien hoitoon. Puhutaan ns. räätälöidyistä lääkkeistä, myös siitä, että samaan vaivaan voidaan määrätä kahdelle eri henkilölle täysin erilaista lääkettä näiden henkilöiden geneettisen sormenjäljen, eli perimän, perusteella. Jo nyt on näyttöä siitä, että esimerkiksi sydän- ja verisuonitaudeilla on geneettisiä alttiustekijöitä ja että ihmiset, joilla on geenimuoto A eräästä geenistä hyötyvät olemassa olevasta lääkkeestä, kun taas potilaat, joilla on geenimuoto B, eivät hyödy samasta kalliista hoidosta mitenkään, koska heidän solunsa eivät kykene hyödyntämään sitä. 2.2 DNA-mikrosiruteknologia DNA-mikrosiruteknologia on yksinkertaisuudessaan sitä, että mitataan kuinka paljon mikrosirulle laitettua DNA-koetinta vastaavaa geeniä on tutkittavassa näytteessä. Fyysisesti mikrosiru on noin neliösenttimetrin kokoinen lasilevy, jolle sijoitetaan eri geeniä vastaavia koettimia. Esimerkiksi ihmisen geenejä mittaavissa siruissa on noin erilaista mittauspistettä, koetinsekvenssityyppiä, yhden neliösenttimetrin alueella. Lisäksi jokaisesta koetinsekvenssistä on miljoonia replikaatteja yhdessä mittauspisteessä. Käytännössä tutkittava DNA-näyte uutetaan perinteisillä molekyylibiologian tekniikoilla solusta. Koska yhdestä solusta ei voida saada tarpeeksi suurta määrää DNA:ta, otetaan näyte kudoksesta, joka on samankaltaisten solujen muodostama funktionaalinen kokonaisuus. Näyte leimataan fluoresoivalla aineella ja pipetoidaan mikrosirulle sekä annetaan näytteen DNA:n hybridisoitua eli liittyä koettimiin (Kuva 1). Tämän jälkeen siru skannataan laser-skannerilla. Laser saa näytteen fluoresenssileiman emittoimaan valoa ja skanneri vastaanottaa tuon valon intensiteetin. Tämän vaiheen jälkeen mikrosirudata on sähköisessä muodossa ja datan prosessointi alkaa. Kuva 1DNA-näyte otetaan soluryhmistä. Näytteen annetaan tarttua mikrosirun koettimiin. Näytteen emittoima fluoresenssivalo havaitaan skannerilla. Tuloksena on kuva geeniekspressioiden intensiteeteistä.[1]

7 11/24/ Signaalinkäsittelyn menetelmät mikrosirudatan prosessoinnissa 3.1 Kuvasta dataksi Skannauksen tuloksena on harmaaväripikselikuva, jossa kutakin mittauspistettä vastaa 16 pikseliä. Yleensä näiden 16 pikselin intensiteeteissä on hajontaa. Ensimmäinen tehtävä on siis määrittää, mikä on oikeasta geenin ekspressiosta tulevaa signaalia ja mikä taustakohinaa. Tämä on vaativa hahmontunnistustehtävä. Tarkoitus kun on erottaa viereiset mittauspisteet toisistaan ja tämän jälkeen vielä päättää mittauspisteiden sisäisen hajonnan tarkastelun jälkeen kompromissiarvo mittauspisteen geeniekspressiolle. Mittana voidaan käyttää mittauspisteen pikseleiden keskiarvoa, mediaania tai jotain muuta sopivaa arvoa. Mikrosiruja käytettäessä taustakohinan erottaminenkin on toisinaan ongelma. Käytännön teknisten ongelmien vuoksi taustakohina on erilaista sirun eri kohdissa. Esimerkiksi sirun reunoilla kohinaongelma on yleensä suurempi. Siksi taustakohinan poistamiseksi ei ole yhtä ja ainoata oikeaa ratkaisua. Tavoitteena olisi kuitenkin, että taustakohina, jos sitä ei voida poistaa kokonaan, ei olisi paikkariippuva. Skannatusta kuvasta lasketaan kohinanpoiston jälkeen geeniekspressiointensiteetit eli kuinka paljon kutakin geeniä ilmentyy tutkittavassa kudoksessa sillä ajan hetkellä ( lukumäärä ). Näitä intensiteettiarvoja käytetään, kun dataa aletaan tutkia tiedon löytämiseksi. Kuva 2 esittää kohinapoistettua ja false colour -värjättyä ekspressiodataa, josta ei vielä sinällään saada kunnollista tietoa, mutta voidaan osoittaa silmämääräiset ekspressiotasot. Vihreät ja punaiset pisteet osoittavat, että näytteistä joko vihreällä tai punaisella leimatut molekyylit dominoivat mittauspisteen geenin ilmentymistä. Keltainen väri indikoi, että molempien näytteiden geenien ekspressiot ovat kutakuinkin samat. Mustilta alueilta ei olla saatu mittausdataa. Joko siinä ei edes ole ollut koetinta mittaamaan geenin ekspressiota tai sitten ekspressiotaso ei ole yltänyt skannerin resoluutiotasolle. Kuva 2Geeniekspressiodata kuvana: hiivan geeniekspressio. [1], modifioitu

8 3.2 Tilastollinen analyysi kunniaan 11/24/2003 On muistettava, että mikrosirulla mitattu DNA on peräisin useista tuhansista soluista. Koska solut ovat itsenäisiä ympäristöönsä reagoivia yksiköitä, niiden geeniekspressiot eivät ole identtisiä. Voidaan kuitenkin olettaa, että kukin näytteen solu on osallisena yhtä suurella painolla ja siksi tulkita datapiste näytteen geeniekspressioiden keskiarvoksi. Tämä koskee siis vain yhtä datakuvan pikseliä. 3.3 Aikasarjadata Lienee helpointa tarkastella mikrosirudatan tulkintaa ja analyysiä signaalinkäsittelyn kannalta aikasarjojen avulla. DNA-mikrosiruista saadaan aikasarjadataa vain silloin, kun näytteitä otetaan tietyin aikavälein ja kustakin näytteestä tehdään oma sirunsa. Biologiset aikasarjat eroavat kuitenkin monista muista aikasarjoista. Ensinnäkin näytteitä on vaikea saada juuri tietyllä ajanhetkellä, koska näytteiden kanssa on oltava hyvin varovainen. Toisekseen DNA-analytiikka on hyvin kallista. Yksi sirukoe maksaa noin 1000 euroa. Toisin sanoen dataa ja taustatietoa on vähän ja aikasarjan näytteenottoajankohdat saattavat olla hieman epämääräiset. Useat biologiset prosessit ovat luonteeltaan syklisiä. Myös solun elämä on jatkuvaa kiertoa: solu jakaantuu, ylläpitää toimintojaan, valmistautuu jakaantumaan ja jakaantuu uudelleen. On hyvin tyypillistä, että tietoa etsiessä halutaan löytää geenit, joiden ekspressiot muuttuvat solusyklin mukana. Olettaen, että datassa on jotain jaksollisia komponentteja, ne pitäisi pystyä löytämään Fourier-muunnoksen avulla. Samalla nähdään minkä pituisia jaksoja ja kuinka voimakkaasti näitä jaksoja on olemassa. Joskus voidaan haluta selvittää jonkin geeniperheen reagointia tiettyyn ärsykkeeseen, esimerkiksi sitä miten koivuallergisen ihmisen silmäluomen epiteelisolut reagoivat koivun siitepölyyn. Tämän jälkeen voidaan seurata näiden geenien ekspressiotasojen muutoksia. Hyvänä apuna on risti- ja autokorrelaatiofunktiot, koska ihmissilmä näkee mieluusti korrelaatioita ja riippuvuuksia myös siellä, missä niitä ei oikeasti ole. 4 Yhteenveto Tässä tutkielmassa tarkasteltiin lyhyesti tavallisimpia signaalinkäsittelyn työkaluja mikrosiruanalytiikassa. Huomattiin, että ongelma on vaikea ja että vastauksia on vähemmän kuin kysymyksiä. Ymmärrettävien lähteiden vähyys on yksi ongelmista, joten asian käsittämisksi tarvitsee yhdistellä omia kokemuksia koulussa opittuihin asioihin. Kirjallisuudesta saa hyviä ideoita, ongelmaksi muodostuu kuitenkin se, että julkaisuissa mennään hyvin nopeasti niin syvälle, että ymmärryksen taso laskee eksponentiaalisesti luettujen sanojen määrän kasvaessa. Tässä tutkielmassa on lisäksi jätetty tilastolliset analyysimenetelmät kokonaan käsittelemättä, koska niiden käytössä on kyse jo muustakin kuin signaalinkäsittelystä. Lienee kuitenkin aiheellista muistaa ja korostaa vielä sitä, että signaalinkäsittely on kaiken DNA-mikrosiruanalyysin perusta, jota ilman ei koko dataa edes olisi olemassa. 4 5 Lähteitä ja lisätietoa Tässä tutkielmassa on käytetty lähteinä lähinnä tekijän omaa käytännön työkokemusta ja koulusivistystä aihealueen piiristä. Aihealueen kirjallisuus biologian osalta on laajaa. Datan

9 11/24/ analyysistä on olemassa lukuisia tieteellisiä artikkeleita, mutta sirun skannauksen ja mittauspisteiden erottelemisen osalta kirjallisuudessa on aukko ja tietoa on erittäin vaikea löytää. Ohessa kuitenkin viitteitä taustojen hahmottamisen helpottamiseksi. Googlen avulla voi kiinnostunut etsiä lisätietoa esimerkiksi hakusanoilla DNA microarray, systems biology ja gene expression. 1. European Bioinformatics Institute: A quick introduction to elements of biology - cells, molecules, genes, functional genomics, microarrays. Sivusto tarjoaa erinomaisen tiivistelmän siitä, mistä molekyylibiologiassa on kyse ja mitä mikrosiruilla voidaan tehdä. 2. Lähdesmäki H. et al.: Using signal processing tools to improve the quality of microarray time-series measurements. Technical report, Tampere University of Technology, Tamperelaiset ovat edelläkäviöitä systeemibiologisessa tutkimuksessa ja mikrosirudatan signaalinkäsittelyssä. 3. Flash-animaatio siitä, miten mikrosirukoe suoritetaan. Suosittelen katsomaan. Tällä pätkällä on viihdearvoa ja ääniefektit mukana.

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin


a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


Inferring Trichoderma reesei gene regulatory network

Inferring Trichoderma reesei gene regulatory network Inferring Trichoderma reesei gene regulatory network Oskari Vinko 29.04.2013 Ohjaaja: Merja Oja Valvoja: Harri Ehtamo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta osin


Matemaatikot ja tilastotieteilijät

Matemaatikot ja tilastotieteilijät Matemaatikot ja tilastotieteilijät Matematiikka/tilastotiede ammattina Tilastotiede on matematiikan osa-alue, lähinnä todennäköisyyslaskentaa, mutta se on myös itsenäinen tieteenala. Tilastotieteen tutkijat


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


Perinnöllinen informaatio ja geneettinen koodi.

Perinnöllinen informaatio ja geneettinen koodi. Tehtävä A1 Kirjoita essee aiheesta: Perinnöllinen informaatio ja geneettinen koodi. Vastaa esseemuotoisesti, älä käytä ranskalaisia viivoja. Piirroksia voi käyttää. Vastauksessa luetaan ansioksi selkeä


Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset


Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä

Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä Evoluutio ja luominen Mian tekemä esitys Jannen esittämänä Väite: tiedemiehet ovat todistaneet evoluutioteorian todeksi Evoluutioteorialla tässä tarkoitan teoriaa, jonka mukaan kaikki elollinen on kehittynyt


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122

Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122 Bioinformatiikan maisteriohjelman infotilaisuus 15.11.2007 Exactum D122 Bio- ja lääketieteiden opiskelu MBImaisteriohjelmassa Outi Monni, Dos, FT Biolääketieteen laitos 15.11.2007 Bioinformatiikan maisteriohjelma


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,


Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016


Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä


Rahastosalkun faktorimallin rakentaminen

Rahastosalkun faktorimallin rakentaminen Teknillinen korkeakoulu Mat 2.177 Operaatiotutkimuksen projektityöseminaari Kevät 2007 Evli Pankki Oyj Väliraportti 28.3.2007 Kristian Nikinmaa Markus Ehrnrooth Matti Ollila Richard Nordström Ville Niskanen


Taulukot. Jukka Harju, Jukka Juslin 2006 1

Taulukot. Jukka Harju, Jukka Juslin 2006 1 Taulukot Jukka Harju, Jukka Juslin 2006 1 Taulukot Taulukot ovat olioita, jotka auttavat organisoimaan suuria määriä tietoa. Käsittelylistalla on: Taulukon tekeminen ja käyttö Rajojen tarkastus ja kapasiteetti


Hiirten ja rottien sydännäytteistä tuotetun mikrosirudatan analysointi

Hiirten ja rottien sydännäytteistä tuotetun mikrosirudatan analysointi Hiirten ja rottien sydännäytteistä tuotetun mikrosirudatan analysointi Tiedonlouhinnan harjoitustyö 9.6.2013 Antti Kurronen Irene Pöllänen antti.kurronen@student.uef.fi 1 YLEISKUVAUS (ANTTI KURRONEN) Tutkimuksessa


Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen


Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien


DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista


Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2. 21.2. 2006, Nisse Suutarinen

Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2. 21.2. 2006, Nisse Suutarinen Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2 21.2. 2006, Nisse Suutarinen Aivoalueen monimutkaistuminen eriytymällä Eriytyminen (segregation) aivojen evoluutiosta puhuttaessa on tapahtuma, jossa



KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,


Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine


Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30 Tampereen yliopisto Bioteknologian tutkinto-ohjelma Valintakoe 21.5.2015 Henkilötunnus - Sukunimi Etunimet Tehtävä 3 Pisteet / 30 3. a) Alla on lyhyt jakso dsdna:ta, joka koodaa muutaman aminohappotähteen


Mitä on laadullinen tutkimus? Pertti Alasuutari Tampereen yliopisto

Mitä on laadullinen tutkimus? Pertti Alasuutari Tampereen yliopisto Mitä on laadullinen tutkimus? Pertti Alasuutari Tampereen yliopisto Määritelmiä Laadullinen tutkimus voidaan määritellä eri tavoin eri lähtökohdista Voidaan esimerkiksi korostaa sen juuria antropologiasta



PIKSELIT JA RESOLUUTIO PIKSELIT JA RESOLUUTIO 22.2.2015 ATK Seniorit Mukanetti ry / Tuula P 2 Pikselit ja resoluutio Outoja sanoja Outoja käsitteitä Mikä resoluutio? Mikä pikseli? Mitä tarkoittavat? Miksi niitä on? Milloin tarvitaan?


Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä

Ekologiset ympäristöongelmat. 10. Geeniteknologia. BI5 II Geeniteknologia 4. Geenitekniikan perusmenetelmiä Ekologiset ympäristöongelmat 10. Geeniteknologia Dna:n ja rna:n käsittely Eristäminen Puhdistaminen Lähetti-rna:t voidaan muuntaa niiden emäsjärjestystä vastaavaksi ns. komplementaariseksi dna:ksi (c-dna)


Geeniekspressio: Mikrosirut. Geneettinen bioinformatiikka

Geeniekspressio: Mikrosirut. Geneettinen bioinformatiikka Geeniekspressio: Mikrosirut Geneettinen bioinformatiikka Microarray Microarray is a compact device containing a very large number of capture molecules (synthetic oligos, PCR products, proteins, antibodies



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien



BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava


Yhtäläisyydet selkärankaisten aivoissa, osa II. Niko Lankinen

Yhtäläisyydet selkärankaisten aivoissa, osa II. Niko Lankinen Yhtäläisyydet selkärankaisten aivoissa, osa II Niko Lankinen Sisältö Neuroneille tyypilliset molekyylit Suoraa jatkoa Niinan esitykseen Alkion aivojen vertailua Neuromeerinen malli Neuromeerisen mallin


Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan?

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? 2012-2013 Lasse Lensu 2 Ihmisen, eläinten ja kasvien hyvinvoinnin kannalta nykyaikaiset mittaus-,


Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan?

Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Antipodidiversiteetin generointi Robert Koch (TB) 1905 Niels K. Jerne


Fysikaalisen kemian syventävät työt CCl 4 -molekyylin Ramanspektroskopia

Fysikaalisen kemian syventävät työt CCl 4 -molekyylin Ramanspektroskopia Fysikaalisen kemian syventävät työt CCl 4 -molekyylin Ramanspektroskopia Tiina Kiviniemi 11. huhtikuuta 2008 1 Johdanto Tämän työn tarkoituksena on tutustua käytännön Ramanspektroskopiaan sekä molekyylien


Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Edistyksen päivät, Helsinki. Voiko tutkija muuttaa maailmaa? Humanistista meta-analyysiä merkitysneuvottelevien koneiden avulla.

Edistyksen päivät, Helsinki. Voiko tutkija muuttaa maailmaa? Humanistista meta-analyysiä merkitysneuvottelevien koneiden avulla. Edistyksen päivät, Helsinki Voiko tutkija muuttaa maailmaa? Humanistista meta-analyysiä merkitysneuvottelevien koneiden avulla Timo Honkela timo.honkela@helsinki.fi 5.10.2017 Taustaa: Rauhankone-konsepti


Mikrosirut ja niiden data-analyysi

Mikrosirut ja niiden data-analyysi Mikrosirut ja niiden data-analyysi S-114.2510 Laskennallinen systeemibiologia 11. Luento: To 24.4.2008 Oppimistavoitteet Mikä on mikrosiru ja miten niitä tehdään Millaisia mikrosiruja on olemassa Kuinka


Biopolymeerit. Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä.

Biopolymeerit. Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä. Biopolymeerit Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä. Tärkeimpiä biopolymeerejä ovat hiilihydraatit, proteiinit ja nukleiinihapot. 1 Hiilihydraatit Hiilihydraatit jaetaan mono


Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus


Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä

Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Reportterigeenit ja reportterikonstruktiot? Monissa tilanteissa tarvitaan ilmaisinta (proobi, luotain, reportteri) kertomaan, mitä/missä/milloin


Otannasta ja mittaamisesta

Otannasta ja mittaamisesta Otannasta ja mittaamisesta Tilastotiede käytännön tutkimuksessa - kurssi, kesä 2001 Reijo Sund Aineistot Kvantitatiivisen tutkimuksen aineistoksi kelpaa periaatteessa kaikki havaintoihin perustuva informaatio,


Geeniekspressioiden klusterointi

Geeniekspressioiden klusterointi Geeniekspressioiden klusterointi Katja Saarela Katja.Saarela@cs.helsinki.fi Klusterointimenetelmät-seminaari Helsingin yliopisto, tietojenkäsittelytieteen laitos Raportti C-2002-54, s. 64-75, marraskuu


9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun


Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä

Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä Huippuyksikköseminaari 12.11.2013 Leena Vähäkylä Menestystarinat Akatemian viestinnässä Akatemian pitkäjänteinen rahoitus laadukkaaseen tutkimukseen näkyy rahoitettujen ja menestyneiden tutkijoiden tutkijanurasta


Uusia mahdollisuuksia FoundationOne

Uusia mahdollisuuksia FoundationOne Uusia mahdollisuuksia FoundationOne FI/FMI/1703/0019 Maaliskuu 2017 FoundationOne -palvelu FoundationOne on kattava genomianalysointipalvelu, jossa tutkitaan 315 geenistä koko koodaava alue sekä 28 geenistä


SoberIT Software Business and Engineering Institute T-121.110. Testaussuunnitelma paperiprototyyppi ja Kevät 2003 HELSINKI UNIVERSITY OF TECHNOLOGY

SoberIT Software Business and Engineering Institute T-121.110. Testaussuunnitelma paperiprototyyppi ja Kevät 2003 HELSINKI UNIVERSITY OF TECHNOLOGY T-121.110 Testaussuunnitelma paperiprototyyppi ja Kevät 2003 Yleistä Palautus viikolla 10 Vaiheessa palautetaan Prototyypin testaussuunnitelma Prototyypin navigaatiokartta Prototyyppi 1. Paperiprototyyppi


S-114.2720 Havaitseminen ja toiminta

S-114.2720 Havaitseminen ja toiminta S-114.2720 Havaitseminen ja toiminta Heikki Hyyti 60451P Harjoitustyö 2 visuaalinen prosessointi Treismanin FIT Kuva 1. Kuvassa on Treismanin kokeen ensimmäinen osio, jossa piti etsiä vihreätä T kirjainta.


Tilastotiede ottaa aivoon

Tilastotiede ottaa aivoon Tilastotiede ottaa aivoon kuinka aivoja voidaan mallintaa todennäköisyyslaskennalla, ja mitä yllättävää hyötyä siitä voi olla Aapo Hyvärinen Laskennallisen data-analyysin professori Matematiikan ja tilastotieteen


6 Mille kohderyhmille viestitään (Kuka tarvitsee tietoa, kuka on kiinnostunut tästä? Mieti alla olevat tahot kun valitset kohderyhmiä)

6 Mille kohderyhmille viestitään (Kuka tarvitsee tietoa, kuka on kiinnostunut tästä? Mieti alla olevat tahot kun valitset kohderyhmiä) 1 VIESTINTÄSUUNNITELMA HARJOITUS 1 Hankkeen nimi 2 Organisaatio 3 Yhteyshenkilö joka toteuttaa viestintää (kuka toteuttaa, kuka saa sanoa?) 4 Ydinviestit (Kirjoita 2 4 ytimekästä ja selkää lausetta siitä,


Mat 2.4177 Operaatiotutkimuksen projektityöseminaari

Mat 2.4177 Operaatiotutkimuksen projektityöseminaari Mat 2.4177 Operaatiotutkimuksen projektityöseminaari Kemira GrowHow: Paikallisen vaihtelun korjaaminen kasvatuskokeiden tuloksissa 21.2.2008 Ilkka Anttila Mikael Bruun Antti Ritala Olli Rusanen Timo Tervola





Tutkielman rakenne. Tellervo Korhonen. Tutki Hjelt-instituutti Kansanterveystieteen osasto Helsingin yliopisto

Tutkielman rakenne. Tellervo Korhonen. Tutki Hjelt-instituutti Kansanterveystieteen osasto Helsingin yliopisto Tutkielman rakenne Hjelt-instituutti Kansanterveystieteen osasto Helsingin yliopisto Tutki 2 30.10.2013 1 Periaatteet tieteellisessä tekstissä Tieteellä omat traditionsa Esitystavassa Rakenteessa Perusajatus



- MIKSI TUTKIMUSNÄYTTÖÖN PERUSTUVAA TIETOA? - MISTÄ ETSIÄ? THM M Mustajoki Sairaanhoitajan käsikirjan päätoimittaja - MIKSI TUTKIMUSNÄYTTÖÖN PERUSTUVAA TIETOA? - MISTÄ ETSIÄ? M Mustajoki 290506 1 Miksi? Kaikilla potilas(!) ja sairaanhoitaja - sama tieto Perustelut


Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina


Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow Genomi Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta Hannu Sariola, Irma Thesleff ja Marja Makarow Malliorganismeiksi kutsutaan lajeja, joita tutkijat käyttävät


PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


FIT Biotech Oy - Innovatiivisia lääkehoitoja. Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK

FIT Biotech Oy - Innovatiivisia lääkehoitoja. Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK FIT Biotech Oy - Innovatiivisia lääkehoitoja Tieteellinen johtaja Santeri Kiviluoto, Fil. tri, KTK Tärkeää tietoa Tämä esitys saattaa sisältää tulevaisuutta koskevia lausumia, arvioita ja laskelmia Yhtiöstä


DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja



ASPIRIININ MÄÄRÄN MITTAUS VALOKUVAAMALLA ASPIRIININ MÄÄRÄN MITTAUS VALOKUVAAMALLA Jaakko Lohenoja 2009 Johdanto Asetyylisalisyylihapon määrä voidaan mitata spektrofotometrisesti hydrolysoimalla asetyylisalisyylihappo salisyylihapoksi ja muodostamalla


Trichoderma reesein geenisäätelyverkoston ennustaminen Oskari Vinko

Trichoderma reesein geenisäätelyverkoston ennustaminen Oskari Vinko Trichoderma reesein geenisäätelyverkoston ennustaminen Oskari Vinko 04.11.2013 Ohjaaja: Merja Oja Valvoja: Harri Ehtamo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta


Round table -neuvottelu eduskunnassa

Round table -neuvottelu eduskunnassa 1 Round table -neuvottelu eduskunnassa 31.05.2005 STM:n visio biopankkilainsäädännöstä ja sen nykytila ministeriössä Apulaisosastopäällikkö Marja-Liisa Partanen, STM 2 Professori Juhani Eskola: Molekyylibiologiasta


Materiaalinäytteiden qpcr-tulosten tulkinnasta

Materiaalinäytteiden qpcr-tulosten tulkinnasta Materiaalinäytteiden qpcr-tulosten tulkinnasta Helena Rintala ja Teija Meklin Sisäilmastoseminaari 13.3.2014 Taustaa qpcr (kvantitatiivinen PCR) on nopea menetelmä mikrobien toteamiseen Käytetty paljon


Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten


Kynä-paperi -harjoitukset. Taina Lehtinen Taina I Lehtinen Helsingin yliopisto

Kynä-paperi -harjoitukset. Taina Lehtinen Taina I Lehtinen Helsingin yliopisto Kynä-paperi -harjoitukset Taina Lehtinen 43 Loput ratkaisut harjoitustehtäviin 44 Stressitestin = 40 s = 8 Kalle = 34 pistettä Ville = 5 pistettä Z Kalle 34 8 40 0.75 Z Ville 5 8 40 1.5 Kalle sijoittuu


BIOS 1 ja OPS 2016 OPS Biologian opetussuunnitelma Opetuksen tavoitteet

BIOS 1 ja OPS 2016 OPS Biologian opetussuunnitelma Opetuksen tavoitteet BIOS 1 ja OPS 2016 Biologian opetussuunnitelma 2016 Biologian opetuksen tehtävänä on tukea opiskelijan luonnontieteellisen ajattelun kehittymistä. Opetus lisää ymmärrystä biologian merkityksestä osana


"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein


Toimittaja Sovellusarkkitehtuuritason pilkkominen. Kalle Launiala, ProtonIT Oy

Toimittaja Sovellusarkkitehtuuritason pilkkominen. Kalle Launiala, ProtonIT Oy Toimittaja Sovellusarkkitehtuuritason pilkkominen Kalle Launiala, ProtonIT Oy kalle.launiala@protonit.net +358445575665 Sisällön rakenne Tekninen ratkaisu vs. Looginen ratkaisu Looginen ratkaisu ja sen


epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio:

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio: -mesenkyymi-vuorovaikutukset, esimerkkinä hammas ja ihokarva elimiä muodostuu kaikista alkiokerroksista, usein epiteelin ja mesenkyymin vuorovaikutuksesta epiteeli ektodermi kumpi aloittaa elimen kehityksen:


Tilastollisen analyysin perusteet Luento 11: Epäparametrinen vastine ANOVAlle

Tilastollisen analyysin perusteet Luento 11: Epäparametrinen vastine ANOVAlle Tilastollisen analyysin perusteet Luento 11: Epäparametrinen vastine ANOVAlle - Sisältö - - - Varianssianalyysi Varianssianalyysissä (ANOVA) testataan oletusta normaalijakautuneiden otosten odotusarvojen


Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa

Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa 1 Sisältö - Sisäympäristön laatu kouluissa - Tutkimuksen taustaa - Siivouksen arviointiin liittyvien


Basic Raster Styling and Analysis

Basic Raster Styling and Analysis Basic Raster Styling and Analysis QGIS Tutorials and Tips Author Ujaval Gandhi http://google.com/+ujavalgandhi Translations by Kari Salovaara This work is licensed under a Creative Commons Attribution


Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia





Hyvin suunniteltu on puoliksi tehty. Tutkimussuunnitelma. Miten se tehdään?

Hyvin suunniteltu on puoliksi tehty. Tutkimussuunnitelma. Miten se tehdään? Hyvin suunniteltu on puoliksi tehty Tutkimussuunnitelma Miten se tehdään? 2016 Tutkimussuunnitelma Tutkimussuunnitelma on käsikirjoitus, joka kuvaa tutkimuksen olennaisimmat asiat. Sitä seuraamalla tutkija


Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa


Kansainvälinen rahatalous Matti Estola. Termiinikurssit ja swapit valuuttariskien hallinnassa

Kansainvälinen rahatalous Matti Estola. Termiinikurssit ja swapit valuuttariskien hallinnassa Kansainvälinen rahatalous Matti Estola ermiinikurssit ja swapit valuuttariskien hallinnassa 1. Valuuttariskien suojauskeinot Rahoitusalan yritykset tekevät asiakkailleen valuuttojen välisiä termiinisopimuksia


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna Ihmisen keho muodostuu miljardeista soluista. Vaikka nämä solut ovat tietyssä mielessä meidän omiamme, ne polveutuvat itsenäisistä yksisoluisista elämänmuodoista, jotka ovat säilyttäneet monia itsenäisen


Lakeja yms. Tässä luennossa. Millaista tietoa? Tietoon perustuva suostumus siirretäänkö vastuu tutkittavalle?

Lakeja yms. Tässä luennossa. Millaista tietoa? Tietoon perustuva suostumus siirretäänkö vastuu tutkittavalle? Lakeja yms. Tietoon perustuva suostumus siirretäänkö vastuu tutkittavalle? Helena Kääriäinen TY/TYKS Laki lääketieteellisestä tutkimuksesta 488/1999 (2004) Potilaslaki 785/1992, henkilötietolaki 523/1999


Digitaalinen audio

Digitaalinen audio 8003203 Digitaalinen audio Luennot, kevät 2005 Tuomas Virtanen Tampereen teknillinen yliopisto Kurssin tavoite Johdanto 2 Tarjota tiedot audiosignaalinkäsittelyn perusteista perusoperaatiot, sekä niissä


HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan


MS-A0502 Todennäköisyyslaskennan ja tilastotieteen peruskurssi

MS-A0502 Todennäköisyyslaskennan ja tilastotieteen peruskurssi MS-A0502 Todennäköisyyslaskennan ja tilastotieteen peruskurssi 4A Parametrien estimointi Lasse Leskelä Matematiikan ja systeemianalyysin laitos Perustieteiden korkeakoulu Aalto-yliopisto Syksy 2016, periodi


MS-A0503 Todennäköisyyslaskennan ja tilastotieteen peruskurssi

MS-A0503 Todennäköisyyslaskennan ja tilastotieteen peruskurssi MS-A0503 Todennäköisyyslaskennan ja tilastotieteen peruskurssi 3B Tilastolliset datajoukot Lasse Leskelä Matematiikan ja systeemianalyysin laitos Perustieteiden korkeakoulu Aalto-yliopisto Lukuvuosi 2016


HMM ja geenien etsintä

HMM ja geenien etsintä Kuten makovin mallien yhteydessä, niin HMM halutulla topologialla voidaan opettaa tunnistamaan geenejä. Ohessa eäs geenitunnistukseen käytetty topologia, joka tunnistaa ihmisen geenit (5 -> 3 ). Edellä


Potilastietojärjestelmän kouluttajan osaaminen ja asiantuntijuus

Potilastietojärjestelmän kouluttajan osaaminen ja asiantuntijuus Potilastietojärjestelmän kouluttajan osaaminen ja asiantuntijuus Pro gradu -tutkielma TtM Jaana Luostarinen TtM Silja Ässämäki 11.05.2004 Tampere Luostarinen & Ässämäki 1 Miksi tämä aihe? Käyttöönottoprojekteissa



UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA LIITU-päivä 4.5.2006 FT Helena Rintala Kansanterveyslaitos, Ympäristöterveyden osasto Mihin sisäympäristön mikrobien mittauksia tarvitaan? Rakennusten


MS-A0503 Todennäköisyyslaskennan ja tilastotieteen peruskurssi

MS-A0503 Todennäköisyyslaskennan ja tilastotieteen peruskurssi MS-A0503 Todennäköisyyslaskennan ja tilastotieteen peruskurssi 3B Tilastolliset datajoukot Lasse Leskelä Matematiikan ja systeemianalyysin laitos Perustieteiden korkeakoulu Aalto-yliopisto Lukuvuosi 2016
