DNA (deoksiribonukleiinihappo)

Save this PDF as:

Koko: px
Aloita esitys sivulta:

Download "DNA (deoksiribonukleiinihappo)"


1 DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri (seuraava fosfaatti tulee kiinnittymään sokerin 3. hiileen) Nukleotidi Dna:n rakenneosa Koostuu sokeri, fosfaatti ja emäsosasta Emäsparisääntö: A T ja G C

2 Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän kuoli ennen Nobel palkinnon myöntämistä.

3 DNA:n kahdentuminen eli replikaatio Helikaasientsyymi katkaisee emäsparien väliset vetysidokset replikaatiokupla avautuu. Kahdentuminen etenee aloituskohdasta kumpaankin suuntaan molempien juosteiden toimiessa mallina. Dna polymeraasientsyymi rakentaa vapaista nukleotideista uusia juosteita vanhojen rinnalle. Juoste voi rakentua vain suunnassa 3 pää 5 pää: toinen juoste etenee pätkissä. Ligaasientsyymi liittää lopulta pätkät (ns. Okazakin fragmentit ) toisiinsa. Tehtävä Piirrä opettavainen kuva kahdentuvasta DNAsta. Johtavan juosteen (se jonka vastinjuoste rakentuu suoraan 3 pää edellä) emäsjärjestys on: AATTG ATCCA TACTT ACCGG AATTA

4 DNA ja geenit Ihmisen jokaisessa solussa on 2 x 98 cm = 196 cm DNAta tästä n. 187 cm on intronialueita, hölynpölyä. Loput 9 cm (eksonit) sisältää 2 x ihmisenrakennusohjeet eli geenit. Geenissä on säätelyalue ja RNA molekyyliksi kopioitava alue eli rakennegeeni. Säätelyalueet ohjaavat geenien toimintaa: Säätelyalueen alussa tehostajajaksoja, joita kiihdyttävät tai hillitsevät viestimolekyylit, transkriptiofaktorit. Promoottorialueeseen (yleensä n. 25 emästä ennen geeniä sijaitseva TATAboksi) kiinnittyy RNA polymeraasi. Esitumallisilla yksi säätelyalue säätelee useita rakennegeenejä = operoni. Transkriptio Proteiinisynteesin ensimmäinen vaihe kun solu tarvitsee kyseisen geenin koodaamaa valkuaisainetta. Transkriptiossa RNA polymeraasi rakentaa esi(aste)lähetti RNAn DNAn mallijuosteen rinnalle. Kun lähetti RNA on valmis, sen 5 päähän rakentuu guaniineista 5 hattu ja 3 päähän noin 250 adenosiinin häntä. Ennen esilähetti RNAn siirtymistä ribosomin pinnalle entsyymit silmukoivat siitä intronit ja muita syntyvään proteiiniin kuulumattomia osia.

5 Translaatio Translaatio alkaa, kun lähetti RNA kiinnittyy ribosomiin solulimassa. Siirtäjä RNAtkuljettavat aminohappoja ribosomille. Lähetti RNAn jokaista erilaista kodonia varten on oma siirtäjä RNA molekyylinsä. Aloituskolmikko aina ATG (metioniini) Mallijuoste TAC, lähetti rna AUG, siirtäjä rna UAC. Antikodoni eli siirtäjä RNAn tunnistuskolmikko pariutuu lähetti RNAssa emäsparisäännön mukaan. Lopetuskodonit ovat ATT, ATC ja ACT. Tehtävä 1. Yhdistä oikein Yhdistä kirjaimilla (a h) merkitty käsite tarkimmin sitä vastaavaan numerolla (I VIII) merkittyyn käsitteeseen. a) haploidi, b) diploidi, c) polyploidi, d) iturata, e) replikaatiohaarukka, f) silmukointi, g) antikodoni, h) perimä I) siirtäjärna, II) DNAn kahdentuminen, III) sukusolujen muodostama solulinja sukupolvesta toiseen, IV) ihmisen somaattinen solu, V) ihmisen sukusolu, VI) 5n, VII) yksilön kaikkidna, VIII) esiasterna

6 Tehtävän 1 vastaukset a) haploidi V) ihmisen sukusolu b) diploidi IV) ihmisen somaattinen solu c) polyploidi VI) 5n d) iturata III) sukusolujen muodostama solulinja sukupolvesta toiseen e) Replikaatiohaarukka II) dna:n kahdentuminen f) silmukointi VIII) esiasterna g) antikodoni I) siirtäjärna h) perimä VII) yksilön kaikki DNA Tehtävä 2. Termit Nimeä suomenkielinen termi tai selitys tieteellisellä tai vierasperäisellä termillä. a) Kahdentumaan kykenevä perimän koodin sisältävä molekyyli b) Perintötekijä c) Aitotumaisen geenin lähetti rna:ta koodaava dna jakso d) Geenin koodaavan alueen sisällä oleva dna jakso, joka ei koodaa lähettirnata e) Geenin säätelyalueen kohta, johon RNA polymeraasi kiinnittyy f) Esitumaisilla eliöillä peräkkäisten geenien muodostama toimintayksikkö, jolla on yksi säätelyalue.

7 a) DNA b) Geeni c) Eksoni d) Introni e) Promoottori f) Operoni Tehtävän 2. vastaukset Tehtävä 3. Proteiinisynteesin vaiheet Kirjoita proteiinisynteesin vaiheet oikeaan järjestykseen. Translaatio eli siirtäjä RNAt tuovat aminohapot ribosomille. Transkriptio eli esilähetti RNAn muodostuminen tumassa dnajuosteen mallin mukaisesti. Dna kaksoisjuoste avautuu. Lähetti RNA kypsyy. Lähetti RNA siirtyy ribosomille. Aminohapot kiinnittyvät toisiina peptidisidoksin. Rna polymeraasin kiinnittyminen promoottoriin.

8 Tehtävän 3. vastaukset 6. translaatio eli siirtäjä RNAt tuovat aminohapot ribosomille 3. transkriptio eli esi lähetti RNAn muodostuminen tumassa dnajuosteen mallin mukaisesti 2. DNA kaksoisjuoste avautuu 4. lähetti RNA kypsyy 5. lähetti RNA siirtyy ribosomille 8. aminohappoketjut laskostuvat kolmiulotteiseksi rakenteeksi 7. aminohapot kiinnittyvät toisiinsa peptidisidoksin 1.RNA polymeraasi kiinnittyy promoottoriin Tehtävä 4. Emäkset Erään geenin emäsjärjestys koodaavan juosteen DNA jakso emästen osalta alkaa seuraavasti: ATGATATTAACCGCCGAAAGCCGC a) Mikä on DNAn mallijuosteen emäsjärjestys? b) Mikä on lähetti RNAn emäsjärjestys? c) Mitkä ovat vastaavat siirtäjä RNA molekyylien emäskolmikot eli antikodonit? d) Mikä on muodostuvan polypeptidin aminohappojärjestys? e) Jos mallijuosteen neljäs emäs muuttuu pistemutaation seurauksena tymiiniksi, miten aminohappojärjestys muuttuu? f) Jos mallijuosteen neljäs emäs häviää pistemutaation seurauksena, miten aminohappojärjestys muuttuu? g) Minkälainen kahdentuma tai häviämä ei muuta lukukehystä?

9 Tehtävän 4. vastaukset a) TACTATAATTGGCGGCTTTCGGCG b) AUGAUAUUAACCGCCGAAAGCCGC c) UAC UAU AAU UGG CGG CUU UCG GCG d) metioniini, isoleusiini, leusiini, treoniini, alaniini, glutamiinihappo,seriini, arginiini e) Isoleusiinin paikalle tulisikin leusiini f) Kolmas emäskolmikko olisi tuolloin lopetuskolmikko ja synteesi päättyisi tähän. g) Kun aminohappo ei muutu pistemutaation seurauksena. Geenitoiminnan säätely Rakennegeenit Ohjaavat solun rakenneproteiinien ja entsyymien muodostumista. Reagoivat säätelygeenien tuottamiin säätelytekijöihin. Säätelygeenit Säätelevät muiden geenien toimintaa mm. transkriptiofaktoreiden avulla. Säätelevät geenien transkriptiota, lähetti RNAn muokkausta, kulkeutumista solulimaan, hajotusta sekä proteiinisynteesiä. Silmukointi: esiaste RNAn vaihtoehtoinen muokkaus yhdestä geenistä voidaan tuottaa kymmeniä erilaisia proteiineja.

10 Huomaa: pääosa evoluutiosta näyttää olevan seurausta säätelygeenien muutoksesta. Homologiset eli samansyntyiset elimet nisäkkäillä: olkaluu kyynärluu värttinäluu ranneluut kämmenluut sormiluut Esimerkiksi nisäkkäiden luut ovat kaikilla ± samoja (ei eroja rakennegeeneissä). Säätelygeenit säätävät luiden kasvuajan mutaa o säätelygeeniin luut kasvavat eri muotoisiksi. Mutaatiot = muutoksia perimässä - Aiheuttajina mutageenit (säteily, myrkyt) - Myös spontaanimutaatioita? 1. Geenimutaatiot (syntyy uusia alleeleja) - Yksittäinen emäs voi kadota tai vaihtua toiseksi. - DNAn kahdentumisessa korjaajaentsyymit korjaavat suurimman osan. - Meissä jokaisessa n pistemutaatioita päivässä. - Somaattisissa soluissa yleensä merkityksettömiä - Jos mutaatio solunjakaantumista säätelevissä geeneissä (ja korjausentsyymien geeneissä) syöpä).

11 Esim sirppisoluanemia: yksi emäs vaihtunut (T A) yksi aminohappo muodostuvassa valkuaisaineessa vaihtunut erilainen hemoglobiini sirppimäinen punasolu. 2. Kromosomimutaatiot - Pätkä kromosomia häviää, kahdentuu, kääntyy 180, siirtyy toiseen paikkaan, tai kaksi kromosomia yhdistyy. 3. Kromosomistomutaatiot - Väärä määrä kromosomeja. - Monosomiassa kromosomia 1 kpl, trisomiassa 3 kpl. - Autopolyploidiassa (ei eläimillä) kromosomistoja 3n, 4n, 5n jne. Usein ääriominaisuuksia. - Allopolyploidiassa kromomistot peräisin eri lajeilta jos parillinen n, yksilöt ovat lisääntymiskykyisiä.

Francis Crick ja James D. Watson

Francis Crick ja James D. Watson Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel-palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Perinnöllinen informaatio sijaitsee dna:ssa eli deoksiribonukleiinihapossa


II Genetiikka 4.(3) Nukleiinihapot

II Genetiikka 4.(3) Nukleiinihapot II Genetiikka 4.(3) Nukleiinihapot Geenitekniikka - menetelmiä, joiden avulla dna:ta ja rna:ta voidaan eristää, muokata ja siirtää muihin soluihin tai eliöihin kromosomit koostuvat dna-rihmasta ja siihen


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita. BI2 III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 9. Solut lisääntyvät jakautumalla 1. Avainsanat 2. Solut lisääntyvät jakautumalla 3. Dna eli deoksiribonukleiinihappo sisältää perimän


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja



SÄTEILYN TERVEYSVAIKUTUKSET SÄTEILYN TERVEYSVAIKUTUKSET 25 Säteily- ja ydinturvallisuus -kirjasarjan toimituskunta: Sisko Salomaa, Wendla Paile, Tarja K. Ikäheimonen, Roy Pöllänen, Anne Weltner, Olavi Pukkila, Jorma Sandberg, Heidi


LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä



Nimi sosiaaliturvatunnus

Nimi sosiaaliturvatunnus Valintakoe 2013 / Biokemia Nimi sosiaaliturvatunnus 1. Selitä: (3,0 p) a) Mitä ovat eksonit ja intronit ja miten ne eroavat toisistaan? b) Mitä eläinsolulle tapahtuu, jos se laitetaan sen sisällä olevaa





Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia

Genomi-ilmentyminen Genom expression (uttryckning) Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Genomi-ilmentyminen Genom expression (uttryckning) DNA RNA 7.12.2017 Nina Peitsaro, yliopistonlehtori, Medicum, Biokemia ja Kehitysbiologia Osaamistavoitteet Lärandemål Luennon jälkeen ymmärrät pääperiaatteet


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista


Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus


Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen



BIOLOGIAN OSIO (45 p.) BIOLÄÄKETIETEEN KOULUTUSOHJELMA PÄÄSYKOE 17.5.2017 BIOLOGIAN OSIO (45 p.) HYVÄN VASTAUKSEN PIIRTEET I) Esseetehtävät (2 kpl) a) Selitä perustellen, miten kuvaan merkittyihin kohtiin osuvat mutaatiot voivat


Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,


Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30 Tampereen yliopisto Bioteknologian tutkinto-ohjelma Valintakoe 21.5.2015 Henkilötunnus - Sukunimi Etunimet Tehtävä 3 Pisteet / 30 3. a) Alla on lyhyt jakso dsdna:ta, joka koodaa muutaman aminohappotähteen


Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi


DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia


a) dominoivaan: esiintyy joka sukupolvessa, sairaille vanhemmille voi syntyä terveitä lapsia

a) dominoivaan: esiintyy joka sukupolvessa, sairaille vanhemmille voi syntyä terveitä lapsia 1. Sukupuut Seuraavat ihmisen sukupuut edustavat periytymistä, jossa ominaisuuden määrää yksi alleeli. Päättele sukupuista A-F, mitä periytymistapaa kukin niistä voi edustaa. Vastaa taulukkoon kirjaimin


Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa


KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 BIOLÄÄKETIETEEN Henkilötunnus: - KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 Kirjoita selvästi nimesi ja muut henkilötietosi niille varattuun


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein


KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli


Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin



Genomin ylläpito TIINA IMMONEN MEDICUM BIOKEMIA JA KEHITYSBIOLOGIA Genomin ylläpito 5.12.2017 TIINA IMMONEN MEDICUM BIOKEMIA JA KEHITYSBIOLOGIA Luennon sisältö Tuman kromosomien rakenne ja pakkautuminen Pakkautumisen säätely: histonien modifikaatiot DNA:n kahdentuminen



NON-CODING RNA (ncrna) NON-CODING RNA (ncrna) 1. Yleistä NcRNA eli non-coding RNA tarkoittaa kaikkia proteiinia koodaamattomia rnamolekyylejä. Näistä yleisimmin tunnetut ovat ribosomaalinen RNA (rrna) sekä siirtäjä-rna (trna),


Anatomia ja fysiologia 1 Peruselintoiminnat

Anatomia ja fysiologia 1 Peruselintoiminnat Anatomia ja fysiologia 1 Peruselintoiminnat Solu Laura Partanen Yleistä Elimistö koostuu soluista ja soluväliaineesta Makroskooppinen mikroskooppinen Mm. liikkumiskyky, reagointi ärsykkeisiin, aineenvaihdunta


Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto.

Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto. Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto Juha.Klefstrom@helsinki.fi Nukleiinihapot! kertausta matkan varrella, vähemmän kuitenkin



465 E MOLEKYYLIBIOLOGIAA 465 E MOLEKYYLIBIOLOGIAA 466 E1 Geneettinen koodi elämän yhteinen kieli Latvala Juho & Seppälä Mika Solu-ja kehitysbiologian kurssin kirjoitelma Anatomian ja solubiologian laitos, Oulun yliopisto 12.9.2009


Biomolekyylit ja biomeerit

Biomolekyylit ja biomeerit Biomolekyylit ja biomeerit Polymeerit ovat hyvin suurikokoisia, pitkäketjuisia molekyylejä, jotka muodostuvat monomeereista joko polyadditio- tai polykondensaatioreaktiolla. Polymeerit Synteettiset polymeerit


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. Valitse listasta kunkin yhdisteen yleiskielessä käytettävä ei-systemaattinen nimi. (pisteet yht. 5p) a) C-vitamiini b) glukoosi c) etikkahappo d) salisyylihappo e) beta-karoteeni a. b. c. d. e. ksylitoli


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.



PROTEIINIEN RAKENTAMINEN PROTEIINIEN RAKENTAMINEN TAUSTAA Proteiinit ovat äärimmäisen tärkeitä kaikille elämänmuodoille. Kaikki solut tarvitsevat prote- iineja toimiakseen kunnolla. Osa proteiineista toimii entsyymeinä eli nopeuttaa


MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta)

MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta) Tehtävä Pisteet a) Mitkä ovat solussa DNA:n, mitkä RNA:n tehtäviä? Miksi mielestäsi DNA on valikoitunut kaikkien solullisten organismien perintöainekseksi? max 5 DNA: perinnöllisen tiedon säilyttäminen


Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.


Ribosomit 1. Ribosomit 2. Ribosomit 3

Ribosomit 1. Ribosomit 2. Ribosomit 3 Ribosomit 1 Palade & Siekevitz eristivät jaottelusentrifugaatiolla ns. mikrosomeja radioakt. aminohapot kertyivät mikrosomeihin, jotka peräisin rer:ää sisältävistä soluista proteiinisynteesi soluliman



DRAAMAN KÄYTTÖ PROTEIINISYNTEESIN OPETUKSESSA LUKIOSSA ANNA RÄSÄNEN DRAAMAN KÄYTTÖ PROTEIINISYNTEESIN OPETUKSESSA LUKIOSSA ANNA RÄSÄNEN Pro gradu -tutkielma Itä-Suomen yliopisto Luonnontieteiden ja metsätieteiden tiedekunta Ympäristö- ja biotieteiden laitos Biologia 2016


3 Eliökunnan luokittelu

3 Eliökunnan luokittelu 3 Eliökunnan luokittelu YO Biologian tehtävien vastausohjeista osa on luettelomaisia ja vain osa on laadittu siten, että ohjeen mukainen mallivastaus riittää täysiin pisteisiin esimerkiksi ylioppilaskokeessa.


Biopolymeerit. Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä.

Biopolymeerit. Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä. Biopolymeerit Biopolymeerit ovat kasveissa ja eläimissä esiintyviä polymeerejä. Tärkeimpiä biopolymeerejä ovat hiilihydraatit, proteiinit ja nukleiinihapot. 1 Hiilihydraatit Hiilihydraatit jaetaan mono


Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa

Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Susan Thorpe-Vargas Ph.D., John Cargill MA, MBA, MS, D. Caroline Coile, Ph.D. Käännös Inkeri Kangasvuo Koskaan ei ehkä


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does


DNA, RNA ja proteiinirakenteen ennustaminen

DNA, RNA ja proteiinirakenteen ennustaminen S-114.500 Solubiosysteemien perusteet Harjoitustyö Syksy 2003 DNA, RNA ja proteiinirakenteen ennustaminen Ilpo Tertsonen, 58152p Jaakko Niemi, 55114s Sisällysluettelo 1. Alkusanat... 3 2. Johdanto... 4


Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen

Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen Säteily ja solu - solun toiminta on monimutkaista ja tarkoin säädeltyä Riitta Mustonen Solun toiminta on tarkoin säädeltyä ja monimutkaista. Solu reagoi ulkoapäin tuleviin ärsykkeisiin - kuten säteilyaltistukseen


*2,3,4,5 *1,2,3,4,5. Helsingin yliopisto. hakukohde. Sukunimi. Tampereen yliopisto. Etunimet. Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30. Tehtävä 1.

*2,3,4,5 *1,2,3,4,5. Helsingin yliopisto. hakukohde. Sukunimi. Tampereen yliopisto. Etunimet. Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30. Tehtävä 1. Helsingin yliopisto Molekyylibiotieteiden hakukohde Tampereen yliopisto Bioteknologian hakukohde Henkilötunnus - Sukunimi (myös entinen) Etunimet Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30 Tehtävä 1.


Hyvä käyttäjä! Ystävällisin terveisin. Toimitus

Hyvä käyttäjä! Ystävällisin terveisin. Toimitus Hyvä käyttäjä! Tämä pdf-tiedosto on ladattu Tieteen Kuvalehden verkkosivuilta (www.tieteenkuvalehti.com). Tiedosto on tarkoitettu henkilökohtaiseen käyttöön, eikä sitä saa luovuttaa kolmannelle osapuolelle.


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Seoksen komponentit voidaan erotella toisistaan kromatografisilla menetelmillä. Mihin kromatografiset menetelmät perustuvat? (2p) Menetelmät perustuvat seoksen osasten erilaiseen sitoutumiseen paikallaan


Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,


DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen

DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen DNA-testit sukututkimuksessa 28.11.2017 Keravan kirjasto Paula Päivinen Solu tuma kromosomit 23 paria DNA Tumassa olevat kromosomit periytyvät jälkeläisille puoliksi isältä ja äidiltä Y-kromosomi periytyy





Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1 1) Tunnista molekyylit (1 piste) ja täytä seuraava taulukko (2 pistettä) a) b) c) d) a) Syklinen AMP (camp) (0.25) b) Beta-karoteeni (0.25 p) c) Sakkaroosi (0.25 p) d) -D-Glukopyranoosi (0.25 p) 2 Taulukko.


Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 2. Solun perusrakenne

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 2. Solun perusrakenne Solun perusrakenne I Solun perusrakenne 2. Solun perusrakenne 1. Avainsanat 2. Kaikille soluille yhteiset piirteet 3. Kasvisolun rakenne 4. Eläinsolun rakenne 5. Sienisolun rakenne 6. Bakteerisolun rakenne


9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun





III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 15. Populaatiogenetiikka ja evoluutio 1. Avainsanat 2. Evoluutio muuttaa geenipoolia 3. Mihin valinta kohdistuu? 4. Yksilön muuntelua


6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?


Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu



BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava


Ribosomit 1. Ribosomit 4. Ribosomit 2. Ribosomit 3. Proteiinisynteesin periaate 1

Ribosomit 1. Ribosomit 4. Ribosomit 2. Ribosomit 3. Proteiinisynteesin periaate 1 Ribosomit 1 Ribosomit 4 Palade & Siekevitz eristivät jaottelusentrifugaatiolla ns. mikrosomeja radioakt. aminohapot kertyivät mikrosomeihin, jotka peräisin rer:ää sisältävistä soluista proteiinisynteesi



EUROOPAN PARLAMENTTI EUROOPAN PARLAMENTTI 1999 2004 Ihmisgenetiikkaa ja nykylääketieteen muita uusia tekniikoita käsittelevä väliaikainen valiokunta VÄLIAIKAINEN 26. heinäkuuta 2001 Par2 KERTOMUSLUONNOS Ihmisgenetiikan sosiaaliset,


Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan?

Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Antipodidiversiteetin generointi Robert Koch (TB) 1905 Niels K. Jerne


Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus:

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta. Hakijan nimi: Henkilötunnus: Esseekysymyksistä 1 ja 2 voi saada enintään 5 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 4 pistettä. Lisäksi vastaaja saa enintään yhden pisteen, mikäli





Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 3. Solujen kemiallinen rakenne

Solun perusrakenne I Solun perusrakenne. BI2 I Solun perusrakenne 3. Solujen kemiallinen rakenne Solun perusrakenne I Solun perusrakenne 3. Solujen kemiallinen rakenne 1. Avainsanat 2. Solut koostuvat molekyyleistä 3. Hiilihydraatit 4. Lipidit eli rasva-aineet 5. Valkuaisaineet eli proteiinit rakentuvat


KEMIA 25.3.2011 lyhennettyjä ratkaisuja. 1. a) Vesiliukoisia: B, C, D, F, G

KEMIA 25.3.2011 lyhennettyjä ratkaisuja. 1. a) Vesiliukoisia: B, C, D, F, G KEMIA 25.3.2011 lyhennettyjä ratkaisuja 1. a) Vesiliukoisia: B,, D, F, G b) Ioniyhdisteitä: B,, F c) Happamia: d) Hiilitabletti on erittäin hienojakoista hiiltä (aktiivihiiltä). Suuren pinta alansa johdosta



BIOLOGIAN KOE 14.9.2015 HYVÄN VASTAUKSEN PIIRTEITÄ BIOLOGIAN KOE 14.9.2015 HYVÄN VASTAUKSEN PIIRTEITÄ Alla oleva vastausten piirteiden, sisältöjen ja pisteitysten luonnehdinta ei sido ylioppilastutkintolautakunnan arvostelua. Lopullisessa arvostelussa


Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta

Helsingin yliopisto Valintakoe Maatalous-metsätieteellinen tiedekunta KOE 8 Ravitsemustiede Sekä A- että B-osasta tulee saada vähintään 7 pistettä. Mikäli A-osan pistemäärä on vähemmän kuin 7 pistettä, B-osa jätetään arvostelematta. Lisäksi A-osasta on saatava yhteensä vähintään











e-oppi Oy. Materiaalin käyttö sallittua vain osana e-opin oppimateriaalia ja maksettua käyttölisenssiä.

e-oppi Oy. Materiaalin käyttö sallittua vain osana e-opin oppimateriaalia ja maksettua käyttölisenssiä. LUKU1 makromolekyyli, macromolecule Suurikokoinen molekyyli, joka on usein polymeeri. Makromolekyylejä ovat proteiinit, dna ja polysakkaridit kuten selluloosa. solukalvo, cell membrane Solukalvo rajoittaa


Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä

Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit ovat, miten ne toimivat ja miten ne tuottavat meille tuttuja elämänilmiöitä Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen. Mendelistinen g. on sen synonyymi Toisessa osassa ryhdymme


Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma Evoluutio BI Elämä ja evoluutio Leena Kangas-Järviluoma 1 Evoluutio lajinkehitystä, jossa eliölajit muuttuvat ja niistä voi kehittyä uusia lajeja on jatkunut elämän synnystä saakka, sillä ei ole päämäärää


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut Hemopoiesis Tuma Mitochondrion Tuma 2 Flagellum Peroxisome Centrioles Microfilaments Microtubules Nuclear envelope Rough endoplasmic reticulum Ribosomes NUCLEUS muoto: pallomainen liuskoittunut (esim.


Kuinka geenin emäsjärjestys muunnetaan proteiinin avaruusrakenteeksi ribosomaalisen proteiinisynteesin vaiheet

Kuinka geenin emäsjärjestys muunnetaan proteiinin avaruusrakenteeksi ribosomaalisen proteiinisynteesin vaiheet Kuinka geenin emäsjärjestys muunnetaan proteiinin avaruusrakenteeksi ribosomaalisen proteiinisynteesin vaiheet Yliopistonlehtori Tuomas Haltia Biotieteiden laitos Helsingin yliopisto Johdanto Ihmisellä


SÄTEILY JA SOLU. Riitta Mustonen ja Aki Salo

SÄTEILY JA SOLU. Riitta Mustonen ja Aki Salo 2 SÄTEILY JA SOLU Riitta Mustonen ja Aki Salo SISÄLLYSLUETTELO 2.1 Solun toiminta on tarkoin säädeltyä... 28 2.2 Säteilyn fysikaaliset vuorovaikutukset solussa... 28 2.3 Ionisoiva säteily vaurioittaa DNA:ta...


Duchennen lihasdystrofian ja spinaalisen lihasatrofian hoidon uusia näkymiä. Jaana Lähdetie TYKS lastenneurologia

Duchennen lihasdystrofian ja spinaalisen lihasatrofian hoidon uusia näkymiä. Jaana Lähdetie TYKS lastenneurologia Duchennen lihasdystrofian ja spinaalisen lihasatrofian hoidon uusia näkymiä Jaana Lähdetie TYKS lastenneurologia Neuromuskulaaritaudit Lihasvoiman heikkenemisen seuraukset Kävelykyvyn heikkeneminen ja


Mustaruoste uhkaa romahduttaa maailman vehnäsadot jälleen

Mustaruoste uhkaa romahduttaa maailman vehnäsadot jälleen Mustaruoste uhkaa romahduttaa maailman vehnäsadot jälleen Ruosteenkestävät ja lyhytkortiset vehnälajikkeet...toivat "vihreän kumouksen" vehnän viljelyyn 60-luvulla: Peltonen-Sainio P. Vihreä vallankumous,



BIOLOGIAN KOE 30.3.2016 HYVÄN VASTAUKSEN PIIRTEITÄ BIOLOGIAN KOE 30.3.2016 HYVÄN VASTAUKSEN PIIRTEITÄ Alla oleva vastausten piirteiden, sisältöjen ja pisteitysten luonnehdinta ei sido ylioppilastutkintolautakunnan arvostelua. Lopullisessa arvostelussa


Solun tuman rakenne ja toiminta. Pertti Panula Biolääketieteen laitos 2012

Solun tuman rakenne ja toiminta. Pertti Panula Biolääketieteen laitos 2012 Solun tuman rakenne ja toiminta Pertti Panula Biolääketieteen laitos 2012 Hermosolun rakkulamainen tuma Monenlaisia tumia Valkosolujen tumien monimuotoisuutta Lähde: J.F.Kerr, Atlas of Functional Histology


b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina.

b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina. Bi5 kertaustehtäviä, mallivastauksia 1. Selosta lyhyesti, missä sijaitsevat seuraavat solun osat: a) tumajyvänen b) keskusjyvänen (sentrioli, sentrosomi), c) soluneste, d) mitokondrio, e) solulimakalvosto


1p - Yksi puuttuu tai väärin, -1/3 p b) Ioniyhdisteitä: B, C, F

1p - Yksi puuttuu tai väärin, -1/3 p b) Ioniyhdisteitä: B, C, F MAL:n pistesuositus kemian reaalikokeen tehtäviin keväällä 2011. - Tehtävän eri osat arvostellaan 1/3 pisteen tarkkuudella ja loppusumma pyöristetään kokonaisiksi pisteiksi. Tehtävän sisällä pieniä puutteita


Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset)

Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset) Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset) Hajottajia (lahottajat ja mädättäjät), patogeeneja (taudinaiheuttajia), tuottajia (yhteyttävät),


2. Elämän kemiallinen koostumus, rakenne ja toiminta

2. Elämän kemiallinen koostumus, rakenne ja toiminta 2. Elämän kemiallinen koostumus, rakenne ja toiminta 2.1. Tuntemamme elämän rakenne-komponentit Tarvitaan: informatiiviset polymeerit: nukleiinihappojuosteet DNA ja RNA (nukleotidit): sisältävät hiiltä,


Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi
