DNA (deoksiribonukleiinihappo)

Koko: px
Aloita esitys sivulta:

Download "DNA (deoksiribonukleiinihappo)"

Transkriptio

1 DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri (seuraava fosfaatti tulee kiinnittymään sokerin 3. hiileen) Nukleotidi Dna:n rakenneosa Koostuu sokeri, fosfaatti ja emäsosasta Emäsparisääntö: A T ja G C

2 Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän kuoli ennen Nobel palkinnon myöntämistä.

3 DNA:n kahdentuminen eli replikaatio Helikaasientsyymi katkaisee emäsparien väliset vetysidokset replikaatiokupla avautuu. Kahdentuminen etenee aloituskohdasta kumpaankin suuntaan molempien juosteiden toimiessa mallina. Dna polymeraasientsyymi rakentaa vapaista nukleotideista uusia juosteita vanhojen rinnalle. Juoste voi rakentua vain suunnassa 3 pää 5 pää: toinen juoste etenee pätkissä. Ligaasientsyymi liittää lopulta pätkät (ns. Okazakin fragmentit ) toisiinsa. Tehtävä Piirrä opettavainen kuva kahdentuvasta DNAsta. Johtavan juosteen (se jonka vastinjuoste rakentuu suoraan 3 pää edellä) emäsjärjestys on: AATTG ATCCA TACTT ACCGG AATTA

4 DNA ja geenit Ihmisen jokaisessa solussa on 2 x 98 cm = 196 cm DNAta tästä n. 187 cm on intronialueita, hölynpölyä. Loput 9 cm (eksonit) sisältää 2 x ihmisenrakennusohjeet eli geenit. Geenissä on säätelyalue ja RNA molekyyliksi kopioitava alue eli rakennegeeni. Säätelyalueet ohjaavat geenien toimintaa: Säätelyalueen alussa tehostajajaksoja, joita kiihdyttävät tai hillitsevät viestimolekyylit, transkriptiofaktorit. Promoottorialueeseen (yleensä n. 25 emästä ennen geeniä sijaitseva TATAboksi) kiinnittyy RNA polymeraasi. Esitumallisilla yksi säätelyalue säätelee useita rakennegeenejä = operoni. Transkriptio Proteiinisynteesin ensimmäinen vaihe kun solu tarvitsee kyseisen geenin koodaamaa valkuaisainetta. Transkriptiossa RNA polymeraasi rakentaa esi(aste)lähetti RNAn DNAn mallijuosteen rinnalle. Kun lähetti RNA on valmis, sen 5 päähän rakentuu guaniineista 5 hattu ja 3 päähän noin 250 adenosiinin häntä. Ennen esilähetti RNAn siirtymistä ribosomin pinnalle entsyymit silmukoivat siitä intronit ja muita syntyvään proteiiniin kuulumattomia osia.

5 Translaatio Translaatio alkaa, kun lähetti RNA kiinnittyy ribosomiin solulimassa. Siirtäjä RNAtkuljettavat aminohappoja ribosomille. Lähetti RNAn jokaista erilaista kodonia varten on oma siirtäjä RNA molekyylinsä. Aloituskolmikko aina ATG (metioniini) Mallijuoste TAC, lähetti rna AUG, siirtäjä rna UAC. Antikodoni eli siirtäjä RNAn tunnistuskolmikko pariutuu lähetti RNAssa emäsparisäännön mukaan. Lopetuskodonit ovat ATT, ATC ja ACT. Tehtävä 1. Yhdistä oikein Yhdistä kirjaimilla (a h) merkitty käsite tarkimmin sitä vastaavaan numerolla (I VIII) merkittyyn käsitteeseen. a) haploidi, b) diploidi, c) polyploidi, d) iturata, e) replikaatiohaarukka, f) silmukointi, g) antikodoni, h) perimä I) siirtäjärna, II) DNAn kahdentuminen, III) sukusolujen muodostama solulinja sukupolvesta toiseen, IV) ihmisen somaattinen solu, V) ihmisen sukusolu, VI) 5n, VII) yksilön kaikkidna, VIII) esiasterna

6 Tehtävän 1 vastaukset a) haploidi V) ihmisen sukusolu b) diploidi IV) ihmisen somaattinen solu c) polyploidi VI) 5n d) iturata III) sukusolujen muodostama solulinja sukupolvesta toiseen e) Replikaatiohaarukka II) dna:n kahdentuminen f) silmukointi VIII) esiasterna g) antikodoni I) siirtäjärna h) perimä VII) yksilön kaikki DNA Tehtävä 2. Termit Nimeä suomenkielinen termi tai selitys tieteellisellä tai vierasperäisellä termillä. a) Kahdentumaan kykenevä perimän koodin sisältävä molekyyli b) Perintötekijä c) Aitotumaisen geenin lähetti rna:ta koodaava dna jakso d) Geenin koodaavan alueen sisällä oleva dna jakso, joka ei koodaa lähettirnata e) Geenin säätelyalueen kohta, johon RNA polymeraasi kiinnittyy f) Esitumaisilla eliöillä peräkkäisten geenien muodostama toimintayksikkö, jolla on yksi säätelyalue.

7 a) DNA b) Geeni c) Eksoni d) Introni e) Promoottori f) Operoni Tehtävän 2. vastaukset Tehtävä 3. Proteiinisynteesin vaiheet Kirjoita proteiinisynteesin vaiheet oikeaan järjestykseen. Translaatio eli siirtäjä RNAt tuovat aminohapot ribosomille. Transkriptio eli esilähetti RNAn muodostuminen tumassa dnajuosteen mallin mukaisesti. Dna kaksoisjuoste avautuu. Lähetti RNA kypsyy. Lähetti RNA siirtyy ribosomille. Aminohapot kiinnittyvät toisiina peptidisidoksin. Rna polymeraasin kiinnittyminen promoottoriin.

8 Tehtävän 3. vastaukset 6. translaatio eli siirtäjä RNAt tuovat aminohapot ribosomille 3. transkriptio eli esi lähetti RNAn muodostuminen tumassa dnajuosteen mallin mukaisesti 2. DNA kaksoisjuoste avautuu 4. lähetti RNA kypsyy 5. lähetti RNA siirtyy ribosomille 8. aminohappoketjut laskostuvat kolmiulotteiseksi rakenteeksi 7. aminohapot kiinnittyvät toisiinsa peptidisidoksin 1.RNA polymeraasi kiinnittyy promoottoriin Tehtävä 4. Emäkset Erään geenin emäsjärjestys koodaavan juosteen DNA jakso emästen osalta alkaa seuraavasti: ATGATATTAACCGCCGAAAGCCGC a) Mikä on DNAn mallijuosteen emäsjärjestys? b) Mikä on lähetti RNAn emäsjärjestys? c) Mitkä ovat vastaavat siirtäjä RNA molekyylien emäskolmikot eli antikodonit? d) Mikä on muodostuvan polypeptidin aminohappojärjestys? e) Jos mallijuosteen neljäs emäs muuttuu pistemutaation seurauksena tymiiniksi, miten aminohappojärjestys muuttuu? f) Jos mallijuosteen neljäs emäs häviää pistemutaation seurauksena, miten aminohappojärjestys muuttuu? g) Minkälainen kahdentuma tai häviämä ei muuta lukukehystä?

9 Tehtävän 4. vastaukset a) TACTATAATTGGCGGCTTTCGGCG b) AUGAUAUUAACCGCCGAAAGCCGC c) UAC UAU AAU UGG CGG CUU UCG GCG d) metioniini, isoleusiini, leusiini, treoniini, alaniini, glutamiinihappo,seriini, arginiini e) Isoleusiinin paikalle tulisikin leusiini f) Kolmas emäskolmikko olisi tuolloin lopetuskolmikko ja synteesi päättyisi tähän. g) Kun aminohappo ei muutu pistemutaation seurauksena. Geenitoiminnan säätely Rakennegeenit Ohjaavat solun rakenneproteiinien ja entsyymien muodostumista. Reagoivat säätelygeenien tuottamiin säätelytekijöihin. Säätelygeenit Säätelevät muiden geenien toimintaa mm. transkriptiofaktoreiden avulla. Säätelevät geenien transkriptiota, lähetti RNAn muokkausta, kulkeutumista solulimaan, hajotusta sekä proteiinisynteesiä. Silmukointi: esiaste RNAn vaihtoehtoinen muokkaus yhdestä geenistä voidaan tuottaa kymmeniä erilaisia proteiineja.

10 Huomaa: pääosa evoluutiosta näyttää olevan seurausta säätelygeenien muutoksesta. Homologiset eli samansyntyiset elimet nisäkkäillä: olkaluu kyynärluu värttinäluu ranneluut kämmenluut sormiluut Esimerkiksi nisäkkäiden luut ovat kaikilla ± samoja (ei eroja rakennegeeneissä). Säätelygeenit säätävät luiden kasvuajan mutaa o säätelygeeniin luut kasvavat eri muotoisiksi. Mutaatiot = muutoksia perimässä - Aiheuttajina mutageenit (säteily, myrkyt) - Myös spontaanimutaatioita? 1. Geenimutaatiot (syntyy uusia alleeleja) - Yksittäinen emäs voi kadota tai vaihtua toiseksi. - DNAn kahdentumisessa korjaajaentsyymit korjaavat suurimman osan. - Meissä jokaisessa n pistemutaatioita päivässä. - Somaattisissa soluissa yleensä merkityksettömiä - Jos mutaatio solunjakaantumista säätelevissä geeneissä (ja korjausentsyymien geeneissä) syöpä).

11 Esim sirppisoluanemia: yksi emäs vaihtunut (T A) yksi aminohappo muodostuvassa valkuaisaineessa vaihtunut erilainen hemoglobiini sirppimäinen punasolu. 2. Kromosomimutaatiot - Pätkä kromosomia häviää, kahdentuu, kääntyy 180, siirtyy toiseen paikkaan, tai kaksi kromosomia yhdistyy. 3. Kromosomistomutaatiot - Väärä määrä kromosomeja. - Monosomiassa kromosomia 1 kpl, trisomiassa 3 kpl. - Autopolyploidiassa (ei eläimillä) kromosomistoja 3n, 4n, 5n jne. Usein ääriominaisuuksia. - Allopolyploidiassa kromomistot peräisin eri lajeilta jos parillinen n, yksilöt ovat lisääntymiskykyisiä.

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien

Lisätiedot

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

SÄTEILYN TERVEYSVAIKUTUKSET

SÄTEILYN TERVEYSVAIKUTUKSET SÄTEILYN TERVEYSVAIKUTUKSET 25 Säteily- ja ydinturvallisuus -kirjasarjan toimituskunta: Sisko Salomaa, Wendla Paile, Tarja K. Ikäheimonen, Roy Pöllänen, Anne Weltner, Olavi Pukkila, Jorma Sandberg, Heidi

Lisätiedot

Nimi sosiaaliturvatunnus

Nimi sosiaaliturvatunnus Valintakoe 2013 / Biokemia Nimi sosiaaliturvatunnus 1. Selitä: (3,0 p) a) Mitä ovat eksonit ja intronit ja miten ne eroavat toisistaan? b) Mitä eläinsolulle tapahtuu, jos se laitetaan sen sisällä olevaa

Lisätiedot

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa

Lisätiedot

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 BIOLÄÄKETIETEEN Henkilötunnus: - KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 Kirjoita selvästi nimesi ja muut henkilötietosi niille varattuun

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

NON-CODING RNA (ncrna)

NON-CODING RNA (ncrna) NON-CODING RNA (ncrna) 1. Yleistä NcRNA eli non-coding RNA tarkoittaa kaikkia proteiinia koodaamattomia rnamolekyylejä. Näistä yleisimmin tunnetut ovat ribosomaalinen RNA (rrna) sekä siirtäjä-rna (trna),

Lisätiedot

465 E MOLEKYYLIBIOLOGIAA

465 E MOLEKYYLIBIOLOGIAA 465 E MOLEKYYLIBIOLOGIAA 466 E1 Geneettinen koodi elämän yhteinen kieli Latvala Juho & Seppälä Mika Solu-ja kehitysbiologian kurssin kirjoitelma Anatomian ja solubiologian laitos, Oulun yliopisto 12.9.2009

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. Valitse listasta kunkin yhdisteen yleiskielessä käytettävä ei-systemaattinen nimi. (pisteet yht. 5p) a) C-vitamiini b) glukoosi c) etikkahappo d) salisyylihappo e) beta-karoteeni a. b. c. d. e. ksylitoli

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.

Lisätiedot

Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa

Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Susan Thorpe-Vargas Ph.D., John Cargill MA, MBA, MS, D. Caroline Coile, Ph.D. Käännös Inkeri Kangasvuo Koskaan ei ehkä

Lisätiedot

DNA, RNA ja proteiinirakenteen ennustaminen

DNA, RNA ja proteiinirakenteen ennustaminen S-114.500 Solubiosysteemien perusteet Harjoitustyö Syksy 2003 DNA, RNA ja proteiinirakenteen ennustaminen Ilpo Tertsonen, 58152p Jaakko Niemi, 55114s Sisällysluettelo 1. Alkusanat... 3 2. Johdanto... 4

Lisätiedot

*2,3,4,5 *1,2,3,4,5. Helsingin yliopisto. hakukohde. Sukunimi. Tampereen yliopisto. Etunimet. Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30. Tehtävä 1.

*2,3,4,5 *1,2,3,4,5. Helsingin yliopisto. hakukohde. Sukunimi. Tampereen yliopisto. Etunimet. Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30. Tehtävä 1. Helsingin yliopisto Molekyylibiotieteiden hakukohde Tampereen yliopisto Bioteknologian hakukohde Henkilötunnus - Sukunimi (myös entinen) Etunimet Valintakoe 21.05.2012 Tehtävä 1 Pisteet / 30 Tehtävä 1.

Lisätiedot

Tuija Solismaa IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS

Tuija Solismaa IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS Tuija Solismaa IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS RAPORTIN NIMIÖSIVU IHMISEN RECQL4-PROTEIININ 450 ENSIMMÄISTÄ AMINOHAPPOA KOODITTAVAN DNA-JAKSON KLOONAUS

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Seoksen komponentit voidaan erotella toisistaan kromatografisilla menetelmillä. Mihin kromatografiset menetelmät perustuvat? (2p) Menetelmät perustuvat seoksen osasten erilaiseen sitoutumiseen paikallaan

Lisätiedot

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,

Lisätiedot

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu

Lisätiedot

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun

Lisätiedot

LAKTOOSI-INTOLERANSSIN MÄÄRITTÄMINEN RT-PCR- MENETELMÄLLÄ

LAKTOOSI-INTOLERANSSIN MÄÄRITTÄMINEN RT-PCR- MENETELMÄLLÄ OPINNÄYTETYÖ - AMMATTIKORKEAKOULUTUTKINTO SOSIAALI-, TERVEYS- JA LIIKUNTA-ALA LAKTOOSI-INTOLERANSSIN MÄÄRITTÄMINEN RT-PCR- MENETELMÄLLÄ Työohjeiden laatiminen bioanalyytikko-opiskelijoille T EKI- JÄT:

Lisätiedot

JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN

JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN JUOSTEISUUDEN SÄILYTTÄVIEN RNA-NÄYTTEENVALMISTUSMENETEL- MIEN VERTAILU UUDEN SUKUPOLVEN SEKVENSOINTIA VARTEN Anne Vaittinen Maisterintutkielma Helsingin yliopisto Maataloustieteiden laitos HEBIOT Biotekniikka

Lisätiedot

EUROOPAN PARLAMENTTI

EUROOPAN PARLAMENTTI EUROOPAN PARLAMENTTI 1999 2004 Ihmisgenetiikkaa ja nykylääketieteen muita uusia tekniikoita käsittelevä väliaikainen valiokunta VÄLIAIKAINEN 26. heinäkuuta 2001 Par2 KERTOMUSLUONNOS Ihmisgenetiikan sosiaaliset,

Lisätiedot

Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1 1) Tunnista molekyylit (1 piste) ja täytä seuraava taulukko (2 pistettä) a) b) c) d) a) Syklinen AMP (camp) (0.25) b) Beta-karoteeni (0.25 p) c) Sakkaroosi (0.25 p) d) -D-Glukopyranoosi (0.25 p) 2 Taulukko.

Lisätiedot

KEMIA 25.3.2011 lyhennettyjä ratkaisuja. 1. a) Vesiliukoisia: B, C, D, F, G

KEMIA 25.3.2011 lyhennettyjä ratkaisuja. 1. a) Vesiliukoisia: B, C, D, F, G KEMIA 25.3.2011 lyhennettyjä ratkaisuja 1. a) Vesiliukoisia: B,, D, F, G b) Ioniyhdisteitä: B,, F c) Happamia: d) Hiilitabletti on erittäin hienojakoista hiiltä (aktiivihiiltä). Suuren pinta alansa johdosta

Lisätiedot

V GEENITEORIA, NUKLEIINIHAPPOTUTKIMUS, GENEETTINEN KOODI

V GEENITEORIA, NUKLEIINIHAPPOTUTKIMUS, GENEETTINEN KOODI Veikko Sorsa: PERINNÖLLISYYSTIETEEN HISTORIAA V 1 V GEENITEORIA, NUKLEIINIHAPPOTUTKIMUS, GENEETTINEN KOODI A Nukleiini, kromatiini, perinnöllisyys, proteiinigeeniteoria Jo 1880-luvulla syntyi hypoteesi,

Lisätiedot

BIOLOGIAN KOE 14.9.2015 HYVÄN VASTAUKSEN PIIRTEITÄ

BIOLOGIAN KOE 14.9.2015 HYVÄN VASTAUKSEN PIIRTEITÄ BIOLOGIAN KOE 14.9.2015 HYVÄN VASTAUKSEN PIIRTEITÄ Alla oleva vastausten piirteiden, sisältöjen ja pisteitysten luonnehdinta ei sido ylioppilastutkintolautakunnan arvostelua. Lopullisessa arvostelussa

Lisätiedot

e-oppi Oy. Materiaalin käyttö sallittua vain osana e-opin oppimateriaalia ja maksettua käyttölisenssiä.

e-oppi Oy. Materiaalin käyttö sallittua vain osana e-opin oppimateriaalia ja maksettua käyttölisenssiä. LUKU1 makromolekyyli, macromolecule Suurikokoinen molekyyli, joka on usein polymeeri. Makromolekyylejä ovat proteiinit, dna ja polysakkaridit kuten selluloosa. solukalvo, cell membrane Solukalvo rajoittaa

Lisätiedot

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut

Tuma. Tuma 2. Tuma 3. Tuma 1. Hemopoiesis. solun kasvaessa tuma kasvaa DNA:n moninkertaistuminen jättisolut Hemopoiesis Tuma Mitochondrion Tuma 2 Flagellum Peroxisome Centrioles Microfilaments Microtubules Nuclear envelope Rough endoplasmic reticulum Ribosomes NUCLEUS muoto: pallomainen liuskoittunut (esim.

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

BIOLOGIAN KOE 30.3.2016 HYVÄN VASTAUKSEN PIIRTEITÄ

BIOLOGIAN KOE 30.3.2016 HYVÄN VASTAUKSEN PIIRTEITÄ BIOLOGIAN KOE 30.3.2016 HYVÄN VASTAUKSEN PIIRTEITÄ Alla oleva vastausten piirteiden, sisältöjen ja pisteitysten luonnehdinta ei sido ylioppilastutkintolautakunnan arvostelua. Lopullisessa arvostelussa

Lisätiedot

2. Elämän kemiallinen koostumus, rakenne ja toiminta

2. Elämän kemiallinen koostumus, rakenne ja toiminta 2. Elämän kemiallinen koostumus, rakenne ja toiminta 2.1. Tuntemamme elämän rakenne-komponentit Tarvitaan: informatiiviset polymeerit: nukleiinihappojuosteet DNA ja RNA (nukleotidit): sisältävät hiiltä,

Lisätiedot

Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi

Lisätiedot

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio

Säteilyvaikutuksen synty. Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyvaikutuksen synty Erikoistuvien lääkärien päivät 25 26.1.2013 Kuopio Säteilyn ja biologisen materian vuorovaikutus Koska ihmisestä 70% on vettä, todennäköisin (ja tärkein) säteilyn ja biologisen

Lisätiedot

DNA testit sukututkimuksessa

DNA testit sukututkimuksessa DNA testit sukututkimuksessa Pakkasten sukuseura ry:n 20 v juhlakokous 19.9.2015 Jyväskylä Raimo Pakkanen, sukuneuvoston pj A,T,G,C. Ihmisen genetiikan lyhyt oppimäärä mtdna diploidinen kromosomisto =

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa

Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa Kati Rajanen & Mira Tyni Molekyyligenetiikan koulutuskartoitus Etelä- Suomessa Metropolia Ammattikorkeakoulu Bioanalyytikko Bioanalytiikan koulutusohjelma Opinnäytetyö 6.4.03 Tiivistelmä Tekijä(t) Otsikko

Lisätiedot

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow Genomi Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta Hannu Sariola, Irma Thesleff ja Marja Makarow Malliorganismeiksi kutsutaan lajeja, joita tutkijat käyttävät

Lisätiedot

Julkaistu Helsingissä 24 päivänä helmikuuta 2014. 141/2014 Maa- ja metsätalousministeriön asetus

Julkaistu Helsingissä 24 päivänä helmikuuta 2014. 141/2014 Maa- ja metsätalousministeriön asetus SUOMEN SÄÄDÖSKOKOELMA Julkaistu Helsingissä 24 päivänä helmikuuta 2014 141/2014 Maa- ja metsätalousministeriön asetus äidinmaidonkorvikkeesta ja vieroitusvalmisteesta annetun kauppa- ja teollisuusministeriön

Lisätiedot

Laskentaa DNA- ja RNA-molekyyleillä. Olli Niemitalo, 7.12.2011

Laskentaa DNA- ja RNA-molekyyleillä. Olli Niemitalo, 7.12.2011 Laskentaa DNA- ja RNA-molekyyleillä Olli Niemitalo, 7.12.2011 1 Sisällys 1 Johdanto... 2 1.1 DNA ja RNA... 2 1.2 Boolen algebra... 3 1.3 Binääriluvut... 4 1.4 Turingin kone... 4 1.5 Tilakone... 5 1.6 Laskettavuusteoria...

Lisätiedot

TESTITULOSTEN YHTEENVETO

TESTITULOSTEN YHTEENVETO TESTITULOSTEN YHTEENVETO LIHASTEN VÄSYMINEN JA PALAUTUMINEN Lihaksesi eivät väsy niin helposti ja ne palautuvat nopeammin. Kehitettävä Hyvä AEROBINEN KUNTO Sinulla on edellytyksiä kasvattaa aerobista kuntoa

Lisätiedot

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien

Lisätiedot

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa

Lisätiedot

SÄTEILYN GENEETTISET VAIKUTUKSET

SÄTEILYN GENEETTISET VAIKUTUKSET 8 SÄTEILYN GENEETTISET VAIKUTUKSET Sisko Salomaa SISÄLLYSLUETTELO 8.1 Ihmisen perinnölliset sairaudet... 122 8.2 Perinnöllisten sairauksien taustailmaantuvuus... 125 8.3 Perinnöllisen riskin arviointi...

Lisätiedot

Huhtikuun 14. päivänä tänä vuonna julistettiin

Huhtikuun 14. päivänä tänä vuonna julistettiin Katsaus Märkäisistä haavasiteistä yksilön genomiin Tiina Immonen ja Hannu Sariola Vuotta 2003 juhlittiin DN:n juhlavuotena ympäri maailmaa. Tähän antoi aiheen ihmisen genomi -hankkeen loppuun saattaminen

Lisätiedot

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna Ihmisen keho muodostuu miljardeista soluista. Vaikka nämä solut ovat tietyssä mielessä meidän omiamme, ne polveutuvat itsenäisistä yksisoluisista elämänmuodoista, jotka ovat säilyttäneet monia itsenäisen

Lisätiedot

Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi

Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Tehtävä 1: Solusykli, 0 9 p. Etsi oppikirjasta (ainakin Lehningeristä ja Albertsista löytyy) tai verkosta kuva solusyklistä (cell

Lisätiedot

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä

Lisätiedot

TEE-SE-ITSE-ELEKTROFOREESI

TEE-SE-ITSE-ELEKTROFOREESI TEE-SE-ITSE-ELEKTROFOREESI Justus Mutanen (Opinkirjon työn pohjalta) BioPop-resurssikeskus, Helsingin yliopiston LUMA-keskus Työn tavoite Työn tavoitteena on tutustua elektroforeesin periaatteeseen ja

Lisätiedot

ELÄMÄN MÄÄRITTELEMINEN. LUENTO 1 Kyösti Ryynänen Seutuviikko 2014, Jämsä MITÄ ELÄMÄ ON? EI-ELÄVÄ LUONTO ELÄVÄ LUONTO PAUL DAVIES 26.3.

ELÄMÄN MÄÄRITTELEMINEN. LUENTO 1 Kyösti Ryynänen Seutuviikko 2014, Jämsä MITÄ ELÄMÄ ON? EI-ELÄVÄ LUONTO ELÄVÄ LUONTO PAUL DAVIES 26.3. LUENTO 1 Kyösti Ryynänen Seutuviikko 2014, Jämsä MITEN ELÄMÄÄ VOIDAAN MÄÄRITELLÄ? MAA-ELÄMÄN RAKENNUSSARJAN SISÄLTÖ 1 ELÄMÄN MÄÄRITTELEMINEN ASTROBIOLOGIA TARVITSEE JA EDELLYTTÄÄ KOSMOLOGISTA JA UNIVERSAALIA

Lisätiedot

Bioinformatiikan sanasto

Bioinformatiikan sanasto Bioinformatiikan sanasto A A-DNA : - A-DNA B-DNA:sta dehydraation kautta syntynyt rakennemuoto, jossa on 11 emäsparia/kierre. - Katso myös: B-DNA, Z-DNA ab initio : - lat. alusta, perusteista Laskennassa

Lisätiedot

RAVITSEMUSTIETEEN PÄÄSYKOKEIDEN OIKEAT VASTAUKSET 2013, OIKEA VAIHTOEHTO ON MERKITTY PUNAISELLA.

RAVITSEMUSTIETEEN PÄÄSYKOKEIDEN OIKEAT VASTAUKSET 2013, OIKEA VAIHTOEHTO ON MERKITTY PUNAISELLA. RAVITSEMUSTIETEEN PÄÄSYKOKEIDEN OIKEAT VASTAUKSET 2013, OIKEA VAIHTOEHTO ON MERKITTY PUNAISELLA. 1. BIOLOGIA Kysymyksissä 1-8 on neljä vastausvaihtoehtoa, joista yksi on oikein. Oikeasta vastauksesta saa

Lisätiedot

-1- Ota henkilötodistus mukaasi jättäessäsi vastauspaperin. Kysymyksiin voi vastata suomeksi, ruotsiksi tai englanniksi.

-1- Ota henkilötodistus mukaasi jättäessäsi vastauspaperin. Kysymyksiin voi vastata suomeksi, ruotsiksi tai englanniksi. Oulun yliopiston biokemian koulutusohjelman valintakoe 21.5.2014 Nimi: Henkilötunnus: Ota henkilötodistus mukaasi jättäessäsi vastauspaperin. Kysymyksiin voi vastata suomeksi, ruotsiksi tai englanniksi.

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Mitä tarkoitetaan biopolymeerilla? Mihin kolmeen ryhmään biopolymeerit voidaan jakaa? (1,5 p) Biopolymeerit ovat luonnossa esiintyviä / elävien solujen muodostamia polymeerejä / makromolekyylejä.

Lisätiedot

5.2.2 IGF-I / MGF... 39 5.2.3 Insuliini... 41 5.2.4 Kasvuhormoni... 41 5.2.5 Androgeenit - testosteroni... 42 5.2.6 Kortisoli... 43 5.

5.2.2 IGF-I / MGF... 39 5.2.3 Insuliini... 41 5.2.4 Kasvuhormoni... 41 5.2.5 Androgeenit - testosteroni... 42 5.2.6 Kortisoli... 43 5. HERAPROTEIININ VAIKUTUS MYOSTATIININ JA SOLUSYKLIÄ SÄÄTELEVIEN GEENIEN ILMENTYMISEEN SEKÄ NÄIDEN YHTEYS ANDROGEENEIHIN VOIMA- HARJOITUKSEN YHTEYDESSÄ IKÄÄNTYNEILLÄ MIEHILLÄ Inna Lisko Pro gradu -tutkielma

Lisätiedot

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan

Lisätiedot

Ihmisten erilaisuuden geneettinen perusta

Ihmisten erilaisuuden geneettinen perusta hmisten erilaisuuden geneettinen perusta etter ortin hmisen genomin tutkimus on astunut uuteen vaiheeseen kun on alettu tutkia ihmisen geneettisen monimuotoisuuden määrää ja laatua. seita tätä tutkimushanketta

Lisätiedot

Geenitekniikalla muunnettujen kasvien riskinarviointi Nykykäytäntö ja eri viranomaisten ohjeita

Geenitekniikalla muunnettujen kasvien riskinarviointi Nykykäytäntö ja eri viranomaisten ohjeita VTT TIEDOTTEITA MEDDELANDEN RESEARCH NOTES 1984 Geenitekniikalla muunnettujen kasvien riskinarviointi Nykykäytäntö ja eri viranomaisten ohjeita Kirsi Törmäkangas VTT Automaatio VALTION TEKNILLINEN TUTKIMUSKESKUS

Lisätiedot

Synteettinen biologia

Synteettinen biologia Synteettinen biologia Julkaisun on toimittanut biotekniikan neuvottelukunta (BTNK) Kirjoittajat: Anneli Ritala, Outi Koivistoinen, Jussi Jäntti Teknologian tutkimuskeskus VTT Marko Ahteensuu Helsingin

Lisätiedot

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...

Lisätiedot

Biologian harjoitustehtäviä kurssit1 5 ilari niemi

Biologian harjoitustehtäviä kurssit1 5 ilari niemi B iolgai o Biologian harjoitustehtäviä kurssit1 5 ilari niemi 1 Turun kristillisen opiston oppimateriaaleja Biologia ja integroivat tehtävät: Ilari Niemi 2014. Taitto ja kuvitus: Ulriikka Lipasti, Turun

Lisätiedot

PISTEET (A+B) A a) b) c) d) e) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20.

PISTEET (A+B) A a) b) c) d) e) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. ASTAUSLOMAKE - KANSALLINEN BIOLOGIAKILPAILU 2014 OPISKELIJAN NIMI: KOTIOSOITE: PISTEET (A+B) SYNTYMÄAIKA: PUHELINNUMERO: SÄHKÖPOSTI: @ KOULUN NIMI: UOSIKURSSINI: 1. 2. 3. 3+ MERKITSE RASTILLA (X) OIKEA

Lisätiedot

PROTEIINIEN MUOKKAUS JA KULJETUS

PROTEIINIEN MUOKKAUS JA KULJETUS PROTEIINIEN MUOKKAUS JA KULJETUS 1.1 Endoplasmakalvosto Endoplasmakalvosto on organelli joka sijaitsee tumakalvossa kiinni. Se on topologisesti siis yhtä tumakotelon kanssa. Se koostuu kahdesta osasta:

Lisätiedot

Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2. 21.2. 2006, Nisse Suutarinen

Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2. 21.2. 2006, Nisse Suutarinen Evolutiiviset muutokset aivoalueiden rakenteessa, osa 2 21.2. 2006, Nisse Suutarinen Aivoalueen monimutkaistuminen eriytymällä Eriytyminen (segregation) aivojen evoluutiosta puhuttaessa on tapahtuma, jossa

Lisätiedot

Laskuharjoitus 1 palautus 21. 10. 2003 mennessä Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi

Laskuharjoitus 1 palautus 21. 10. 2003 mennessä Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Laskuharjoitus 1 palautus 21. 10. 2003 mennessä Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Yleistä Kurssin maksimipistemäärä on 44. Kaikista mahdollisista pisteistä 36 on jaossa kurssin tentissä, 4

Lisätiedot

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien

Lisätiedot

Tieteessä tapahtuu 3/2013 1

Tieteessä tapahtuu 3/2013 1 Tieteessä tapahtuu 3 2013 Tieteen yhteiskunnalliset haasteet DNA:n rakenne tunnettu 60 vuotta Ilmastoneuvotteluiden vaikutus Afrikkaan Opiskelijapalautteella rahaa Tutkimuksen kustannustehokkuus Tieteessä

Lisätiedot

Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa

Lisätiedot

Genetiikan synnystä 140 vuotta

Genetiikan synnystä 140 vuotta Genetiikan synnystä 140 vuotta etter ortin 36 Genetiikan perusteiden luoja Gregor Mendel on yksi ihmiskunnan suurista neroista ja 1800-luvulla esiin murtautuneen rationaalisen ajattelutavan luojista. nsikädessä

Lisätiedot

Symbioosi 2 VASTAUKSET. b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl

Symbioosi 2 VASTAUKSET. b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl Luku 14 Symbioosi 2 VASTAUKSET 1. Banaanikärpänen dihybridiristeytys a. Mikä on vanhempien genotyyppi? Vastaus: VvLl b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl c.

Lisätiedot

Tuma - nucleus. Tumahuokonen nuclear pore samanlaisia kasveilla ja eläimillä. Tuman rakenne. Solubiologian luennot 2003, kasvitiede

Tuma - nucleus. Tumahuokonen nuclear pore samanlaisia kasveilla ja eläimillä. Tuman rakenne. Solubiologian luennot 2003, kasvitiede Tuma - nucleus Solubiologian luennot 2003, kasvitiede Tuman rakenne kaksoiskalvo, joiden välissä perinukleaarinen tila huokoset (nuclear pores) ulkokalvo yhteydessä ER:ään sisäkalvossa kiinni 10 nm filamentteja

Lisätiedot

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa.

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa. 1 1/2011 Parkinsonin taudin perinnöllisyys Geenien ja ympäristötekijöiden vuorovaikutus sairastumisen taustalla Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla

Lisätiedot

YMPYROI OIKEAT VAIHTOEHDOT

YMPYROI OIKEAT VAIHTOEHDOT YMPYROI OIKEAT VAIHTOEHDOT Jokaisesta kysymyksestä saa yhden pisteen, jos siitä on valittu oikea(t ) vaihtoehdot. Jos jokin oikea väittämä puuttuu, tai väärä väittämä on merkitty oikeaksi, vastaus antaa

Lisätiedot

Periytyvyys ja sen matematiikka

Periytyvyys ja sen matematiikka Periytyvyys ja sen matematiikka 30.7.2001 Katariina Mäki MMM,tutkija Helsingin yliopisto, Kotieläintieteen laitos / kotieläinten jalostustiede katariina.maki@animal.helsinki.fi Jalostuksen tavoitteena

Lisätiedot

Uusi DNA:n puhdistusmenetelmä

Uusi DNA:n puhdistusmenetelmä Uusi DNA:n puhdistusmenetelmä Jens Laitinen, FT Opiskelijanumero: 010624984 Helsinki 19.05.2011 Tutkielma jens.laitinen@helsinki.fi Ohjaaja: dos. Erkki Hölttä, LKT Patologian osasto, Kliinisteoreettinen

Lisätiedot

Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.

Lisätiedot

SOLUJEN RAKENTEET, ERI SOLUTYYPIT

SOLUJEN RAKENTEET, ERI SOLUTYYPIT 71 B SOLUJEN RAKENTEET, ERI SOLUTYYPIT 72 B1 Tuma miten aitotumallinen säilyttää ja käsittelee informaatiota Stenius, Hannele & Valli, Noora Solu-ja kehitysbiologian kurssin kirjoitelma Anatomian ja solubiologian

Lisätiedot

2 c. n V. n c. m = = V. Tehtävä 1. Väkevän suolahapon massaprosenttinen HCl-pitoisuus on 37%.

2 c. n V. n c. m = = V. Tehtävä 1. Väkevän suolahapon massaprosenttinen HCl-pitoisuus on 37%. Tehtävä 1. äkevä suoahapo massaprosettie C-pitoisuus o 7%. a. Mikä o iuokse kosetraatio (mo/), ku se tiheys o 1,18 kg/? b. Mite pajo tarvitset suoahappoa eutraoidaksesi 0,1 itraa 0,5 M kasiumhydroksidia(aq)?

Lisätiedot

KEESHONDIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,

Lisätiedot

5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin

Lisätiedot

11111111111111 11 [II 1111

11111111111111 11 [II 1111 11111111111111 11 [II 1111 F (000101453B (12) PATENTTIJULKAISU PATENTS1CRIFT (10) FI 101453 B (45) Patentti myönnetty - Patent beviljats 30.06.98 (51) Kv.lk.6 - Int.k1.6 SUOMI-FINLAND (FI) A 61K 39/012,

Lisätiedot

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten

Lisätiedot

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008 16 Kromosomimuutokset Huhtikuussa 2008 Tätä työtä tuki EuroGentest, joka on Euroopan yhteisön tutkimuksen kuudennen puiteohjelman rahoittama verkosto. Kääntänyt Tiina Lund-Aho yhteistyössä Väestöliiton

Lisätiedot

Maria Aalto. BRIP1-geenin eksonien 12 ja 14 mutaatiomääritys munasarjasyövässä

Maria Aalto. BRIP1-geenin eksonien 12 ja 14 mutaatiomääritys munasarjasyövässä Maria Aalto BRIP1-geenin eksonien 12 ja 14 mutaatiomääritys munasarjasyövässä Metropolia Ammattikorkeakoulu Laboratorioanalyytikko Laboratorioalan koulutusohjelma Opinnäytetyö 26.4.2012 ALKULAUSE Tämä

Lisätiedot

Aleksi Jokinen, Timo Viljanen & Lassi 81: 1 &82: 4 Ti 3.3.

Aleksi Jokinen, Timo Viljanen & Lassi 81: 1 &82: 4 Ti 3.3. Biologian kurssi 4: Ihmisen biologia Laadi monisteen tehtäviä apuna käyttäen selkeä suullinen esitelmä ihmisen elimistä, niiden rakenteista, toiminnan säätelystä ja yleisimmistä toimintahäiriöistä. Aihe:

Lisätiedot

Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa

Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa KOTIELÄINJALOSTUKSEN TIEDOTE No 82 Geeniteknologian hyväksikäyttö- mahdollisuudet kotieläinjalostuksessa Sampo Sirkkomaa ja Matti Ojala Kotieläinten jalostustieteen laitos Helsinki 1988 Julkaistjat: Kotieläinten

Lisätiedot

SIKIÖDIAGNOSTIIKKA SUOMESSA

SIKIÖDIAGNOSTIIKKA SUOMESSA SIKIÖDIAGNOSTIIKKA SUOMESSA Geneettisten tutkimusmenetelmien kehitys Enni Loven Päivi Suorsa Opinnäytetyö Lokakuu 2011 Bioanalytiikan koulutusohjelma Tampereen ammattikorkeakoulu 2 TIIVISTELMÄ Tampereen

Lisätiedot

Epigenetiikka haastaa käsityksiämme periytymisestä ja evoluutiosta

Epigenetiikka haastaa käsityksiämme periytymisestä ja evoluutiosta Epigenetiikka haastaa käsityksiämme periytymisestä ja evoluutiosta Hanna Häkkinen, Antti Miettinen, Anne-Mari Mikkonen, Tinja Pitkämäki, Salla Sovelius ja Susanne Varjola Epigenetiikka on viime aikoina

Lisätiedot

Broilerivehnän viljelypäivä 2.2.2012 Essi Tuomola

Broilerivehnän viljelypäivä 2.2.2012 Essi Tuomola Hankeaika 10.10.2007-31.12.2012 Yhteistyössä: Siipikarjan tuottajat Broilerivehnän viljelypäivä 2.2.2012 Essi Tuomola Broilerin rehustuksen koostumus Valkuaisaineet Aminohapot Vehnän rehuarvo broilerille

Lisätiedot

Proteiinien muuntuminen energiaksi ihmiselimistössä

Proteiinien muuntuminen energiaksi ihmiselimistössä Proteiinien muuntuminen energiaksi ihmiselimistössä Helsingin yliopisto Matemaattis-luonnontieteellinen tiedekunta Kemian laitos Kemian opettajankoulutusyksikkö Kandidaatintutkielma Tekijä: Klaus Sippel

Lisätiedot

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB

Mitä uutta DNA:sta. - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset. Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB Mitä uutta DNA:sta - koko perimän laajuiset analyysimenetelmät ja niiden sovellukset Heidi Nousiainen, FT Erikoistuva kemisti, HUSLAB SKKY:n ja Sairaalakemistit Ry:n syyskoulutuspäivät Paasitorni, 16.11.2012

Lisätiedot

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki

Lisätiedot