6.4. Genomin koon evoluutio Genomin koko vaihtelee

Koko: px
Aloita esitys sivulta:

Download "6.4. Genomin koon evoluutio Genomin koko vaihtelee"

Transkriptio

1 6.4. Genomin koon evoluutio Genomin koko vaihtelee

2 C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm))

3 Missäkohtaa genomiaon kokoeroja? geenien määrä geenien koko; eksonien/intronien koko geenien välialueet polyploidisaatio repetitiivinen DNA, mm. siirtyvistä elementeistä peräisin

4 Genomin koko -genomin koko ja proteiinia koodaavien geenien määrä korreloivat bakteereilla, arkeilla ja viruksilla mutta eivät eukaryooteilla: C-arvoparadoksi -Eukaryooteilla geenien määrä vaihtelee 50 kertaisesti, DNA:n määrä kertaisesti - selittyy paljolti repetitiivisellä, eifunktionaalisella DNA:lla, kasveilla myös polyploidialla Geenien lukumäärä

5 Prot. koodaavaa Ihm. pseudogeeni Repetitiivistä DNA:ta Barton ym Ihmisen beta T-solureseptorigeeni (osa) E. coli K12 - genomia

6 Ihmisen factor IX geeni GL12

7 kb Lituruohon tiiviitä geenejä COP1 DET1 IV II FCA IV GA1 IV TFL1 V FAH1 IV F3H III CAD IV DFR V CHI III CHS IV

8 Genomin koon vaihtelu heinäkasveissa selittyy polyploidisaatiolla Lajien määrä GL381 Genomin koko x 10 9 bp

9 Miten saa aikaiseksi paljon erilaisia geenituotteita ilman että genomin koko kasvaa: -intronien koodaamat proteiinit -päällekkäiset geenit -geenin jakaminen (samalla geenillä on erilaisia toimintoja) -RNA:n editointi (transkription jälkeinen prosessointi) S Farajollahi and S Maas 2010 Molecular diversity through RNA editing: a balancing act. Trends in Genetics 26: vaihtoehtoinen silmikointi H Keren, G Lev-Maor & G Ast 2010 Alternative splicing and evolution: diversification, exon definition and function. Nature Reviews Genetics 11,

10 Mikä määrää genomin koon? Repetitiivisen DNA:n määrä on seurausta tasapainosta toistojen synnyn ja häviämisen välillä: erot eri lajeilla johtuvat joko erilaisesta vauhdista jolla toistoja syntyy genomiin tai jolla niitä poistuu genomista -selektionistinen hypoteesi: funktio, esim. globaalinen geenisäätely -nukleotyyppinen hypoteesi: solukoko -neutralistinen hypoteesi: roska-dna; drifti määrää genomin koon -itsekäs DNA-hypoteesi: kykenee itsenäisesti lisääntymään genomin sisällä; liiallinen DNA voi olla huono metabolian raskauden takia

11 Mikä hypoteesi? Barton ym. 2007

12 6.4.2 Repetitiivinen DNA selittää pääosin eukaryoottien C-arvoparadoksin koostuu eri pituisista ja sisältöisistä DNA-jaksoista jotka esiintyvät moninkertaisina toistoina joko paikallisesti (tandem, perättäin) tai hajallaan (dispersed) genomissa yksittäin esiintyvät jaksot ovat yksittäiskopiogeenejä (single copy genes) Ihmisen genomista noin 50 % on repetitiivisiä sekvenssejä, vain alle 1,5 % koodaavaa aluetta

13 -Yksinkertaiset perättäin esiintyvät repetitiiviset sekvenssit: GL392 -Hajallaan olevat repetitiiviset sekvenssit ovat suureksi osaksi siirtyviä elementtejä.

14 Siirtyvät elementit (transposable elements) - sekvenssejä jotka pystyvät siirtymään ja kopioitumaan genomissa - suhteellisen pysyvä osa genomia - aktiivisten siirtyvien elementtien toiminnan hiljennys (silencing) - ei adaptiivista funktiota - luokittelu: autonominen ei-autonominen RNA-välitteinen (luokan I elementti; retrotransposoni) DNA-välitteinen (luokan II elementti; DNA-transposoni )

15 Siirtyvien elementtien liikkuminen a) DNA-transposoni: Konservatiivinen transpositio b) DNA-transposoni: Replikatiivinen transpositio c) Retrotransposoni Hox! -tämän mekanismin avulla myös satunn. geenien mrna:sta kääntyy joskus cdna ja insertoituu genomiin > retrosekvenssi; on usein pseudogeeni GL324

16 Ihmisen siirtyvät elementit voidaan jakaa pääosin 4 luokkaan: Review-artikkeli siirtyvistä elementeistä: Slotkin, Martienssen 2007, Nat Rev Gen 8: Nature 409:860, 2001 Retro trans poso neja

17 Eukaryoottien SINE-LINE elementit SINE (short interspersed repetitive elements) bp -ei-autonomisia siirtyviä elementtejä jotka tarvitsevat apua retropositioon -peräisin 7SL RNAsta tai trnasta (suurin osa) -esim. ihmisen Alu muodostaa 10% genomista. LINE (long interspersed repetitive elements) -3-7 kb sis. endonukleaasin ja käänteistranskriptaasin joka spesifinen kullekin LINElle (3 pää määrää spesifisyyden) -osa degeneroituneita, eivät enää pysty siirtymään SINEt siirtyvät LINEn avulla

18 GL348 Sine-Line-parit

19 Geenit ESTit Siirt.elementit Mitok. (musta)/kloropl. (vihr.)-alkuperä trna (musta) snrna (pun) Värikoodi: Pun=paljon Sin=vähän v.pun= rdna Siirtyviä elementtejä on paljon sentromeerien lähellä. A. thaliana Nature 408:796, 2000

20 Liikkuvien elementtien vaikutukset -Genomin koon kasvu -Geenien siirtyminen bakteereissa plasmidien transposonit sisältävät resistenssigeenejä -Geeninsäätely Siirtyvän elementin insertio geeniin > geeni muuttuu toimimattomaksi tai geenisäätely muuttuu; esim transposoni FLC geenin 1. intronissa > FLC ei toimi; esim. jos E. colin gal operoniin menee transposoni, operoni ekspressoituu jatkuvasti -Materiaalina uusille geeneille tai säätelyalueille

21 -Aiheuttavat genomisia uudelleenjärjestelyjä (inversiot translokaatiot, duplikaatiot, insertiot ja deleetiot) 1) joko suoraan: DNA-sekvenssi siirtyy paikasta toiseen 2) tai välillisesti: syntyy homologisia alueita eri puolille tai perättäin genomissa, jolloin rekombinaatio on mahdollinen

22 6.5. Genomiprojektit: Eri lajien genomien sekvenssivertailu antaa tietoa: geenien lkm, koko, pseudogeenit uusien geenien synty geeniperheet ja niiden organisaatio intronien lkm ja sijainti repetitiiviset sekvenssit: mikrosatelliitit ja siirtyvät elementit Ei-alleelinen geenikonversio alueelliset erot nukleotidisisällössä, metylaatiossa, geenien ja intronien ominaisuuksissa kodonin käyttö horisontaalinen geenisiirto (lajien välillä, organellien ja tuman välillä) Charlesworth et al TREE 16:235

23 Sivusto NCBI:stä

24

Genomin evoluutio. Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan?

Genomin evoluutio. Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan? Genomin evoluutio Miten genomin koko ja rakenne muuttuvat ja miten sitä tutkitaan? -duplikaatiot: geenien, geenin osien duplikaatiot, segmentaaliset, koko genomin duplikaatiot -duplikoituneiden geenien

Lisätiedot

HOX. Esimerkki geeniperheestä: HOX

HOX. Esimerkki geeniperheestä: HOX Esimerkki geeniperheestä: HOX HOX Barton ym. 2007 Unraveling ancient segmental duplication events in human genome by phylogenetic analysis of multigene families residing on HOXcluster paralogons, Abbasi,

Lisätiedot

Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi

Lisätiedot

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja

Lisätiedot

VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen

Lisätiedot

NON-CODING RNA (ncrna)

NON-CODING RNA (ncrna) NON-CODING RNA (ncrna) 1. Yleistä NcRNA eli non-coding RNA tarkoittaa kaikkia proteiinia koodaamattomia rnamolekyylejä. Näistä yleisimmin tunnetut ovat ribosomaalinen RNA (rrna) sekä siirtäjä-rna (trna),

Lisätiedot

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien

Lisätiedot

DNA > RNA > Proteiinit

DNA > RNA > Proteiinit Genetiikan perusteiden luentojen ensimmäisessä osassa tarkasteltiin transmissiogenetiikkaa eli sitä, kuinka geenit siirtyvät sukupolvesta toiseen Toisessa osassa ryhdymme tarkastelemaan sitä, mitä geenit

Lisätiedot

Genomin ilmentyminen

Genomin ilmentyminen Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne

Lisätiedot

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset

Lisätiedot

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli

Lisätiedot

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays

Lisätiedot

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia DNA 18.4.2016 Tiina Immonen, FT, yo-lehtori HY Lääketieteellinen tiedekunta Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio

Lisätiedot

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä

Lisätiedot

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO

Muuttumaton genomi? Genomin ylläpito. Jakson luennot. Luennon sisältö DNA:N KAHDENTUMINEN ELI REPLIKAATIO Muuttumaton genomi? Genomin ylläpito SNP 14.1.2013 Tiina Immonen Biolääketieteen laitos Biokemia ja kehitysbiologia Jakson luennot Mitä on genomilääketiede? Dan Lindholm Genomin ylläpito Tiina Immonen

Lisätiedot

Francis Crick ja James D. Watson

Francis Crick ja James D. Watson Francis Crick ja James D. Watson Francis Crick ja James D. Watson selvittivät DNAn rakenteen 1953 (Nobel-palkinto 1962). Rosalind Franklin ei ehtinyt saada kunniaa DNA:n rakenteen selvittämisestä. Hän

Lisätiedot

Sekvenssievoluutio ja fylogeniat

Sekvenssievoluutio ja fylogeniat Sekvenssievoluutio ja fylogeniat Miksi sekvenssien evoluutionopeus vaihtelee? -erot korvautumisnopeudessa geenien tai geenin eri osien välillä, -erot korvautumisnopeudessa eri fylogeneettisten linjojen

Lisätiedot

"Geenin toiminnan säätely" Moniste sivu 13

Geenin toiminnan säätely Moniste sivu 13 "Geenin toiminnan säätely" Moniste sivu 13 Monisteen alussa on erittäin tärkeitä ohjeita turvallisuudesta Lukekaa sivu 5 huolellisesti ja usein Vaarat vaanivat: Palavia nesteitä ja liekkejä on joskus/usein

Lisätiedot

LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä

LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä LUENTO 3 Kyösti Ryynänen Seutuviikko 2014, Jämsä MITEN MATERIA KOODAA MATERIAA? 1 PROTEIINISYNTEESI DNA SISÄLTÄÄ GENEETTISEN KOODIN EMÄSJÄRJESTYKSEN MUODOSSA DNA:N EMÄSJÄRJESTYS KOPIOIDAAN (TRANSKRIPTIO)

Lisätiedot

Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.

Lisätiedot

DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri

Lisätiedot

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30

Bioteknologian tutkinto-ohjelma Valintakoe Tehtävä 3 Pisteet / 30 Tampereen yliopisto Bioteknologian tutkinto-ohjelma Valintakoe 21.5.2015 Henkilötunnus - Sukunimi Etunimet Tehtävä 3 Pisteet / 30 3. a) Alla on lyhyt jakso dsdna:ta, joka koodaa muutaman aminohappotähteen

Lisätiedot

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 10. Valkuaisaineiden valmistaminen solussa 1. Avainsanat 2. Perinnöllinen tieto on dna:n emäsjärjestyksessä 3. Proteiinit koostuvat

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia

Genomin ylläpito Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Genomin ylläpito 14.1.2014 Tiina Immonen BLL Lääke8eteellinen biokemia ja kehitysbiologia Luennon sisältö DNA:n kahdentuminen eli replikaa8o DNA:n korjausmekanismit Replikaa8ovirheiden korjaus Emäksenpoistokorjaus

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto.

Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto. Nukleiinihapot! Juha Klefström, Biolääketieteen laitos/biokemia ja genomibiologian tutkimusohjelma Helsingin yliopisto Juha.Klefstrom@helsinki.fi Nukleiinihapot! kertausta matkan varrella, vähemmän kuitenkin

Lisätiedot

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu

Lisätiedot

Evoluutiovoimat. Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa?

Evoluutiovoimat. Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa? Evoluutiovoimat Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa? -sattuman sysäily: populaatiokoon vaikutus -valinta: positiivinen, tasapainottava ja negatiivinen -mutaatiot: neutraalien,

Lisätiedot

Seutuviikko 2015, Jämsä Kyösti Ryynänen PROTEIINISYNTEESI LUENTO 3 DNA-RAKENNE DNA SOLUJAKAUTUMINEN DNA-KAKSOISKIERRE

Seutuviikko 2015, Jämsä Kyösti Ryynänen PROTEIINISYNTEESI LUENTO 3 DNA-RAKENNE DNA SOLUJAKAUTUMINEN DNA-KAKSOISKIERRE Seutuviikko 2015, Jämsä Kyösti Ryynänen LUENTO 3 MITEN MATERIA KOODAA MATERIAA? 1 PROTEIINISYNTEESI DNA SISÄLTÄÄ GENEETTISEN KOODIN EMÄSJÄRJESTYKSEN MUODOSSA DNA:N EMÄSJÄRJESTYS KOPIOIDAAN (TRANSKRIPTIO)

Lisätiedot

SÄTEILYN TERVEYSVAIKUTUKSET

SÄTEILYN TERVEYSVAIKUTUKSET SÄTEILYN TERVEYSVAIKUTUKSET 25 Säteily- ja ydinturvallisuus -kirjasarjan toimituskunta: Sisko Salomaa, Wendla Paile, Tarja K. Ikäheimonen, Roy Pöllänen, Anne Weltner, Olavi Pukkila, Jorma Sandberg, Heidi

Lisätiedot

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio

Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Avainsanat: perimä dna rna 5`-ja 3`-päät replikaatio polymeraasientsyymi eksoni introni promoottori tehostajajakso silmukointi mutaatio Perinnöllinen informaatio sijaitsee dna:ssa eli deoksiribonukleiinihapossa

Lisätiedot

II Genetiikka 4.(3) Nukleiinihapot

II Genetiikka 4.(3) Nukleiinihapot II Genetiikka 4.(3) Nukleiinihapot Geenitekniikka - menetelmiä, joiden avulla dna:ta ja rna:ta voidaan eristää, muokata ja siirtää muihin soluihin tai eliöihin kromosomit koostuvat dna-rihmasta ja siihen

Lisätiedot

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa Kertaus CHEM-C2300 0 Tällä luennolla: - Oletteko lukeneet artikkelia, käydäänkö läpi? - Ehdotuksia tenttikysymyksiin? - Käydään läpi kurssin keskeiset asiakokonaisuudet otsikkotasolla - Extra: PCR-alukkeiden

Lisätiedot

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93.

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93. 1 I) Ovatko väittämät oikein (O) vai väärin (V)? Jos väite on mielestäsi väärin, perustele se lyhyesti väittämän alla oleville riveille. O/V 1.2. Downin oireyhtymä johtuu pistemutaatista fenyylialaniinin

Lisätiedot

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00

KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 BIOLÄÄKETIETEEN Henkilötunnus: - KOULUTUSOHJELMA Sukunimi: 18.5.2016 Etunimet: Nimikirjoitus: BIOLOGIA (45 p) Valintakoe klo 9.00-13.00 Kirjoita selvästi nimesi ja muut henkilötietosi niille varattuun

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

Genetiikan perusteiden harjoitustyöt

Genetiikan perusteiden harjoitustyöt Genetiikan perusteiden harjoitustyöt Molekyylien kloonaus ja siihen liittyvät taidot ja temput, osa 1 Restriktioentsyymit, elektroforeesi Moniste sivulta 24-: Geenien kloonaus CELL 491- Isolating, cloning,

Lisätiedot

Uusia mahdollisuuksia FoundationOne

Uusia mahdollisuuksia FoundationOne Uusia mahdollisuuksia FoundationOne FI/FMI/1703/0019 Maaliskuu 2017 FoundationOne -palvelu FoundationOne on kattava genomianalysointipalvelu, jossa tutkitaan 315 geenistä koko koodaava alue sekä 28 geenistä

Lisätiedot

Etunimi: Henkilötunnus:

Etunimi: Henkilötunnus: Kokonaispisteet: Lue oheinen artikkeli ja vastaa kysymyksiin 1-25. Huomaa, että artikkelista ei löydy suoraan vastausta kaikkiin kysymyksiin, vaan sinun tulee myös tuntea ja selittää tarkemmin artikkelissa

Lisätiedot

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja

Lisätiedot

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008 16 Kromosomimuutokset Huhtikuussa 2008 Tätä työtä tuki EuroGentest, joka on Euroopan yhteisön tutkimuksen kuudennen puiteohjelman rahoittama verkosto. Kääntänyt Tiina Lund-Aho yhteistyössä Väestöliiton

Lisätiedot

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa

Lisätiedot

Ribosomit 1. Ribosomit 2. Ribosomit 3

Ribosomit 1. Ribosomit 2. Ribosomit 3 Ribosomit 1 Palade & Siekevitz eristivät jaottelusentrifugaatiolla ns. mikrosomeja radioakt. aminohapot kertyivät mikrosomeihin, jotka peräisin rer:ää sisältävistä soluista proteiinisynteesi soluliman

Lisätiedot

Bioinformatiikan sanasto

Bioinformatiikan sanasto Bioinformatiikan sanasto A A-DNA : - A-DNA B-DNA:sta dehydraation kautta syntynyt rakennemuoto, jossa on 11 emäsparia/kierre. - Katso myös: B-DNA, Z-DNA ab initio : - lat. alusta, perusteista Laskennassa

Lisätiedot

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...

Lisätiedot

Eliömaailma. BI1 Elämä ja evoluutio Leena Kangas-Järviluoma

Eliömaailma. BI1 Elämä ja evoluutio Leena Kangas-Järviluoma Eliömaailma BI1 Elämä ja evoluutio Leena Kangas-Järviluoma Aitotumalliset l. eukaryootit Esitumalliset l. prokaryootit kasvit arkit alkueliöt sienet bakteerit eläimet Eliökunnan sukupuu Tumattomat eliöt

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Seoksen komponentit voidaan erotella toisistaan kromatografisilla menetelmillä. Mihin kromatografiset menetelmät perustuvat? (2p) Menetelmät perustuvat seoksen osasten erilaiseen sitoutumiseen paikallaan

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

Kukan kehitystä säätelevien geenien molekyylikloonaus

Kukan kehitystä säätelevien geenien molekyylikloonaus Sanna Viitanen Kukan kehitystä säätelevien geenien molekyylikloonaus Opinnäytetyö Metropolia Ammattikorkeakoulu Terveys- ja hoitoala Bioanalytiikka Opinnäytetyö 15.5.2014 Tiivistelmä Tekijä(t) Otsikko

Lisätiedot

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio

Lisätiedot

Saana-Mari Jänkälä CDNA-KIRJASTON VALMISTUKSESSA KÄYTETTÄVIÄ GEENITEKNIIKAN MENETELMIÄ

Saana-Mari Jänkälä CDNA-KIRJASTON VALMISTUKSESSA KÄYTETTÄVIÄ GEENITEKNIIKAN MENETELMIÄ Saana-Mari Jänkälä CDNA-KIRJASTON VALMISTUKSESSA KÄYTETTÄVIÄ GEENITEKNIIKAN MENETELMIÄ CDNA-KIRJASTON VALMISTUKSESSA KÄYTETTÄVIÄ GEENITEKNIIKAN MENETELMIÄ Saana-Mari Jänkälä Opinnäytetyö syksy 2011 Laboratorioalan

Lisätiedot

MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta)

MALLIVASTAUKSET (max 30 p/kysymys, max 120 p koko kokeesta) Tehtävä Pisteet a) Mitkä ovat solussa DNA:n, mitkä RNA:n tehtäviä? Miksi mielestäsi DNA on valikoitunut kaikkien solullisten organismien perintöainekseksi? max 5 DNA: perinnöllisen tiedon säilyttäminen

Lisätiedot

Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine

Lisätiedot

Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä

Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Vesihuoltopäivät 10.5.2017, Jyväskylä Jenni Kesulahti Diplomityö Aalto-yliopistossa Hankkeessa

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. a) Mitä tarkoitetaan biopolymeerilla? Mihin kolmeen ryhmään biopolymeerit voidaan jakaa? (1,5 p) Biopolymeerit ovat luonnossa esiintyviä / elävien solujen muodostamia polymeerejä / makromolekyylejä.

Lisätiedot

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Nimi sosiaaliturvatunnus. Vastaa lyhyesti, selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1. Valitse listasta kunkin yhdisteen yleiskielessä käytettävä ei-systemaattinen nimi. (pisteet yht. 5p) a) C-vitamiini b) glukoosi c) etikkahappo d) salisyylihappo e) beta-karoteeni a. b. c. d. e. ksylitoli

Lisätiedot

Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä

Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Kehitysbiologiassa käytetään lukuisia viekkaita kuvantamismenetelmiä Reportterigeenit ja reportterikonstruktiot? Monissa tilanteissa tarvitaan ilmaisinta (proobi, luotain, reportteri) kertomaan, mitä/missä/milloin

Lisätiedot

Ihmisten erilaisuuden geneettinen perusta

Ihmisten erilaisuuden geneettinen perusta hmisten erilaisuuden geneettinen perusta etter ortin hmisen genomin tutkimus on astunut uuteen vaiheeseen kun on alettu tutkia ihmisen geneettisen monimuotoisuuden määrää ja laatua. seita tätä tutkimushanketta

Lisätiedot

BIOLOGIAN OSIO (45 p.)

BIOLOGIAN OSIO (45 p.) BIOLÄÄKETIETEEN KOULUTUSOHJELMA PÄÄSYKOE 17.5.2017 BIOLOGIAN OSIO (45 p.) HYVÄN VASTAUKSEN PIIRTEET I) Esseetehtävät (2 kpl) a) Selitä perustellen, miten kuvaan merkittyihin kohtiin osuvat mutaatiot voivat

Lisätiedot

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset EU:ssa ei ole yleisesti hyväksyttyä elintarvikepetosten määritelmää. Yleinen ohjeistus löytyy elintarvikelainsäädäntöä

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma Evoluutio BI Elämä ja evoluutio Leena Kangas-Järviluoma 1 Evoluutio lajinkehitystä, jossa eliölajit muuttuvat ja niistä voi kehittyä uusia lajeja on jatkunut elämän synnystä saakka, sillä ei ole päämäärää

Lisätiedot

Elämän synty. Matti Leisola

Elämän synty. Matti Leisola Elämän synty Matti Leisola Selitettävää Universumin rakenne Biologinen elämä Maailmallemme on olemassa kaksi erilaista selitysmallia Kaikki on syntynyt sattumanvaraisten fysikaalisten ja kemiallisten tapahtumien

Lisätiedot

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi)

Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) Plasmidi-DNA:n eristys bakteerisoluista DNA:n geelielektroforeesi (Proteiinien geelielektroforeesi) CHEM-A1310 Biotieteen perusteet Heli Viskari 2017 DNA-harjoitustöiden aikataulu, valitse yksi näistä

Lisätiedot

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,

Lisätiedot

Perimä on DNA:ta. DNA koodaa proteiineja Osa geeneistä on ns. RNA-geenejä. Ihmisen perimä. Periytymisen molekyylitason mekanismit

Perimä on DNA:ta. DNA koodaa proteiineja Osa geeneistä on ns. RNA-geenejä. Ihmisen perimä. Periytymisen molekyylitason mekanismit GEENIT, GEENIEN JA YMPÄRISTÖN YHTEISVAIKUTUKSET JA MIELENTERVEYDEN HÄIRIÖT Periytymisen molekyylitason mekanismit Tiina Paunio Psykiatrian dosentti, erikoislääkäri ja professori HY, K2 28.9.2012 on DNA:ta

Lisätiedot

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan

Lisätiedot

b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina.

b) keskusjyvänen eläinsolujen solulimassa lähellä tumaa, 2 kpl toimivat mitoosissa ja meioosissa sukkularihmojenkiinnittymiskohtina. Bi5 kertaustehtäviä, mallivastauksia 1. Selosta lyhyesti, missä sijaitsevat seuraavat solun osat: a) tumajyvänen b) keskusjyvänen (sentrioli, sentrosomi), c) soluneste, d) mitokondrio, e) solulimakalvosto

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio

Lisätiedot

Suurten kasvigenomien evoluutio ja tutkiminen

Suurten kasvigenomien evoluutio ja tutkiminen Suurten kasvigenomien evoluutio ja tutkiminen Timo Kumpula LuK-tutkielma Oulun yliopisto Genetiikan ja fysiologian tutkimusryhmä Toukokuu 2016 Sisällys 1. Johdanto... 1 1.1. Kromosomi- ja kromosomistomutaatiot...

Lisätiedot

Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan?

Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Miten on mahdollista, että meillä on vasta-aineet (antibodit) aivan kaikkea mahdollista sisääntunkeutuvaa vierasmateriaalia vastaan? Antipodidiversiteetin generointi Robert Koch (TB) 1905 Niels K. Jerne

Lisätiedot

HMM ja geenien etsintä

HMM ja geenien etsintä Kuten makovin mallien yhteydessä, niin HMM halutulla topologialla voidaan opettaa tunnistamaan geenejä. Ohessa eäs geenitunnistukseen käytetty topologia, joka tunnistaa ihmisen geenit (5 -> 3 ). Edellä

Lisätiedot

A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen

A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen A - soveltaminen B - ymmärtäminen C - tietäminen 1 - ehdottomasti osattava 2 - osattava hyvin 3 - erityisosaaminen Asiasisältö Keskeisyys Taso 1 2 3 A B C 1 Yleiskäsitteitä periytymiseen liittyen 1.1 Penetranssi

Lisätiedot

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow Genomi Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta Hannu Sariola, Irma Thesleff ja Marja Makarow Malliorganismeiksi kutsutaan lajeja, joita tutkijat käyttävät

Lisätiedot

DNA, RNA ja proteiinirakenteen ennustaminen

DNA, RNA ja proteiinirakenteen ennustaminen S-114.500 Solubiosysteemien perusteet Harjoitustyö Syksy 2003 DNA, RNA ja proteiinirakenteen ennustaminen Ilpo Tertsonen, 58152p Jaakko Niemi, 55114s Sisällysluettelo 1. Alkusanat... 3 2. Johdanto... 4

Lisätiedot

BIOLOGIAN KOE 30.3.2016 HYVÄN VASTAUKSEN PIIRTEITÄ

BIOLOGIAN KOE 30.3.2016 HYVÄN VASTAUKSEN PIIRTEITÄ BIOLOGIAN KOE 30.3.2016 HYVÄN VASTAUKSEN PIIRTEITÄ Alla oleva vastausten piirteiden, sisältöjen ja pisteitysten luonnehdinta ei sido ylioppilastutkintolautakunnan arvostelua. Lopullisessa arvostelussa

Lisätiedot

CAR- JA PXR -TUMARESEPTORIEN KLOONAAMINEN ERI LAJEISTA JA NIIDEN TOIMINNAN TUTKIMINEN

CAR- JA PXR -TUMARESEPTORIEN KLOONAAMINEN ERI LAJEISTA JA NIIDEN TOIMINNAN TUTKIMINEN OPINNÄYTETYÖ - AMMATTIKORKEAKOULUTUTKINTO SOSIAALI-, TERVEYS- JA LIIKUNTA-ALA CAR- JA PXR -TUMARESEPTORIEN KLOONAAMINEN ERI LAJEISTA JA NIIDEN TOIMINNAN TUTKIMINEN TEKIJÄ: Anni-Maaria Pakanen SAVONIA-AMMATTIKORKEAKOULU

Lisätiedot

1111111111!11,11)11111,11111111111191 1 111 111111 111 11111

1111111111!11,11)11111,11111111111191 1 111 111111 111 11111 1111111111!11,11)11111,11111111111191 1 111 111111 111 11111 (12) PATENTTIJULKAISU PATENTSKRIFT (10) FI 111384B (45) Patentti myönnetty - Patent beviljats 15.07.2003 SUOMI - FINLAND (FI) PATENTTI- JA REKISTERIHALLITUS

Lisätiedot

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka

Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Uuden sukupolven sekvensointimenetelmät ja diagnostiikka Juha-Pekka Pursiheimo Turun Yliopisto Turku Clinical Sequencing Laboratory (TCSL) Labquality Days 2016 11.02. 2016 n. 3,3 miljardia emäsparia kliinisesti

Lisätiedot

Molekyylipopulaatiogenetiikka

Molekyylipopulaatiogenetiikka Molekyylipopulaatiogenetiikka Hedrick 2005, kappale 8, pp. 452-462, 428-449 Demografian ja valinnan vaikutukset koalesenssipuihin Valinnan havaitseminen TajimanD Divergenssin ja polymorfismin vertailu

Lisätiedot

? LUCA (Last universal common ancestor) 3.5 miljardia v.

? LUCA (Last universal common ancestor) 3.5 miljardia v. Mitä elämä on? - Geneettinen ohjelma, joka kykenee muuttamaan ainehiukkaset ja molekyylit järjestyneeksi itseään replikoivaksi kokonaisuudeksi. (= geneettistä antientropiaa) ? LUCA (Last universal common

Lisätiedot

Virukset Materiaalitieteiden Rakennusaineina Suomalainen Tiedeakatemia

Virukset Materiaalitieteiden Rakennusaineina Suomalainen Tiedeakatemia Virukset Materiaalitieteiden Rakennusaineina Suomalainen Tiedeakatemia Mauri Kostiainen Molekyylimateriaalit-ryhmä Teknillisen fysiikan osasto Aalto-yliopisto Virukset materiaaleina Virus on isäntäsolussa

Lisätiedot

Epigenetiikka, geeninsäätely ja syöpä

Epigenetiikka, geeninsäätely ja syöpä Katsaus Mikko Taipale Epigenetiikka, geeninsäätely ja syöpä Geenitutkimus on totunnaisesti keskittynyt DNA:han. Kuitenkin perimän perusyksikkö kromosomi koostuu DNA:n lisäksi histoneista ja muista proteiineista,

Lisätiedot

Bioteknologia BI5. Mikrobit

Bioteknologia BI5. Mikrobit Bioteknologia BI5 Mikrobit MIKROBIT eliöitä kaikista neljästä kunnasta + virukset ja prionit kaikki mikroskooppisen pienet eliöt yksilö- ja lajimäärältään enemmän kuin muita eliöitä esiintyvät kaikenlaisissa

Lisätiedot

14.iv. STREPTOPHYTA - vinosiimaiset

14.iv. STREPTOPHYTA - vinosiimaiset 14.iv. STREPTOPHYTA - vinosiimaiset KASVIEN PÄÄRYHMÄT 2016 CHLOROPHYTA STREPTOPHYTA Turmel, M. ym. 2002. Mol. Biol. Evol. 19:24-38 Lemieux, C. ym. 2000: Ancestral chloroplast genome in Mesostigma viride

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista

Lisätiedot

Perinnöllinen informaatio ja geneettinen koodi.

Perinnöllinen informaatio ja geneettinen koodi. Tehtävä A1 Kirjoita essee aiheesta: Perinnöllinen informaatio ja geneettinen koodi. Vastaa esseemuotoisesti, älä käytä ranskalaisia viivoja. Piirroksia voi käyttää. Vastauksessa luetaan ansioksi selkeä

Lisätiedot

ELAHEH MORADI ARABINOOSIPROMOOTTORIN TRANSKRIPTIODYNAMIIKKA KOLIBAKTEERISSA. Kandidaatintyö

ELAHEH MORADI ARABINOOSIPROMOOTTORIN TRANSKRIPTIODYNAMIIKKA KOLIBAKTEERISSA. Kandidaatintyö ELAHEH MORADI ARABINOOSIPROMOOTTORIN TRANSKRIPTIODYNAMIIKKA KOLIBAKTEERISSA Kandidaatintyö Tarkastaja: Lehtori Heikki Huttunen Ohjaajat: Andre S.Ribeiro, Jarno Mäkelä Jätetty tarkastettavaksi 16.12.2011

Lisätiedot