Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä

Save this PDF as:

Koko: px
Aloita esitys sivulta:

Download "Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä"


1 Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Vesihuoltopäivät , Jyväskylä Jenni Kesulahti Diplomityö Aalto-yliopistossa Hankkeessa mukana: Suomen Vesilaitosyhdistys ry (VVY) Helsingin seudun ympäristöpalvelut -kuntayhtymä (HSY) Hyvinkään Vesi Porvoon vesi Tampereen Vesi Turun seudun puhdistamo Oy Diplomityö valmistui helmikuussa

2 Tutkimuksen tausta Tausta Biologinen jätevedenpuhdistus perustuu mikrobien toimintaan prosessissa Perinteiset mikrobien tutkimusmenetelmät: mikroskopointi ja viljelytekniikat Molekyylibiologiset menetelmät: biologisten makromolekyylien (mm. DNA, RNA, proteiinit) tutkimus Kuva: J. Kesulahti 4 2

3 Tausta Bakteerit DNA 16S rrna -geeni alkuperä Arkit Eukaryootit Taksonominen taso Domeeni Pääjakso Luokka Lahko Heimo Suku Laji Esimerkki Bacteria (Bakteerit) Proteobacteria (Proteobakteerit) Gammaproteobacteria (Gammaproteobakteerit) Enterobacteriales Enterobacteriaceae Escherichia coli 5 Tutkimuksen tarkoitus 3

4 Tutkimuskysymyksiä Miten menetelmiä voidaan hyödyntää yhdyskuntien jätevedenpuhdistuksessa ja mitkä ovat suositukset puhdistamoille? Millaisia menetelmiä on olemassa mikrobipopulaatioiden määrittämiseen yhdyskuntajätevesistä? Erot näytteiden välillä? Yleisimmät bakteeriryhmät? Nitrifikaatiobakteerit? 7 Molekyylibiologisia tutkimusmenetelmiä Useita eri menetelmiä Mm. hybridisaatiomenetelmät, polymeraasiketjureaktiotekniikat, sormenjälkitekniikat, uuden sukupolven sekvensointitekniikat, transkriptomiikka, proteomiikka Diplomityön kokeellisessa osiossa käytetty menetelmä Eri menetelmillä voidaan vastata osittain erilaisiin tutkimuskysymyksiin Mitä mikrobeja ja millä osuuksilla? Kuinka paljon? Muutokset mikrobiyhdyskunnissa? Mikrobien toiminta? 8 4

5 Kokeellinen osio Näytteenotto Aktiivilietenäytteitä kerättiin viideltä jätevedenpuhdistamolta keväällä ja syksyllä 2016 HSY:n Viikinmäen puhdistamo Hyvinkään Kaltevan puhdistamo Porvoon Hermanninsaaren puhdistamo Tampereen Viinikanlahden puhdistamo Turun Kakolanmäen puhdistamo 10 5

6 Kokeellisen osion kulku Näytteiden keruu puhdistamoilta Esikäsittely Kuva: J. Kesulahti Kuva: J. Kesulahti Säilytys Tiedonkäsittely DNA:n eristys ja sekvensointi Tulokset 11 Kokeellisen osion tuloksia 6

7 Pääjaksot Proteobakteerit 13 Yleisimmät lahkot, kevään näytteet 14 7

8 Yleisimmät lahkot, syksyn näytteet 15 Nitrifikaatiobakteerit Ammoniumia hapettavat: Nitrosomonas, Nitrosovibrio, (Nitrosospira) Nitriittiä hapettavat: Nitrospira ja Candidatus Nitrotoga Näytteissä pääosin suhteellisen pienillä osuuksilla, useita mahdollisia selittäviä tekijöitä Tutkimus jatkuu Aalto-yliopistossa 16 8

9 Johtopäätöksiä Arvioita käytetystä tutkimusmenetelmästä Vahvuudet: runsaasti ja tarkempaa tietoa kuin perinteisillä mikrobien tutkimusmenetelmillä, tulosten analysoinnissa lukuisia mahdollisuuksia Heikkoudet: analyysin kesto, tietojen käsittelyn haasteet, ei tietoa esim. mikrobien aktiivisuudesta Mahdollisuudet: tekninen kehitys johtaa edelleen hintojen laskuun, tietokantojen ja tiedon jatkuva kertyminen Uhat: virhetulkinnat ja liian suorat johtopäätökset, ei synny standardeja Tämän hetken mahdollinen sovellustapa puhdistamoilla: ongelmanratkaisu 18 9

10 Molekyylibiologisten menetelmien sovellusmahdollisuuksia Lajistoselvitykset, mikrobien roolit ja vuorovaikutukset, suhde ympäristömuuttujiin ja prosessiparametreihin Nykyisten prosessiolosuhteiden optimointi Prosessissa olevien ongelmien ratkaisu Bioaugmentaatio Uusien prosessien kehittäminen 19 Kiitos! Jenni Kesulahti 10

Typenpoiston tehostaminen vesistön mikrobeilla

Typenpoiston tehostaminen vesistön mikrobeilla 2013-2017 Typenpoiston tehostaminen vesistön mikrobeilla Sanni Aalto 9.6.2016 Demonstraatiot 2014-16 Ulkopuoliset rahoittajat & Seurantaryhmä: MTK HS Vesi Metsähallitus Ympäristöministeriö Hämeen ELY Viron


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa

- Extra: PCR-alukkeiden suunnittelutehtävä haluttaessa Kertaus CHEM-C2300 0 Tällä luennolla: - Oletteko lukeneet artikkelia, käydäänkö läpi? - Ehdotuksia tenttikysymyksiin? - Käydään läpi kurssin keskeiset asiakokonaisuudet otsikkotasolla - Extra: PCR-alukkeiden


REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio Jyväskylän ympäristölaboratorio Eeronkatu 10 40720 JYVÄSKYLÄ Puh. 014 626650 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Mikrobit (homeet, hiivat, bakteerit ja aktinobakteerit) akkr


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


HSY Vesi Energiatehokkuus osana Helsingin seudun vesihuoltoa

HSY Vesi Energiatehokkuus osana Helsingin seudun vesihuoltoa HSY Vesi Energiatehokkuus osana Helsingin seudun vesihuoltoa Maailman vesipäivän seminaari 22.3.2010 Suomen Vesiyhdistys ry Jukka Piekkari toimialajohtaja HSY Vesi Jukka Piekkari, HSY Vesi 22.3.2010 1


Kohti energiaomavaraista jätevesilaitosta. Vesi ja vihreä talous - seminaari

Kohti energiaomavaraista jätevesilaitosta. Vesi ja vihreä talous - seminaari Kohti energiaomavaraista jätevesilaitosta Vesi ja vihreä talous - seminaari 11.9. 2013 1 Konsernirakenne 2013 Econet-konserni Econet Oy Econet Consulting Oy 100 % Oy Slamex Ab 100 % Dewaco Oy 100 % Econet


Jätevedet Elintavat vaikuttavat laatuun

Jätevedet Elintavat vaikuttavat laatuun Jätevedet Elintavat vaikuttavat laatuun Helsingin seudun ympäristöpalvelut kuntayhtymä HSY Jätevedenpuhdistus/HSY vesihuollon toimiala Jätevedenpuhdistus HSY:ssä 2 Jätevedenpuhd istus/hsy Jätevettä syntyy


Projekti-insinööri, DI Maija Renkonen 21.5.2015. Vesihuoltolaki (119/2001) uudistui 1.9.2014

Projekti-insinööri, DI Maija Renkonen 21.5.2015. Vesihuoltolaki (119/2001) uudistui 1.9.2014 Vesihuollon kehittäminen ja ohjaaminen -projekti Vesihuolto 2015 Projekti-insinööri, DI Maija Renkonen Projektin tausta Vesihuoltolaki (119/2001) uudistui 1.9.2014» Lain 5 :stä poistui velvollisuus laatia


KYT - Syväbiosfääritutkimukset. Malin Bomberg Teknologian tutkimuskeskus VTT

KYT - Syväbiosfääritutkimukset. Malin Bomberg Teknologian tutkimuskeskus VTT KYT - Syväbiosfääritutkimukset Malin Bomberg Teknologian tutkimuskeskus VTT 2 Mikrobien merkitys syväbiosfäärissä Mikrobiyhteisöt ovat hyvin monimuotoiset tuhansia lajeja Yleensä matala aineenvaihdunta,





Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi

Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Annika Rökman sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Oma taustani FM genetiikka 1998 sairaalageneetikko 2004 FT Perinnöllisestä eturauhassyövästä 2004 Finaksen teknisenä arvioijana vuodesta


Viikinmäen jätevedenpuhdistamon Energiantuotannon tehostaminen

Viikinmäen jätevedenpuhdistamon Energiantuotannon tehostaminen Viikinmäen jätevedenpuhdistamon Energiantuotannon tehostaminen Kaasumoottorikannan uusiminen ja ORC-hanke Helsingin seudun ympäristöpalvelut Riikka Korhonen Viikinmäen jätevedenpuhdistamo Otettiin käyttöön


Päätösmallin käyttö lietteenkäsittelymenetelmän valinnassa

Päätösmallin käyttö lietteenkäsittelymenetelmän valinnassa Päätösmallin käyttö lietteenkäsittelymenetelmän valinnassa Diplomityön esittely Ville Turunen Aalto yliopisto Hankkeen taustaa Diplomityö Vesi- ja ympäristötekniikan laitokselta Aalto yliopistosta Mukana


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio Ramboll Finland Oy Ramboll Analytics Niemenkatu 73 15140 LAHTI Puh. 0403567895 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Haihtuvat orgaaniset yhdisteet (VOC), aktiivikeräys akkr ISO


REKISTERIOTE Hyväksytyt laboratoriot. Valvontaosasto Valvonnan kehittämisyksikkö. Länsi-Uudenmaan vesi ja ympäristö ry, Vesi- ja elintarvikelaboratori

REKISTERIOTE Hyväksytyt laboratoriot. Valvontaosasto Valvonnan kehittämisyksikkö. Länsi-Uudenmaan vesi ja ympäristö ry, Vesi- ja elintarvikelaboratori Länsi-Uudenmaan vesi ja ympäristö ry, Vesi- ja elintarvikelaboratori PL 51 (Tehtaankatu 26) 08100 Lohja EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Aerobiset mikro-organismit NMKL 86:1999 Enterobacteriaceae


Vesijohtoverkostosta ja -laitteista talousveteen liukenevat metallit

Vesijohtoverkostosta ja -laitteista talousveteen liukenevat metallit 1.5.217 Vesijohtoverkostosta ja -laitteista talousveteen liukenevat metallit Vesihuoltopäivät Jyväskylä 1.5.217 8.5.217 Page 1 Hankkeen tausta Juomavesidirektiivin muutos (liite II D) Talousveden valvontanäytteet





Biokaasua Espoon Suomenojalta

Biokaasua Espoon Suomenojalta Biokaasua Espoon Suomenojalta Suomen Kaasuyhdistyksen syyskokous 8.11.2012 Tommi Fred, vs. toimialajohtaja 8.11.2012 1 HSY ympäristötekoja toimivan arjen puolesta Helsingin seudun ympäristöpalvelut -kuntayhtymä


Helsingin kaupunki Pöytäkirja 14/ (6) Kaupunginhallitus Kj/

Helsingin kaupunki Pöytäkirja 14/ (6) Kaupunginhallitus Kj/ Helsingin kaupunki Pöytäkirja 14/2013 1 (6) 392 Lausunto seudullisesta vesihuollon kehittämissuunnitelmaluonnoksesta 2013 2022 ja HSY:n vesihuollon toiminta-alueluonnoksesta 2014 HEL 2013-003207 T 14 04





VESIHUOLTO päivät Jyväskylässä Jyväskylän Paviljonki, Lutakonaukio 12

VESIHUOLTO päivät Jyväskylässä Jyväskylän Paviljonki, Lutakonaukio 12 VESIHUOLTO 2017 -päivät Jyväskylässä 10. - 11.5.2017 Jyväskylän Paviljonki, Lutakonaukio 12 Keskiviikko 10.5.2017 Wilhelm -sali Aamupäivä Puheenjohtaja: apulaisjohtaja Mika Rontu, Vesilaitosyhdistys 09.00


Selvitys Viikinmäen jätevedenpuhdistamon valmiudesta vastaanottaa Mäntsälän jätevedet

Selvitys Viikinmäen jätevedenpuhdistamon valmiudesta vastaanottaa Mäntsälän jätevedet Selvitys Viikinmäen jätevedenpuhdistamon valmiudesta vastaanottaa Mäntsälän jätevedet Helsingin seudun ympäristöpalvelut -kuntayhtymä Opastinsilta 6 A 00520 Helsinki puhelin 09 156 11 faksi 09 1561 2011


Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa

Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Maria Valkonen, Kaisa Jalkanen, Martin Täubel, Anne Hyvärinen 31.3.2014 Sisäilmastoseminaari 2014 1 Tausta Asumisterveysoppaan mukaiset sisäympäristön


REKISTERIOTE Hyväksytty tai rekisteröity laboratorio. Kymen Ympäristölaboratorio Oy. Patosillantie KUUSANKOSKI Puh.

REKISTERIOTE Hyväksytty tai rekisteröity laboratorio. Kymen Ympäristölaboratorio Oy. Patosillantie KUUSANKOSKI Puh. 1 Kymen Ympäristö Oy Patosillantie 2 45700 KUUSANKOSKI Puh. 05 5443300 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Aerobiset mikro-organismit 30 C akkr NMKL 86:2013 Anaerobiset sulfiittia pelkistävät


Kiekkosuodatuksen koeajot Viikinmäen jätevedenpuhdistamolla

Kiekkosuodatuksen koeajot Viikinmäen jätevedenpuhdistamolla Kiekkosuodatuksen koeajot Viikinmäen jätevedenpuhdistamolla Tavoitteena käsitellyn jäteveden fosforipitoisuus < 0,1 mg(p)/l Kiekkosuodatuskoeajot Koeajojen tavoitetuloksen


Keräinnäytteen tutkiminen arv STM:n Asumisterveysohje 2003 ja Asumisterveysopas 2008

Keräinnäytteen tutkiminen arv STM:n Asumisterveysohje 2003 ja Asumisterveysopas 2008 Jyväskylän kaupunki, Ympäristötoimen laboratorio Eeronkatu 10 40720 Jyväskylä EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Keräinnäytteen tutkiminen arv STM:n Asumisterveysohje 2003 ja


Espoon kaupunki Pöytäkirja 107. Ympäristölautakunta Sivu 1 / Suomenojan ja Viikinmäen jätevedenpuhdistamoiden toiminta vuonna 2015

Espoon kaupunki Pöytäkirja 107. Ympäristölautakunta Sivu 1 / Suomenojan ja Viikinmäen jätevedenpuhdistamoiden toiminta vuonna 2015 Ympäristölautakunta 08.12.2016 Sivu 1 / 1 77/2013 11.01.03 107 Suomenojan ja Viikinmäen jätevedenpuhdistamoiden toiminta vuonna 2015 Valmistelijat / lisätiedot: Ilppo Kajaste, puh. 043 826 5220


REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio 1 Ramboll Finland Oy Ramboll Analytics Niemenkatu 73 15140 LAHTI Puh. 0403567895 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Formaldehydi akkr STM:n Asumisterveysohje (2003:1), Asumisterveysopas


Puhdistus ja desinfiointi Hygio-otsonointilaitteella

Puhdistus ja desinfiointi Hygio-otsonointilaitteella 26.05.2015 Puhdistus ja desinfiointi Hygio-otsonointilaitteella 1. Hygio-laitteen käyttötarkoitus terveydenhuollossa Hygio a40 on tarkoitettu tekstiilien, kenkien ja tavaroiden puhdistamiseen ja desinfiointiin.


Jäteveden denitrifikaation lisääminen ja vesistöhaittojen vähentäminen sedimenttidiffuusorin avulla

Jäteveden denitrifikaation lisääminen ja vesistöhaittojen vähentäminen sedimenttidiffuusorin avulla LIFE12 ENV/FI/597 2013-2017 Jäteveden denitrifikaation lisääminen ja vesistöhaittojen vähentäminen sedimenttidiffuusorin avulla Marja Tiirola Limnologipäivät 10.4.2017 N-SINK o Reduction of waste water


Pvm/Datum/Date akkr ISO Sisäilmanäyte. akkr ISO Sisäilmanäyte

Pvm/Datum/Date akkr ISO Sisäilmanäyte. akkr ISO Sisäilmanäyte 1 Eurofins Environment Testing Finland Oy Niemenkatu 73 15140 LAHTI Puh. 0403567895 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Formaldehydi akkr STM:n Asumisterveysohje (2003:1), Asumisterveysopas


Sieni-itiöt, materiaalit arv Asumisterveysohje 2003 ja Asumisterveysopas 2009

Sieni-itiöt, materiaalit arv Asumisterveysohje 2003 ja Asumisterveysopas 2009 Rauman kaupunki, Ympäristölaboratorio PL 238 26101 Rauma EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveys Sieni-itiöt, materiaalit arv Asumisterveysohje 2003 ja Asumisterveysopas 2009 Sieni-itiöt, pintanäytteet








REKISTERIOTE Hyväksytyt laboratoriot. Valvontaosasto Valvonnan kehittämisyksikkö

REKISTERIOTE Hyväksytyt laboratoriot. Valvontaosasto Valvonnan kehittämisyksikkö 23.8.2010 6842/961/2006 Savo-Karjalan ympäristötutkimus Oy, Kuopio Elintarvikeyksikkö Yrittäjäntie 24 70150 KUOPIO EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Aerobiset mikro-organismit akkr ISO



NITRIFIKAATIOBAKTEERIEN TOIMINTA NITRIFIKAATIOBAKTEERIEN TOIMINTA 1(6) Ville Kivisalmi Typen kiertoon maa- ja vesiekosysteemeissä osallistuvat bakteerit ovat pääasiassa autotrofeja kemolitotrofeja, jotka saavat energiansa epäorgaanisten


Biokaasun liikennekäyttö Keski- Suomessa. Juha Luostarinen Metener Oy

Biokaasun liikennekäyttö Keski- Suomessa. Juha Luostarinen Metener Oy Biokaasun liikennekäyttö Keski- Suomessa Juha Luostarinen Metener Oy Tausta Biokaasulaitos Kalmarin tilalle vuonna 1998 Rakentamispäätöksen taustalla navetan lietelannan hygieenisen laadun parantaminen


REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio Savo-Karjalan Ympäristötutkimus Oy Joensuun laboratorio Jokikatu 8 80220 JOENSUU Puh. 017 2647200 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Mikrobit (homeet, hiivat, ja aktino), pitoisuus


Kaikki alkaa puhtaasta vedestä Helsingin seudun ympäristöpalvelut

Kaikki alkaa puhtaasta vedestä Helsingin seudun ympäristöpalvelut Kaikki alkaa puhtaasta vedestä Helsingin seudun ympäristöpalvelut 2 3 On lottovoitto juoda suomalaista. Maapallon vedestä yli 97 prosenttia on suolapitoista. Ja kun kolmesta prosentista vähennetään lumen


HSY:n kokemuksia EIB- ja NIB -rahoituksesta infrahankkeissa

HSY:n kokemuksia EIB- ja NIB -rahoituksesta infrahankkeissa HSY:n kokemuksia EIB- ja NIB -rahoituksesta infrahankkeissa EFSI seminaari 17.9.2015 Raimo Inkinen, toimitusjohtaja 17.9.2015 HSY:n investointihankkeista HSY:llä on suuri investointitarve erityisesti


TESTAUSSELOSTE J ^Talousvesitutkimus

TESTAUSSELOSTE J ^Talousvesitutkimus 1 (4) Liperin kunta, tekninen osasto Riikonen Kari Keskustie 10 83100 LIPERI Tilausnro 219952 (4774J/VALVVIIN), saapunut 3.5.2017, näytteet otettu 3.5.2017 Näytteenottaja: Väisänen


Syvien biosfäärien geomikrobiologia - Molekyylibiologiset monitorointimenetelmät, GEOMOL

Syvien biosfäärien geomikrobiologia - Molekyylibiologiset monitorointimenetelmät, GEOMOL Syvien biosfäärien geomikrobiologia - Molekyylibiologiset monitorointimenetelmät, GEOMOL KYT seminaari 26.9.2008 Merja Itävaara Projektin tausta Miksi geomikrobiologiaa tutkitaan? Loppusijoitusalueen hydrogeokemiallinen



1.1 MIKROBIT ELINTARVIKKEISTA Kainuun elintarvike- ja ympäristölaboratorio 1. ELINTARVIKKEET Hinta alv 0 % Hinta alv. 24 % 1.1 MIKROBIT ELINTARVIKKEISTA Bacillus cereus 16,58 20,56 Campylobacter spp. 38,53 47,78 Clostridium perfringens


Mikrobiologisen veden laadun online-seuranta

Mikrobiologisen veden laadun online-seuranta Mikrobiologisen veden laadun online-seuranta Anna-Maria Hokajärvi ja Tarja Pitkänen Terveyden ja hyvinvoinnin laitos, Vesi- ja terveys-yksikkö 25.4.2013 25.4.2013 Anna-Maria Hokajärvi 1 Veden laadun hallinta


Bi3 Ympäristöekologia Mika Sipura

Bi3 Ympäristöekologia Mika Sipura Bi3 Ympäristöekologia Mika Sipura Kurssin sisältö 1. Luonnon monimuotoisuus ja sen säilyttäminen (kirjan sivut 6-40) 2. Ekologiset ympäristöongelmat (s. 41-67) Bi3-kurssilla tehdään mahdollisuuksien mukaan


Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa

Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa 1 Sisältö - Sisäympäristön laatu kouluissa - Tutkimuksen taustaa - Siivouksen arviointiin liittyvien


Espoon kaupunki Pöytäkirja 75

Espoon kaupunki Pöytäkirja 75 08.12.2014 Sivu 1 / 1 1857/00.04.01/2014 75 Helsingin seudun ympäristöpalvelut -kuntayhtymän (HSY) ylimääräinen yhtymäkokous 19.12.2014 kokousedustajan määrääminen ja toimiohjeen antaminen Valmistelijat


Viemäröinti ja jätevedenpuhdistus Anna Mikola TkT D Sc (Tech)

Viemäröinti ja jätevedenpuhdistus Anna Mikola TkT D Sc (Tech) Viemäröinti ja jätevedenpuhdistus Anna Mikola TkT D Sc (Tech) Kytkeytyminen oppimistavoitteisiin Pystyy kuvailemaan yhdyskuntien vesi- ja jätehuollon kokonaisuuden sekä niiden järjestämisen perusperiaatteet


TESTAUSSELOSTE Talousvesitutkimus 26.5.2016

TESTAUSSELOSTE Talousvesitutkimus 26.5.2016 TESTAUSSELOSTE 1 (4) Paraisten kaupunki Vesihuoltolaitos Rantatie 28 21600 PARAINEN Tilausnro 190664 (WPAR/V3), saapunut 10.5.2016, näytteet otettu 10.5.2016 (08:30) Näytteenottaja: M. Laaksonen NÄYTTEET


Jätevesien hygienisoinnin menetelmät

Jätevesien hygienisoinnin menetelmät Jätevesien hygienisoinnin menetelmät Jätevedet ja hygienia 14.1.2010 Ari Niemelä 14.1.2010 / ANi Hygienisoinnin tavoitteet Käsitellyn jäteveden mikrobit (Tekes, Vesihuolto 2001): fekaaliset koliformit:


REKISTERIOTE Hyväksytty tai rekisteröity laboratorio. Hallinto-osasto Suunnittelu- ja ohjausyksikkö. Eurofins Scientific Finland Oy, Kokkola

REKISTERIOTE Hyväksytty tai rekisteröity laboratorio. Hallinto-osasto Suunnittelu- ja ohjausyksikkö. Eurofins Scientific Finland Oy, Kokkola Eurofins Scientific Finland Oy, Kokkola PL 1100 (Kemirantie 1) 67101 KOKKOLA Puh. 0447819001 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Aerobiset mikro-organismit akkr NMKL 86:2013 Anaerobiset





Kurssin suorittaminen

Kurssin suorittaminen Kurssin suorittaminen - Oppikirja: Kokkonen ym.: Lukion biologia, eliömaailma. Otava, 2010 (tai uudempi). Kurssi koostuu kolmesta osasta: 1. Kurssikoe (18 pistettä): 1. Kaikille pakollinen käsitteenmäärittelytehtävä.


Tausta tutkimukselle

Tausta tutkimukselle Näin on aina tehty Näyttöön perustuvan toiminnan nykytilanne hoitotyöntekijöiden toiminnassa Vaasan keskussairaalassa Eeva Pohjanniemi ja Kirsi Vaaranmaa 1 Tausta tutkimukselle Suomessa on aktiivisesti


Laajakirjoisia beetalaktamaaseja tuottavat bakteerit ja MRSA - Uudet ilmoitettavat eläintaudit

Laajakirjoisia beetalaktamaaseja tuottavat bakteerit ja MRSA - Uudet ilmoitettavat eläintaudit Laajakirjoisia beetalaktamaaseja tuottavat bakteerit ja MRSA - Uudet ilmoitettavat eläintaudit Erikoistutkija Suvi Nykäsenoja Jaostopäällikkö Antibioottijaosto Elintarvike- ja rehumikrobiologian tutkimusyksikkö


Pizzatäyteprojekti 2014

Pizzatäyteprojekti 2014 Sastamalan seudun sosiaali- ja terveyspalvelut Ympäristöterveydenhuolto 7.8.2014 AP Pizzatäyteprojekti 2014 Pizzatäytteenä käytettävien kinkun ja katkaravun laatu Sotesin alueella kesällä 2014 Sastamala,


REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio 1 Oulun kaupungin elintarvike- ja ympäristölaboratorio Oy PL 19 90015 Oulun kaupunki Puh. 044 7036740 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Mikrobit (homeet, hiivat, bakteerit


TESTAUSSELOSTE J ^Talousvesitutkimus

TESTAUSSELOSTE J ^Talousvesitutkimus 1 (5) Liperin kunta, tekninen osasto Riikonen Kari Keskustie 10 83100 LIPERI Tilausnro 219962 (4774J/VALVLIYL), saapunut 3.5.2017, näytteet otettu 3.5.2017 Näytteenottaja: Väisänen





METROPOLI JA VESI toimitusjohtaja Raimo Inkinen 17.3.2011 1

METROPOLI JA VESI toimitusjohtaja Raimo Inkinen 17.3.2011 1 METROPOLI JA VESI 1 Helsingin seudun toimintaympäristö 14 kuntaa, ylikunnalliset organisaatiot 1.3 miljoonaa asukasta Liikenne ja ympäristöpalvelut kaupunkiseudulla: HSY 4 kaupunkia,vesi- ja jätehuolto,


LIITE 1. REKISTERIOTE Hyväksytty laboratorio

LIITE 1. REKISTERIOTE Hyväksytty laboratorio Riihimäen seudun terveyskeskuksen ky Elintarvike- ja vesilaboratorio Kallionkatu 10-16 C 11100 Riihimäki EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Aerobiset mikro-organismit akkr NMKL 86:2006


MetropoliLab Oy (perustettu ) Helsingin tytäryhtiö, muut omistajat Espoo, Vantaa ja Kauniainen Helsingin Viikin tiedeyhteisön kampusalueella

MetropoliLab Oy (perustettu ) Helsingin tytäryhtiö, muut omistajat Espoo, Vantaa ja Kauniainen Helsingin Viikin tiedeyhteisön kampusalueella MetropoliLab Oy (perustettu 1.6.2010) Helsingin tytäryhtiö, muut omistajat Espoo, Vantaa ja Kauniainen Helsingin Viikin tiedeyhteisön kampusalueella Helsingin laboratorio perustettu 1884 MetropoliLab Oy


Miksi Älykästä Vettä. Resurssiviisas Pääkaupunkiseutu Toimialajohtaja Jukka Piekkari

Miksi Älykästä Vettä. Resurssiviisas Pääkaupunkiseutu Toimialajohtaja Jukka Piekkari Miksi Älykästä Vettä Resurssiviisas Pääkaupunkiseutu 12.5.2015 Toimialajohtaja Jukka Piekkari HSY:n vesihuolto pähkinänkuoressa HSY: Vesihuolto, jätehuolto, seutu- ja ympäristötieto Vesihuolto: veden puhdistus





Opettaja: Mika Sipura

Opettaja: Mika Sipura Opettaja: Mika Sipura Kurssin suorittaminen - Oppikirja: Idänpirtti ym.: Bi1. Elämä ja evoluutio. Otava. 2016 Kurssiarvosana koostuu kolmesta osasta: 1. 2 osakoetta (18 + 18 pistettä): 1. Kaikille pakollinen


DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen

DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen DNA-testit sukututkimuksessa 28.11.2017 Keravan kirjasto Paula Päivinen Solu tuma kromosomit 23 paria DNA Tumassa olevat kromosomit periytyvät jälkeläisille puoliksi isältä ja äidiltä Y-kromosomi periytyy


Perhearviointi. Perheen voimavarojen, vahvuuksien ja vaikeuksien arviointimenetelmä

Perhearviointi. Perheen voimavarojen, vahvuuksien ja vaikeuksien arviointimenetelmä Perheen voimavarojen, vahvuuksien ja vaikeuksien arviointimenetelmä 31.10.2017 Suomen Mielenterveysseuran Koulutuskeskus Marjukka Laukkanen, Psykoterapeutti VET 1 Perheen toimintamalli Perhejärjestelmän


TASKILAN PUHDISTAMON SANEERAUS - jätevesien käsittely keskittyy Ouluun

TASKILAN PUHDISTAMON SANEERAUS - jätevesien käsittely keskittyy Ouluun TASKILAN PUHDISTAMON SANEERAUS - jätevesien käsittely keskittyy Ouluun Pohjois-Suomen vesihuoltopäivät 19. 20.11.2014 Oulu Jarmo Lahtinen käyttöpäällikkö Oulun Vesi TASKILAN PUHDISTAMO Puhdistamo on aloittanut


Pvm/Datum/Date Aerobiset mikro-organismit akkr ISO :2013 Myös rohdosvalmisteet ja ravintolisät. Sisäinen menetelmä, OES

Pvm/Datum/Date Aerobiset mikro-organismit akkr ISO :2013 Myös rohdosvalmisteet ja ravintolisät. Sisäinen menetelmä, OES 1 Novalab Oy, Kemian ja mikrobiologian osastot Lepolantie 9 03600 KARKKILA Puh. 09 2252860 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Aerobiset mikro-organismit akkr ISO 4833-1:2013 Myös rohdosvalmisteet


Helsingin kaupunki Esityslista 8/ (7) Ympäristölautakunta Yj/

Helsingin kaupunki Esityslista 8/ (7) Ympäristölautakunta Yj/ Helsingin kaupunki Esityslista 8/2013 1 (7) 2 Ilmoitusasiat Päätösehdotus Tiivistelmä Kaupunginhallituksen kokous 25.3.2013 1. 325 V Strategiaohjelma vuosiksi 2013-2016 päättänee merkitä tiedoksi kohdat


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset


Jätevesilietteistä multaa ravinteiden kierrätyksen mahdollisuudet. Mikko Wäänänen, HSY Vesihuolto

Jätevesilietteistä multaa ravinteiden kierrätyksen mahdollisuudet. Mikko Wäänänen, HSY Vesihuolto Jätevesilietteistä multaa ravinteiden kierrätyksen mahdollisuudet Mikko Wäänänen, HSY Vesihuolto 25.11.2014 Teollisuusjätevesien tarkkailu ja neuvonta Jätevedenpuhdistusosasto Jätevedenpuhdistus Lietteiden


Prosessimetallurgian opintosuunta

Prosessimetallurgian opintosuunta Opintosuuntainfo Perjantai 27.1.2017, PR102 1 prosessi- ja ympäristötekniikan koulutusohjelmissa Osaamistavoitteet - Tutkimus- ja kehitystehtävissä tarvittava menetelmällinen osaaminen - Kokeellinen tutkimus


Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö

Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ituepidemia ja VTEC -tutkimukset elintarvikkeista Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ajankohtaista laboratoriorintamalla / 12.10.2011 EHEC-ITUEPIDEMIAN VAIHEITA: Vahva signaali epidemiasta



ENERGIATEHOKAS VESIHUOLTO ENERGIATEHOKAS VESIHUOLTO MAAILMAN VESIPÄIVÄN SEMINAARI 19.3.2014 20.3.2014 HSY strategia 2020 Hallitus 28.2.2014 Visio 2020 Strategiset päämäärät (vaikutukset) Mahdollistajat Vastuulliset, tehokkaat ja


REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio 1 Kokemäenjoen vesistön vesiensuojeluyhdistys ry, Tampere PL 265 (Patamäenkatu 24) 33101 Tampere Puh. 03 2461111 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Elohopea akkr Sisäinen menetelmä KVVY


TUTKIMUSRAPORTTI Luokat 202, 207 ja 208

TUTKIMUSRAPORTTI Luokat 202, 207 ja 208 TUTKIMUSRAPORTTI Luokat 202, 207 ja 208 Kotkan lyseo, Arcus-talo Kirkkokatu 15 48100 KOTKA Työ nro T8007-5 Kotka 5.4.2016 Oy Insinööri Studio OY INSINÖÖRI STUDIO, TORNATORINTIE 3, PL 25, 48101 KOTKA, PUH.






GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


Maaperän biologinen monimuotoisuus Tuhannet tuntemattomat jalkojemme alla

Maaperän biologinen monimuotoisuus Tuhannet tuntemattomat jalkojemme alla Maaperän biologinen monimuotoisuus Tuhannet tuntemattomat jalkojemme alla Jari Haimi Bio- ja ympäristötieteiden laitos Jyväskylän yliopisto 24.11.2015 Maaperän monimuotoisuus 2 Maaperässä elää ja vaikuttaa


VESIHUOLTOLAITOSTEN KRIITTISTEN ASIAKKAIDEN KARTOITUS JA HUOMIOIMINEN DI Ulla Koivisto 20.5.2015. Johdanto Kriittiset asiakkaat ja asiakastietokortit

VESIHUOLTOLAITOSTEN KRIITTISTEN ASIAKKAIDEN KARTOITUS JA HUOMIOIMINEN DI Ulla Koivisto 20.5.2015. Johdanto Kriittiset asiakkaat ja asiakastietokortit VESIHUOLTOLAITOSTEN KRIITTISTEN ASIAKKAIDEN KARTOITUS JA HUOMIOIMINEN DI Ulla Koivisto ESITYKSEN SISÄLTÖ Johdanto Kriittiset asiakkaat ja asiakastietokortit Kriittisten asiakkaiden kartoittaminen ja luokittelu


SeutuRuutu & SeutuCD - paikkatietoa pk-seudulta. Mikko Nikkanen Paikkatietoasiantuntija HSY

SeutuRuutu & SeutuCD - paikkatietoa pk-seudulta. Mikko Nikkanen Paikkatietoasiantuntija HSY SeutuRuutu & SeutuCD - paikkatietoa pk-seudulta Mikko Nikkanen Paikkatietoasiantuntija HSY 16.11.2017 Mikä SeutuRuutu? Miksi SeutuRuutu? Kuka käyttää SeutuRuutua? Miten se toimii? Mistä data tulee? Mitä


TESTAUSSELOSTE Talousvesitutkimus 19.4.2016

TESTAUSSELOSTE Talousvesitutkimus 19.4.2016 TESTAUSSELOSTE Talousvesitutkimus 19.4.2016 16-2170 #1 1 (4) Uudenkaupungin kaupunki Uudenkaupungin Vesi PL 20 23501 UUSIKAUPUNKI Tilausnro 189593 (WUKI/N1), saapunut 5.4.2016, näytteet otettu 5.4.2016


Mädätys HSY:n jätevedenpuhdistamoilla. Mädätyksen rakenne- ja laitetekniikka seminaari 15.10.2013

Mädätys HSY:n jätevedenpuhdistamoilla. Mädätyksen rakenne- ja laitetekniikka seminaari 15.10.2013 Mädätys HSY:n jätevedenpuhdistamoilla Mädätyksen rakenne- ja laitetekniikka seminaari 15.10.2013 HSY - Helsingin seudun ympäristöpalvelut kuntayhtymä HSY tuottaa jäte- ja vesihuoltopalveluita yli miljoonalle


Typenja fosforintalteenotto

Typenja fosforintalteenotto Typenja fosforintalteenotto jätevesistä - rejekti Surendra Pradhan Riku Vahala Anna Mikola Juho Kaljunen 29.03.2017 Sisällys Typen talteenoton tarpeellisuus NPHarvest-projekti lyhyesti Laboratoriotestien


Hygienisoinnin määritelmä

Hygienisoinnin määritelmä Alueellinen vesihuoltopäivä, Kouvola 19.3.2015 Jätevesien hygienisointi Saijariina Toivikko 12.3.2015 1 Saijariina Toivikko Hygienisoinnin määritelmä Hygienisointi = Jäteveden ja lietteen patogeenien määrän


TESTAUSSELOSTE Talousvesitutkimus 31.5.2016

TESTAUSSELOSTE Talousvesitutkimus 31.5.2016 TESTAUSSELOSTE Talousvesitutkimus 31.5.2016 16-3220 #1 1 (4) Vehmaan kunta Vesilaitos Saarikontie 8 23200 VINKKILÄ Tilausnro 190647 (WVEHMAA/P1), saapunut 10.5.2016, näytteet otettu 10.5.2016 (11:15) Näytteenottaja:


Analyysi Menetelmä Yksikkö 32057-1 Verkostovesi Pattasten koulu. * SFS-EN ISO pmy/ml 1 Est. 7,5 Sähkönjohtavuus, 25 C * SFS-EN 10523:2012

Analyysi Menetelmä Yksikkö 32057-1 Verkostovesi Pattasten koulu. * SFS-EN ISO pmy/ml 1 Est. 7,5 Sähkönjohtavuus, 25 C * SFS-EN 10523:2012 1 Tutkimustodistus 214-3257 1(4) Raahen Vesi Oy Marintie 1 9214 Pattijoki Näytetiedot Näyte Verkostovesi Näyte otettu 25.8.214 Näytteen ottaja Jukka Ollikkala Saapunut 26.8.214 Näytteenoton syy Jaksottainen


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


Vastaanottaja Ramboll Finland Niko Rissanen Asiakirjatyyppi Nitrifikaation ja hapenkulutuksen inhibitio - Tutkimusraportti Päivämäärä 22.2.2016 Viite 1510025001 KUUSAKOSKI OY RAJAVUOREN KAATO- PAIKKAVEDEN


Asumisterveys ja rakentaminen KK-diplomi 60 op HUOM! Muutokset voivat olla mahdollisia!

Asumisterveys ja rakentaminen KK-diplomi 60 op HUOM! Muutokset voivat olla mahdollisia! Asumisterveys ja rakentaminen KK-diplomi 60 op 22.1.2018-31.5.2019 1. Talonrakennus ja korjausrakentaminen 20 op Kouvola 22.1.-31.7.2018 22.1.2018 klo 10.00 16.00: Orientaatio moduuliin ja kk-diplomiin


REKISTERIOTE Hyväksytty tai rekisteröity laboratorio. Hallinto-osasto Suunnittelu- ja ohjausyksikkö

REKISTERIOTE Hyväksytty tai rekisteröity laboratorio. Hallinto-osasto Suunnittelu- ja ohjausyksikkö 1 Kokemäenjoen vesistön vesiensuojeluyhdistys ry, Porilab Tiedepuisto 4, A-rakennus 28600 PORI Puh. 0447013343 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Aerobiset mikro-organismit ISO 4833-1:2013


Ilmastuksen energiankulutuksen ja typenpoiston optimointi Turun Kakolanmäen jätevedenpuhdistamolla

Ilmastuksen energiankulutuksen ja typenpoiston optimointi Turun Kakolanmäen jätevedenpuhdistamolla Ilmastuksen energiankulutuksen ja typenpoiston optimointi Turun Kakolanmäen jätevedenpuhdistamolla Envieno, Turun seudun puhdistamo Oy, Esa Malmikare Jouko Tuomi Vesihuolto 2015 KAKOLANMÄEN JÄTEVEDENPUHDISTAMO



TESTAUSSELOSTE Vesi. Maksaja PL LASKUT O MetropoliLab TESTAUSSELOSTE 2011-7660 Vesi 1(2) 06.07.2011 Tilaaja 0988874-7 Puolustushallinnon rakennuslaitos Keskusyksikkö PL 1 49401 HAMINA Näytetiedot Näyte Näyte otettu Vastaanotettu Tutkimus alkoi





REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio Savo-Karjalan Ympäristötutkimus Oy, elintarvikkeet Kuopion laboratorio Yrittäjäntie 24 70150 KUOPIO EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Aerobiset mikro-organismit akkr ISO 4833:2003 Anaerobiset


(Jatkotutkinto-opiskelija, Helsingin yliopisto: eläinlääketieteen tohtorin tutkinto 2.6.2007 )

(Jatkotutkinto-opiskelija, Helsingin yliopisto: eläinlääketieteen tohtorin tutkinto 2.6.2007 ) CURRICULUM VITAE Opetustehtävät Tuija Kantala, yliopisto-opettaja (sijainen), jatkotutkinto-opiskelija KOULUTUS Eläinlääketieteen lisensiaatti, Helsingin yliopisto, 2006 (Jatkotutkinto-opiskelija, Helsingin
