Ihmisten erilaisuuden geneettinen perusta

Koko: px
Aloita esitys sivulta:

Download "Ihmisten erilaisuuden geneettinen perusta"


1 hmisten erilaisuuden geneettinen perusta etter ortin hmisen genomin tutkimus on astunut uuteen vaiheeseen kun on alettu tutkia ihmisen geneettisen monimuotoisuuden määrää ja laatua. seita tätä tutkimushanketta koskevia artikkeleita ilmestyi Nature-lehdessä viime lokakuussa [1]. Myös nnual Review of Genomics and uman Genetics -aikakauskirjassa on äskettäin ilmestynyt aiheesta laaja kokoomaartikkeli (Crawford ym. 2005). seista henkilöistä tehtyjen genomin analyysien perusteella on käynyt mahdolliseksi myös luonnonvalinnan osuuden tutkiminen ihmisen evoluutiossa (Bustamante ym. 2005). Geneettinen polymorfismi eli monimuotoisuus tarkoittaa sitä, että populaatiossa esiintyy säännöllisesti ja samanaikaisesti kaksi tai useampia toisistaan selvästi erottuvia periytyviä variantteja tai genotyyppejä eli morfeja niin runsaasti, että sitä ei voida harvinaisimmankaan morfin tapauksessa selittää yksin toistuvista mutaatioista eli mutaatiopaineesta johtuvaksi. Käytännössä polymorfismista puhutaan kun harvinaisimmankin morfin suhteellinen runsaus on yli yksi prosentti. Luonnossa kaikki populaatiot ovat polymorfisia ja polymorfismin määrä on suuri. Kun on tutkittu monisoluisten eläinten polymorfismia proteiinien tasolla, on havaittu, että yleensä kaikilla eläimillä, ihminen mukaan luettuna, noin yksi kolmasosa proteiineja koodaavista geeneistä on polymorfisia. DN-tasolla polymorfismi on vieläkin laajempaa. ri eläimillä DN: n polymorfismin määrä vaihtelee suunnilleen sellaisissa rajoissa, että noin joka sadas tai joka tuhannes nukleotidipari DN:ssa on monimuotoinen. ällöin puhutaan yhden nukleotidin polymorfismeista eli ns. snipeistä (engl. N = single nucleotide polymorphism). Yhden nukleotidin polymorfismit ovat aina kaksialleelisia, koska DN:n nukleotidipareilla on vain kaksi mahdollista tilaa. ari on joko adeniinin () ja tymiinin () tai sitten guaniinin (G) ja sytosiinin (C) muodostama. Yhden nukleotidin polymorfismien analysointi antaa tarkimman mahdollisen geneettisen polymorfismin määrän mitan. ällä hetkellä meillä on jo varsin hyvä käsitys näiden snippien lukumäärästä ihmisen genomissa. hmisen genomi koostuu 3,2 miljardista nukleotidiparista. frikkalaiset populaatiot muuntelevampia kuin eurooppalaiset Naturessa julkaistussa tutkimuksessa selvitettiin neljästä Maapallon eri puolilla asustavasta ihmispopulaatiosta kaikkiaan 269 yksilön genotyypit siinä laajuudessa, että pystyttiin havaitsemaan vähintään yksi snippi jokaista nukleotidiparin jaksoa kohti. Lisäksi kaikista yksilöistä analysoitiin kymmenen nukleotidiparia käsittävää DN-jaksoa kokonaan (Cheung ym. 2005). hmisen yhden nukleotidin polymorfismien kokonaismääräksi havaittiin yli 10 miljoonaa niin tässä kuin 137 eri etnistä alkuperää olevaa yhdysvaltalaista ihmistä koskevassa tutkimuksessa (Crawford ym. 2005). ämä merkitsee sitä, että verrattaessa ketä tahansa kahta ihmistä, he poikkeavat toisistaan miljoonien nukleotidiparien osalta. utkimuksissa (he nternational apmap Consortium 2005) on havaittu, että ihmisen genomissa keskimäärin joka 279. nukleotidipari on polymorfinen. ämän perusteella laskemalla saataisiin ihmisen snippien kokonaismääräksi 11,47 miljoonaa. ästä taas voidaan laskea, että Mendelin lakien mukaan ihmisen kaikkien mahdollisten genotyyppien teoreettinen kokonaismäärä olisi huikeat kolme potenssiin 11,47 miljoonaa. Kymmenen potensseina tämä on kymmenen potens- 23 Ä 3/2006

2 Ä 24 siin 5,47 miljoonaa. ämä on niin suuri luku, että jos yhden nollan kirjoittamiseen menee tilaa yksi millimetri, seuraa ykköstä 5,47 kilometriä pitkä jono nollia. uppeammassa tutkimuksessa (Crawford ym. 2005) tultiin vieläkin suurempaan polymorfismin määrään. rvioitiin, että suunnilleen joka 180. nukleotidipari ihmisellä olisi polymorfinen. Jos näin on, olisi ihmisen kaikkien mahdollisten genotyyppien määrä kymmenen potenssiin 8,48 miljoonaa. On siis sula mahdottomuus, että nyt olisi tai olisi joskus ollut olemassa kahtakaan genotyypiltään identtistä yksilöä (luonnollisesti lukuun ottamatta identtisten kaksosten erikoistapausta). ässä tutkimuksessa havaittiin myös, että verrattaessa mitä tahansa kahta kromosomia, keskimäärin joka nukleotidipari afroamerikkalisilla ja joka eurooppalaista alkuperää olevilla amerikkalaisilla oli erilainen. ästä voidaan laskea, että ensin mainitussa ryhmässä mitkä hyvänsä kaksi genomia poikkeavat toisistaan 2,89 miljoonan ja jälkimmäisessä ryhmässä 2,23 miljoonan nukleotidiparin osalta. Kuten muutkin tutkimukset ovat aikaisemmin osoittaneet, ovat afrikkalaiset populaatiot siis muuntelevampia kuin eurooppalaiset, mikä osoittaa että ihmisen alkukoti on frikassa. [2] oikkeamme toisistamme vain muutaman promillen verran Yhden nukleotidin polymorfismit ovat siis erilaisuutemme geneettinen perusta. ämä monimuotoisuus tekee meistä ulkonäöltämme erilaisia, säätelee alttiuksiamme sairastua tiettyihin tauteihin sekä ohjaa osittain myös käyttäytymisemme eroja. Jokainen meistä poikkeaa kaikista muista ihmisistä miljoonien nukleotidiparien verran. amalla kuitenkin snippien moniin muihin eläinlajeihin verrattuna varsin pieni suhteellinen määrä on myös samanlaisuutemme perusta. hmiskunta nimittäin polveutuu hyvin suppeasta, vain noin henkeä käsittävästä tä-frikassa asuneesta populaatiosta, mikä on rajoittanut lajimme geneettisen muuntelun määrää (ks. Valste 2004). Vaikka siis ihmisen mahdollisten genotyyppien määrä on tähtitieteellistäkin suurempi, poikkeamme kuitenkin toisistamme kaikkein perustavimmalla geneettisellä tasolla vain 3,6 5,6 promillen verran ([1 000 : 279] [1 000 : 180]). ässä on ihmisten tasa-arvoisuuden geneettinen perusta ja oikeutus, ja kaikenlaisen etnisen ynnä muun syrjinnän biologiset perustelut voidaan heittää romukoppaan. tse asiassa Maapallolla kilometrin päässä toisistaan elävät ihmiset poikkeavat geneettisesti vähemmän kuin frikassa toistensa naapureina elävät gorillapopulaatiot. yötyä yleisten sairauksien syiden etsinnässä Yhden geenin mutaatioiden aiheuttamien, Mendelin sääntöjen mukaan periytyvien sairauksien geenivirheiden etsiminen on jo pitkään ollut ihmisgeneetikkojen rutiinia. Jo ennen kuin ihmisen genomin molekulaarinen tutkimus aloitettiin, etsittiin tällaisten monogeenisten sairauksien ehdokasgeenejä klassillisen genetiikan kartoitusmenetelmiä soveltaen. Genomimme kartan valmistuttua vuonna 2001 on periaatteessa kaikkien geneettisten sairauksien ehdokasgeenejä voitu etsiä myös suoraan genomitiedostosta. seiden tautien osalta tämä on ollut mahdollista jo paljon aikaisemminkin kun on ollut käytössä osan genomiamme kattavia molekyylitason karttoja. Monitekijäisten sairauksien taustalla olevien geenivirheiden etsiminen sen sijaan on paljon hankalampaa. Niiden löytäminen on kuitenkin tärkeää, koska monet yleiset, kansanterveyden kannalta tärkeät taudit, kuten verenpainetauti, diabetes ja sydänverisuonisairaudet ovat tällaisia. ällaisten tautien puhkeamiseen ja kehitykseen vaikuttavat geenien ohella myös elintavat ja muut ympäristötekijät. Yhden nukleotidin polymorfismien avulla voidaan etsiä tällaisten monitekijäisten sairauksien taustalla olevia geenimuotoja. Yleisenä metodisena periaatteena on se, että yksilöillä, jotka tutkittavaa tautia sairastavat, on usein tietty snippi kromosomistossa lähellä sitä geneettistä varianttia, joka sairaudelle altistaa. ätä korrelaatiota kutsutaan kytkentäepätasapainoksi (engl. linkage disequilibrium, LD). iettyjen geneettisten varianttien ryhmää kromosomissa kutsutaan puolestaan haplotyypiksi. Kahden tai useamman geneettisen markkerin, kuten esimerkiksi tietyn snipin ja jonkin sairaudelle altistavan variantin esiintymistä yhdessä taas kutsutaan geneettiseksi assosiaatioksi. Naturen lokakuun niteen artikkelissa (he nternational apmap Consortium: he nternational apmap Consortium: haplotype map of the human genome, 2005) esitellään tietokantana ihmisen haplotyyppien kartta ja sen laadinnan Ä 3/2006

3 perusta. Vastaavasti kyseistä projektia kutsutaan apmap- projektiksi (ap = haplotyyppi, Map = kartta). ässä julkaistu tietokanta on apmapprojektin ensimmäisen vaiheen tulos, joka perustuu tietyt kriteerit täyttävän snipin analyysiin. rojektin toisessa vaiheessa on tarkoitus kartoittaa noin 4,6 miljoonaa snippiä lisää jokaisesta neljästä tutkimuksen kohteeksi valitusta populaatiosta. rojekti aloitettiin lokakuussa 2002, ja sen tarkoituksena on laatia julkinen, koko genomin kattava tietokanta ihmisen yleisistä DN-sekvenssin variaatioista. ietokanta tarjoaa informaation, joka on tarpeen ihmisen kliinisten fenotyyppien geneettisessä tutkimuksessa ja se muodostaa ihmisen genomiprojektin luontevan jatkon. ietokanta on internetissä vapaasti käytettävissä osoitteessa Geneettisten assosiaatiotutkimusten strategia apmap-projektin aloittamisen tärkein motiivi oli siis etsiä ihmisen genomin snipit jotta niitä voitaisiin käyttää geneettisten sairauksiemme ja sairausalttiuksiemme assosiaatiotutkimuksissa. ietyn sairauden assosiaatio-tutkimuksen yhteydessä löydettyä snippien ryhmää kutsutaan osoitelapuksi (engl. tag). Kutakin osoitelappusarjaa voidaan analysoida assosiaatioiden löytämiseksi erilaisin tilastollisin menetelmin. Osoitelapun avulla voidaan sairaudelle altistava geenimuoto löytää keneltä hyvänsä ihmiseltä, jolla sellainen on. aplotyypit purkautuvat useimmilla kromosomialueilla vähitellen geneettisen rekombinaation johdosta vaikkakin monia haplotyyppejä rajaavat myös spesifiset rekombinaatiokohdat. oisin sanoen haplotyyppejä reunustavat ns. rekombinaation kuumat pisteet, joissa tapahtuu geneettistä rekombinaatiota paljon runsaammin kuin haplotyypin sisällä. Geneettisen taudin aiheuttaman mutaation iästä riippuu kuinka voimakkaasti se on edelleen kytkeytynyt alkuperäisiin snippeihin. Mitä nuorempi mutaatio, sen todennäköisemmin alkuperäinen haplotyyppi on pysynyt koossa. Jos assosiaatiotutkimuksesta halutaan todella kattava, tutkimuksen tulee käsittää kaikki kysymykseen tulevat geenimuodot, jotka voivat altistaa tutkimuksen kohteena olevalle taudille. uurin osa eroista DN:n ei-koodaavalla alueella nippejä esiintyy yleisesti kautta koko ihmisen genomin. Kuitenkin suuri osa (64 %) iistä on niin harvinaisia, että niiden harvinaisemman muodon taajuus on vähemmän kuin viisi prosenttia. Vain neljä prosenttia snipeistä sijaitsee geenien koodaavalla alueella ja 96 prosenttia ei-koodaavalla alueella (Crawford ym. 2005). ämä ei kuitenkaan ole odottamatonta, sillä genomistamme vain noin viisi prosenttia on proteiineja koodaavaa DN:ta. Keskimääräinen geeni sisältää 126 snippiä, joista kuitenkin vain 46:n yleisyys on suurempi kuin viisi prosenttia. Näistä tutkituista 126: sta vain keskimäärin viisi on geenin koodaavalla alueella (eksoneissa) ja loput koodaamattomissa eksonien väleihin sijoittuvissa introneissa. utkittiin aineistoa, joka koski sekä farmakogenetiikkaa että sydänverisuonisairauksien riskitekijöitä. ässä aineistossa kaikkiaan 69 geenin koodaavalla alueella olevan snipin 541 tutkitusta havaittiin olevan haitallisia ko. geenin koodaaman proteiinin toiminnan kannalta. Kuitenkin kaikki mainitut 541 snippiä olivat sellaisia, jotka saavat aikaan aminohapon vaihdoksen proteiinissa (Crawford ym. 2005) hmisen geeneihin on kohdistunut sekä positiivista että negatiivista valintaa Vertaamalla koodaavien alueiden polymorfismia useammassa kuin geenissä 39 ihmisen joukossa ihmisen ja simpanssin eroihin saatiin vahvoja todisteita siitä, että luonnonvalinta, eikä yksin mutaatiopaine, on muokannut lajimme viimeaikaista evoluutiota (Bustamante ym. 2005). Geneettisessä koodissa esiintyy synonyymisiä koodisanoja. ynonyymiset koodisanat koodaavat samaa aminohappoa proteiinin primäärirakenteessa, ei-synonyymiset puolestaan koodaavat eri aminohappoja. utkimalla yhtäältä synonyymisiin ja toisaalta ei-synonyymisiin koodisanoihin johtavia DN:n vaihteluita, voidaan tehdä päätelmiä luonnonvalinnan voimakkuudesta. utkimuksen kohteena oli kaikkiaan sellaista ihmisen geeniä, joilla on vastine simpanssin genomissa. avaittiin, että geenissä näistä (92,6 %) oli koodaavan alueen muuntelua joko ihmislajin sisällä tai ihmisen ja simpanssin välillä. hmisen ja simpanssin välillä havaittiin fiksoitunutta synonyymistä eroa (siis sellaisia muunnoksia, jotka esiintyivät vain 25 Ä 3/2006

4 Ä 26 joko ihmisessä tai simpanssissa). ämä merkitsee 1,02 prosentin suuruista eroa. (ekä ihmisen että simpanssin genomissa on kaikkiaan 3,2 miljardia nukleotidiparia.) Vastaavasti löydettiin fiksoitunutta ei-synonyymistä eroa 11,81 miljoonan nukleotidiparin joukossa, eli 0,242 prosentin suuruinen ero. hmislajin sisällä havaittiin vastaavasti synonyymistä ja ei-synonyymistä snippiä. Kun otettiin huomioon kaikkien mahdollisten synonyymisten ja ei-synonyymisten nukleotidivaihdosten määrä koodissa, havaittiin että ei-synonyymisten snippien suhteellisen määrän suhde synonyymisten snippien suhteelliseen määrään oli pienempi kuin synonyymisten snippien suhteellisen määrän suhde ei-synonyymisten suhteelliseen määrään. ämä osoittaa, että aminohappovaihdoksia on enemmän kuin pelkän mutaatiopaineen perusteella voitaisiin odottaa syntyvän. ämä puolestaan osoittaa luonnonvalinnan toimineen ihmisen evoluution aikana. [4] Fenotyyppien erot johtuvat myös geenitoiminnan säätelyn eroista Kun analysoitiin ihmisen geenitoiminnan luontaista muuntelua, tehtiin assosiaatiotutkimuksia tiheällä snippien sarjalla apmap- projektin tuottamassa aineistossa geenien toiminnan säätelykohtien löytämiseksi (Cheung ym. 2005). utkittiin 27 geeniä, joiden toiminnan tason tiedettiin aikaisempien perheaineistoihin perustuvien selvitysten perusteella vaihtelevan geneettisistä syistä johtuen. lustava perheaineistoihin perustuva tutkimus oli sisältänyt kaikkiaan 3554:n geenien toiminnan eroihin pohjautuvan fenotyypin kytkentäanalyysin 14 utahilaisessa perheessä. Näistä noin tuhannessa löydettiin viitteitä siitä, että kulloinkin tutkimuksen kohteena olleen geenin lähellä olisi sitä säätelevä kohta DN:ssa. ap- Map- projektiin pohjautuva tarkempi tutkimus näistä jakautui kahteen osaan. nsinnäkin tehtiin assosiaatiotutkimus 374 fenotyypin osalta. Näistä 65 (17 %) osoitti erittäin merkitsevää assosiaatiota vähintään yhteen snippiin. Lisäksi löydettiin 136 (36 %) sellaista fenotyyppiä, joissa assosiaatio oli vähemmän merkitsevä, mutta kuitenkin selvä. Osoittautui myös, että perheaineistossa havaitun kytkennän voimakkuus ennusti selvästi assosiaation löytymistä. euraavaksi tehtiin tarkempi, 27 fenotyyppiin rajoitettu tutkimus. Näillä fenotyypeillä oli osoitettu voimakas kytkentä kyseisen geenin lähellä olevaan, sitä säätelevään DN-jaksoon. Kun kokonaisiin genomeihin kohdistuvan tutkimuksen mahdollisuudet ja resurssit ovat kasvaneet, on alettu kiinnittää entistä enemmän huomiota assosiaatiotutkimuksiin. Jo nyt saavutetut tulokset osoittavat, että myös geenien toiminnan säätelyyn kohdistuvat assosiaatiotutkimukset auttavat suuresti kun etsitään monitekijäisten ominaisuuksien ja sairauksien taustalla olevia geenejä. Jatkossa, kun snippi-kartat vielä tihentyvät ja genotyyppien määrittämisen menetelmät paranevat, tulee suuren mittakaavan assosiaatiotutkimuksista käytännöllinen keino tällaisten geenien etsinnässä. Olemme kaikki hyvin yksilöllisiä apmap-projekti ja sen tulevat sovellukset, joiden tarkoituksena on tulkita ihmisen yhden nukleotidin polymorfismien merkitys terveytemme kannalta, on monessa suhteessa käänteentekevä työ. en tulokset tulevat edesauttamaan paitsi monitekijäisten sairauksien taustalla olevien geenimuotojen ymmärtämystä myös monien muiden piirteidemme genetiikan selvittelyssä. hmiskuvamme kannalta kuitenkin projektin mielenkiintoisin tulos on se, että verrattaessa ketä tahansa kahta ihmistä, on heidän välillään aina miljoonien DN:n nukleotidiparien ero. Olemme siis kaikki hyvin yksilöllisiä myös geeniemme puolesta, ja voidaan sanoa, että geneettisessä mielessä ei ole olemassa normaalia ihmistyyppiä. Kirjoittaja on urun yliopiston perinnöllisyystieteen emeritusprofessori. V [1] Goldstein ym. (2005): nderstanding human diversity. / he nternational apmap Consortium (2005): haplotype map of the human genome. / Cheung ym. (2005): Mapping determinants of human gene expression by regional and genomewide association. Nature 437. [2] Ks. Bustamante ym. (2005): Natural selection on protein-coding genes in the human genome. Nature 437. [3] tse asiassa havaittiin, että keskimääräinen nukleotididiversitetti geeniä kohti laskettuna afroamerikkalaisilla oli 9, ja eurooppalaista alkuperää olevilla amerikkalaisilla 6, (Crawford ym. 2005) [4] Kun tutkitaan sitä mihin geeneihin on kohdistunut negatiivinen ja mihin positiivinen valinta, ver- Ä 3/2006

5 rataan polymorfismin määrää () yhtäältä synonyymisissä () kohdissa ja toisaalta ei-synonyymisissä (N) kohdissa näiden kohtien divergenssiin (D). Jos suhdeluku ( / D ) : ( N / D N ). on pienempi kuin yksi, on geeniin kohdistunut negatiivinen valinta. Jos taas suhdeluku on suurempi kuin yksi, on geeniin kohdistunut positiivinen valinta. Jos sen sijaan suhdeluku on yksi, on geeni valinnan kannalta neutraali. en selvittämiseksi kohdistuuko geeniin negatiivinen vai positiivinen valinta tai ovatko ne valinnan kannalta neutraaleja tutkittiin kaikkiaan ihmisen geeniä. seimmat niistä (3 799; 77,3 %) olivat valinnan kannalta neutraaleja. Kuitenkin 813 geenin (16,5 %) havaittiin olleen tilastollisesti merkitsevän negatiivisen ja 304 (6,2 %) positiivisen valinnan kohteena. 45 geenin havaittiin olevan nopean evoluution kohteena. Mielenkiintoista on, että erityisesti toisten geenien toimintaa sääteleviä transkriptiofaktoreita koodaavien geenien havaittiin olevan nopeasti kehittyviä. KRJLL Bustamante, Carlos D., Fledel-lon, di, Williamson cott, Nielsen, Rasmus, odd ubitsz, Melissa, Glanowski, tephen, anenbaum, David M., White, homas J., ninsky, John J., ernadez, Ryan D., Civello, Daniel, dams, Mark D., Cargill, Michelle & Clark, ndrew G. (2005): Natural selection on protein-coding genes in the human genome. Nature 437: Cheung, Vivian G., pielman, Richard., wens, Kathryn G., Weber, eresa M., Morley, Michael & Burdick, Joshua. (2005): Mapping determinants of human gene expression by regional and genome-wide association. Nature 437: Crawford, Diana C., key, Dayana. & Nickerson, Deborah. (2005): he patterns of natural variation in human genes. nn. Rev. Genomics um. Genet. 6: Goldstein, David B. & Cavalleri, Gianpiero L. (2005): nderstanding human diversity. Nature 437: he nternational apmap Consortium (2005): haplotype map of the human genome. Nature 437: Valste, Juha (2004): pinasta ihmiseksi. WOY, elsinki, 343 s. 27 Ä 3/2006

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä



KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MHC II-GEENIEN MONIMUOTOISUUSKARTOITUS Koirilla esiintyy useita erilaisia perinnöllisiä sairauksia samalla tavalla kuin ihmisilläkin. Rotuhistoriasta johtuen perinnöllisten sairauksien yleisyys


Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja


Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015

Kipu. Oleg Kambur. Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 23.6.2015 Katekoli-O-metyylitransferaasi ja kipu Oleg Kambur Kipu Geneettisillä tekijöillä suuri merkitys Yksittäisiä geenejä on löydetty vain vähän COMT 1 Katekoli-O-metyylitransferaasi (COMT) proteiini tuotetaan


Psyykkisten rakenteiden kehitys

Psyykkisten rakenteiden kehitys Psyykkisten rakenteiden kehitys Bio-psykososiaalinen näkemys: Ihmisen psyykkinen kasvu ja kehitys riippuu bioloogisista, psykoloogisista ja sosiaalisista tekijöistä Lapsen psyykkisen kehityksen kannalta


Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä Matti Pirinen Suomen molekyylilääketieteen instituutti (FIMM) Helsingin Yliopisto 17.2.2015 Tilastollisen päättelyn kurssi Kumpula Sisältö


Evoluutiovoimat. Ydinkysymykset. Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa?

Evoluutiovoimat. Ydinkysymykset. Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa? Evoluutiovoimat Ydinkysymykset Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa? -sattuman sysäily: populaatiokoon vaikutus -valinta: positiivinen, tasapainottava ja negatiivinen -mutaatiot:


Perinnöllinen informaatio ja geneettinen koodi.

Perinnöllinen informaatio ja geneettinen koodi. Tehtävä A1 Kirjoita essee aiheesta: Perinnöllinen informaatio ja geneettinen koodi. Vastaa esseemuotoisesti, älä käytä ranskalaisia viivoja. Piirroksia voi käyttää. Vastauksessa luetaan ansioksi selkeä


Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa

Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa Neandertalinihmisen ja nykyihmisen suhde molekyyligenetiikan valossa Petter Portin Kysymys siitä, ovatko nykyihminen (Homo sapiens) ja neandertalinihminen (Homo neanderthalensis) kaksi eri lajia vai saman


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


Geenikartoitusmenetelmät. Kytkentäanalyysin teoriaa. Suurimman uskottavuuden menetelmä ML (maximum likelihood) Uskottavuusfunktio: koko aineisto

Geenikartoitusmenetelmät. Kytkentäanalyysin teoriaa. Suurimman uskottavuuden menetelmä ML (maximum likelihood) Uskottavuusfunktio: koko aineisto Kytkentäanalyysin teoriaa Pyritään selvittämään tiettyyn ominaisuuteen vaikuttavien eenien paikka enomissa Perustavoite: löytää markkerilokus jonka alleelit ja tutkittava ominaisuus (esim. sairaus) periytyvät



KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,


Laboratorioanalyysit, vertailunäytteet ja tilastolliset menetelmät

Laboratorioanalyysit, vertailunäytteet ja tilastolliset menetelmät Jarmo Koskiniemi Maataloustieteiden laitos Helsingin yliopisto 0504151624 jarmo.koskiniemi@helsinki.fi 03.12.2015 Kolkunjoen taimenten geneettinen analyysi Näytteet Mika Oraluoma (Vesi-Visio osk) toimitti



Molekyylipopulaatiogenetiikka Molekyylipopulaatiogenetiikka Hedrick 2005, kappale 8, pp. 452-462, 428-449 Demografian ja valinnan vaikutukset koalesenssipuihin Valinnan havaitseminen TajimanD Divergenssin ja polymorfismin vertailu


Voidaanko geenitiedolla lisätä kansanterveyttä?

Voidaanko geenitiedolla lisätä kansanterveyttä? Voidaanko geenitiedolla lisätä kansanterveyttä? Duodecimin vuosipäivä 14.11.2014 Veikko Salomaa, LKT, tutkimusprofessori 21.11.2014 Esityksen nimi / Tekijä 1 Sidonnaisuudet Ei ole 21.11.2014 Esityksen


Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016


Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä

Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä Evoluutio ja luominen Mian tekemä esitys Jannen esittämänä Väite: tiedemiehet ovat todistaneet evoluutioteorian todeksi Evoluutioteorialla tässä tarkoitan teoriaa, jonka mukaan kaikki elollinen on kehittynyt


Pia Soronen (FM, LK, väitellyt) 21.3.2013

Pia Soronen (FM, LK, väitellyt) 21.3.2013 Pia Soronen (FM, LK, väitellyt) 21.3.2013 Yleistä periytyvyydestä ja genetiikasta Miten perinnöllisyyttä tutkitaan Kytkentäanalyyseistä nykypäivään Tärkeimmät löydökset Ehdokasgeeni esimerkkejä Uudet GWAS


Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20

Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 26. 05. 2005 Etunimet Tehtävä 3 Pisteet / 20 3: Osa 1 Tumallisten solujen genomin toiminnassa sekä geenien


Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet?

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Harvinaiset-seminaari TYKS 29.9.2011 Jaakko Ignatius TYKS, Perinnöllisyyspoliklinikka Miksi Harvinaiset-seminaarissa puhutaan


Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve


Autoimmuunitaudit: osa 1

Autoimmuunitaudit: osa 1 Autoimmuunitaudit: osa 1 Autoimmuunitaute tunnetaan yli 80. Ne ovat kroonisia sairauksia, joiden syntymekanismia eli patogeneesiä ei useimmissa tapauksissa ymmärretä. Tautien esiintyvyys vaihtelee maanosien,


Farmakogeneettiset testit apuna lääkehoidon arvioinnissa

Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit Farmakogenetiikalla tarkoitetaan geneettisiä variaatioita, jotka vaikuttavat lääkeainevasteeseen. Geneettisen tiedon hyödyntäminen


Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti


Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä



TESTITULOSTEN YHTEENVETO TESTITULOSTEN YHTEENVETO LIHASTEN VÄSYMINEN JA PALAUTUMINEN Lihaksesi eivät väsy niin helposti ja ne palautuvat nopeammin. Kehitettävä Hyvä AEROBINEN KUNTO Sinulla on edellytyksiä kasvattaa aerobista kuntoa


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä



SÄTEILYN GENEETTISET VAIKUTUKSET 8 SÄTEILYN GENEETTISET VAIKUTUKSET Sisko Salomaa SISÄLLYSLUETTELO 8.1 Ihmisen perinnölliset sairaudet... 122 8.2 Perinnöllisten sairauksien taustailmaantuvuus... 125 8.3 Perinnöllisen riskin arviointi...


X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 12 X-kromosominen periytyminen TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 FOLKHÄLSANS GENETISKA KLINIK PB 211, (Topeliusgatan 20) 00251 Helsingfors tel (09)


Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä?

Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Huono-osaisuuden periytyminen: Mitä annettavaa on geneettiset tekijät huomioivilla tutkimusmenetelmillä? Antti Latvala Sosiaalilääketieteen päivät 28.11.2012 Esityksen teemat Miksi ja miten huomioida geneettisten


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio CELL 411-- replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi


Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Astman ja atopian genetiikka miten ehdokasgeenitutkimuksien tuloksia tulkitaan? Tarja Laitinen, Lauri A. Laitinen ja Juha Kere

Astman ja atopian genetiikka miten ehdokasgeenitutkimuksien tuloksia tulkitaan? Tarja Laitinen, Lauri A. Laitinen ja Juha Kere Genomi Astman ja atopian genetiikka miten ehdokasgeenitutkimuksien tuloksia tulkitaan? Tarja Laitinen, Lauri A. Laitinen ja Juha Kere Astman ja atopian genetiikaa käsittelevien julkaisujen määrä on viimeisten


Populaatiosimulaattori. Petteri Hintsanen HIIT perustutkimusyksikkö Helsingin yliopisto

Populaatiosimulaattori. Petteri Hintsanen HIIT perustutkimusyksikkö Helsingin yliopisto Populaatiosimulaattori Petteri Hintsanen HIIT perustutkimusyksikkö Helsingin yliopisto Kromosomit Ihmisen perimä (genomi) on jakaantunut 23 kromosomipariin Jokaisen parin toinen kromosomi on peritty isältä


Koiran periytyvä persoonallisuus

Koiran periytyvä persoonallisuus Koiran periytyvä persoonallisuus Katriina Tiira, FT, Koirangeenit tutkimusryhmä, HY & Folkhälsan, Eläinten hyvinvoinnin tutkimuskeskus Periytyykö käyttäytyminen? Kaikki yksilön kokemukset kohtuajasta eteenpäin=


Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän


GEENIT SKITSOFRENIAN AIHEUTTAJANA. Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9.

GEENIT SKITSOFRENIAN AIHEUTTAJANA. Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9. GEENIT SKITSOFRENIAN AIHEUTTAJANA Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9.2009 SKITSOFRENIAN ETIOLOGIAA Hermoston kehityksen häiriö Poikkeava neurotransmissio





Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta


Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa.

Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla tekijöillä ja perimällä on oma osuutensa. 1 1/2011 Parkinsonin taudin perinnöllisyys Geenien ja ympäristötekijöiden vuorovaikutus sairastumisen taustalla Parkinsonin tauti on monitekijäinen tauti, jonka synnyssä erilaisilla elämän aikana vaikuttavilla


Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen käyttöön liittyviä haasteita Juhani Eskola 310505 7.6.2005 1 Valitut painopistealueet Kansantautien ja terveyden geenitausta Mikrobit ja



GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus GENOMINEN VALINTA HEVOSJALOSTUKSESSA Markku Saastamoinen MTT Hevostutkimus Genominen valinta genomisessa valinnassa eläimen jalostusarvo selvitetään DNA:n sisältämän perintöaineksen tiedon avulla Genomi


Miten geenit elelevät populaatioissa, vieläpä pitkiä aikoja?

Miten geenit elelevät populaatioissa, vieläpä pitkiä aikoja? Miten geenit elelevät populaatioissa, vieläpä pitkiä aikoja? Populaatio on lisääntymisyhteisö ja lisääntymisjatkumo Yksilöt ovat geenien tilapäisiä yhteenliittymiä, mutta populaatiossa geenit elelevät



KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN Suomen Ympäristösairauskeskus perustettiin viime vuonna ajantasaisen ympäristösairaustiedon asiantuntijakeskukseksi. Tavoitteena on ajantasaisen,


KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


Tarkastelen suomalaisen taloustieteen tutkimuksen tilaa erilaisten julkaisutietokantojen avulla. Käytän myös kerättyjä tietoja yliopistojen

Tarkastelen suomalaisen taloustieteen tutkimuksen tilaa erilaisten julkaisutietokantojen avulla. Käytän myös kerättyjä tietoja yliopistojen 1 2 3 Tarkastelen suomalaisen taloustieteen tutkimuksen tilaa erilaisten julkaisutietokantojen avulla. Käytän myös kerättyjä tietoja yliopistojen opettajien tutkimusalueista. 4 Kuviossa 1 esitetään kansantaloustieteen


Ongelma 1: Onko datassa tai informaatiossa päällekkäisyyttä?

Ongelma 1: Onko datassa tai informaatiossa päällekkäisyyttä? Ongelma 1: Onko datassa tai informaatiossa päällekkäisyyttä? 2012-2013 Lasse Lensu 2 Ongelma 2: Voidaanko dataa tai informaatiota tallettaa tiiviimpään tilaan koodaamalla se uudelleen? 2012-2013 Lasse


Suomalaisen maatiaiskanan säilytysohjelman koulutuspäivä, Riihimäki, 25.10.2014 Pasi Hellstén

Suomalaisen maatiaiskanan säilytysohjelman koulutuspäivä, Riihimäki, 25.10.2014 Pasi Hellstén Suomalaisen maatiaiskanan säilytysohjelman koulutuspäivä, Riihimäki, 25.10.2014 Pasi Hellstén Sisäsiittoisuudella tarkoitetaan perinnöllisyystieteessä lisääntymistä, jossa pariutuvat yksilöt ovat enemmän





Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa

Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Susan Thorpe-Vargas Ph.D., John Cargill MA, MBA, MS, D. Caroline Coile, Ph.D. Käännös Inkeri Kangasvuo Koskaan ei ehkä


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja


Geenikartoituksen käsitteet ja lähestymistavat

Geenikartoituksen käsitteet ja lähestymistavat Geenikartoituksen käsitteet ja lähestymistavat Luentomateriaalin pohjana Vesa Ollikainen, CSC Geenikartoituskurssin kalvot Geenikartoitus ongelmana Tavoitteena on löytää tilastollisia yhteyksiä yksilöillä





Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien



GEENIVARAT OVAT PERUSTA KASVINJALOSTUKSELLE. Merja Veteläinen Boreal Kasvinjalostus Oy GEENIVARAT OVAT PERUSTA KASVINJALOSTUKSELLE Merja Veteläinen Boreal Kasvinjalostus Oy OPIT TÄNÄÄN Miksi kasvinjalostus tarvitsee geenivaroja? Miten geenivaroja käytetään kasvinjalostuksessa? Geenivarat



ELINKEINOTOIMINNAN VEROVELAT ELINKEINOTOIMINNAN VEROVELAT HTSY Verohallinto 3.3.2015 2 (5) ELINKEINOTOIMINNAN VEROVELAT Vuoden 2013 lopulla elinkeinotoiminnan verovelkaa oli miltei kolme miljardia euroa ja yritysten verovelat näyttävät


Suomen suosituimmat remontit järjestyksessä

Suomen suosituimmat remontit järjestyksessä Suomen suosituimmat remontit järjestyksessä Remonttien kilpailutuspalvelu urakkamaailma.fi on tilastoinut ja analysoinut tuhansien remonttitarjouspyyntöjen perusteella Suomen suosituimmat remontit. Nyt


Periytyvyys ja sen matematiikka

Periytyvyys ja sen matematiikka Periytyvyys ja sen matematiikka 30.7.2001 Katariina Mäki MMM,tutkija Helsingin yliopisto, Kotieläintieteen laitos / kotieläinten jalostustiede katariina.maki@animal.helsinki.fi Jalostuksen tavoitteena


PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi


Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten


DNA (deoksiribonukleiinihappo)

DNA (deoksiribonukleiinihappo) DNA (deoksiribonukleiinihappo) Kaksoiskierre (10 emäsparin välein täysi kierros) Kaksi sokerifosfaattirunkoa. Huomaa suunta: 5 päässä vapaana fosfaatti (kiinni sokerin 5. hiilessä) 3 päässä vapaana sokeri


Eksponentti- ja logaritmifunktiot

Eksponentti- ja logaritmifunktiot Eksponentti- ja logaritmifunktiot Eksponentti- ja logaritmifunktiot liittyvät läheisesti toisiinsa. Eksponenttifunktio tulee vastaan ilmiöissä, joissa tarkasteltava suure kasvaa tai vähenee suhteessa senhetkiseen


Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta

Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Genetiikan tutkijat Englannin Kennel Clubin ja AHT:n kanssa yhteistyössä ovat laatineet seuraavanlaisen artikkelin Episodic Fallingista


a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien


Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Geenitutkimuksista Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; Huhtikuussa 2008 Tätä työtä


Suomenhevosten askelja hyppyominaisuuksien periytyvyys. Suomenhevosten jalostuspäivät 10.2.2016 Aino Aminoff

Suomenhevosten askelja hyppyominaisuuksien periytyvyys. Suomenhevosten jalostuspäivät 10.2.2016 Aino Aminoff Suomenhevosten askelja hyppyominaisuuksien periytyvyys Suomenhevosten jalostuspäivät 10.2.2016 Aino Aminoff Suomenhevosten laatuarvostelu Suomenhevosten laatuarvostelu on 3-5 v. suomenhevosille suunnattu


Miltä näyttää kotimaisten rotujemme perinnöllinen monimuotoisuus? Jalostusvalinta on merkittävin koirarotujen monimuotoisuutta vähentävä tekijä

Miltä näyttää kotimaisten rotujemme perinnöllinen monimuotoisuus? Jalostusvalinta on merkittävin koirarotujen monimuotoisuutta vähentävä tekijä Miltä näyttää kotimaisten rotujemme perinnöllinen monimuotoisuus? Katariina Mäki ja Mauri Kumpulainen Kennelliitolla on meneillään tilaustutkimus kotimaisten rotujen DLA-monimuotoisuudesta. Mukana ovat


Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä



KEMIALLISET ANALYYSIT TURUN YLIOPISTOSSA Biokemian ja elintarvikekemian laitos RAPORTTI 1 (8) Projekti: Siian laatu kalan tarjontaketjussa Dnro: 4682/3516/05 Hankenro: 534589 Raportin laatija: Jukka Pekka Suomela KEMIALLISET ANALYYSIT TURUN YLIOPISTOSSA


Terveyteen liittyvät geenitestit

Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Jokaisella meistä on vanhemmiltamme perittynä oma yksilöllinen geenivalikoimamme. Tämä geneettinen rakenteemme yhdessä erilaisten ympäristön


Farmakogeneettinen paneeli Geenitestillä tehokas ja turvallinen lääkehoito

Farmakogeneettinen paneeli Geenitestillä tehokas ja turvallinen lääkehoito Farmakogeneettinen paneeli Geenitestillä tehokas ja turvallinen lääkehoito VAIKUTTAVAA TERVEYSPALVELUA Farmakogenetiikka mitä ja miksi? Lääkehoitoihin tiedetään liittyvän huomattavaa yksilöllistä vaihtelua,


måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia



ISOJOEN JA KAUHAJOEN ALUEEN TAIMENTEN GENEETTISET TUTKIMUKSET JA HOITOSUOSITUKSET ISOJOEN JA KAUHAJOEN ALUEEN TAIMENTEN GENEETTISET TUTKIMUKSET JA HOITOSUOSITUKSET Taimenpäivä 12.12.2016 Isojoki Kodesjärven kylätalo Eero Jutila Nettiosoite http://jukuri.luke.fi/bitstream/handle/10024/519534/lukeluobio_52_2015.pdf?sequence=1


1 Raja-arvo. 1.1 Raja-arvon määritelmä. Raja-arvo 1

1 Raja-arvo. 1.1 Raja-arvon määritelmä. Raja-arvo 1 Raja-arvo Raja-arvo Raja-arvo kuvaa funktion f arvon f() kättätmistä, kun vaihtelee. Joillakin funktioilla f() muuttuu vain vähän, kun muuttuu vähän. Toisilla funktioilla taas f() hppää tai vaihtelee arvaamattomasti,


Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,



Kreatransporttihäiriö Tietolehtiset on tarkoitettu yleiskatsauksiksi johonkin tiettyyn oireyhtymään tai sairauteen, ne eivät korvaa perinnöllisyysneuvontaa tai erikoislääkärin konsultaatiota. Kreatransporttihäiriö Erikoislääkäri


Genetiikan synnystä 140 vuotta

Genetiikan synnystä 140 vuotta Genetiikan synnystä 140 vuotta etter ortin 36 Genetiikan perusteiden luoja Gregor Mendel on yksi ihmiskunnan suurista neroista ja 1800-luvulla esiin murtautuneen rationaalisen ajattelutavan luojista. nsikädessä


Luku 21. Evoluution perusteet

Luku 21. Evoluution perusteet 1. Evoluutio käsitteenä a. Mitä käsite evoluutio tarkoittaa? b. Miten evoluutiota tapahtuu? c. Mitkä ovat evoluution päämääriä? 2. Evoluution todisteita Mitä seuraavat evoluution todisteet osoittavat evoluutiosta?


Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:


Oppilaiden sisäilmakysely - Tutkimusseloste

Oppilaiden sisäilmakysely - Tutkimusseloste Tutkimusseloste 1(10) Oppilaiden sisäilmakysely - Tutkimusseloste Kohde: Ivalon yläaste ja Ivalon lukio sekä vertailukouluna toiminut Inarin koulu Kuopio 29.01.2016 Jussi Lampi Asiantuntijalääkäri jussi.lampi@thl.fi



BIOLOGIAN YHTEISVALINTA 2011 KYSYMYS 1. Mallivastaus KYSYMYS 1 Lepät (Alnus) ovat lehtipuita, jotka elävät symbioosissa juurinystyröitä aikaansaavan Frankia - bakteerin kanssa. A. Kerro, miten leppä ottaa ravinteita. (24 p) B. Mitä ravinteita tarvitaan ja


6.4. Genomin koon evoluutio Genomin koko vaihtelee

6.4. Genomin koon evoluutio Genomin koko vaihtelee 6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?


BIOLOGIA 1. kurssi 7. luokka

BIOLOGIA 1. kurssi 7. luokka 1. kurssi 7. luokka Kurssin tavoitteena on ohjata oppilasta ymmärtämään elämän perusilmiöitä ja vesiekosysteemien rakennetta ja toimintaa. Tavoitteena on, että oppilas oppii tunnistamaan ja luokittelemaan


DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia

DNA Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia DNA 3.3.2015 Tiina Immonen, FT, yo-lehtori HY Biolääketieteen laitos, Biokemia ja kehitysbiologia Koordinaattori, Master s Degree Programme in Translational Medicine (TRANSMED) 1 Sisältö DNA:n rakenne


Huhtikuun 14. päivänä tänä vuonna julistettiin

Huhtikuun 14. päivänä tänä vuonna julistettiin Katsaus Märkäisistä haavasiteistä yksilön genomiin Tiina Immonen ja Hannu Sariola Vuotta 2003 juhlittiin DN:n juhlavuotena ympäri maailmaa. Tähän antoi aiheen ihmisen genomi -hankkeen loppuun saattaminen


Matemaatikot ja tilastotieteilijät

Matemaatikot ja tilastotieteilijät Matemaatikot ja tilastotieteilijät Matematiikka/tilastotiede ammattina Tilastotiede on matematiikan osa-alue, lähinnä todennäköisyyslaskentaa, mutta se on myös itsenäinen tieteenala. Tilastotieteen tutkijat


Tietoa sähkökentästä tarvitaan useissa fysikaalisissa tilanteissa, esimerkiksi jos halutaan

Tietoa sähkökentästä tarvitaan useissa fysikaalisissa tilanteissa, esimerkiksi jos halutaan 3 Sähköstatiikan laskentamenetelmiä Tietoa sähkökentästä tavitaan useissa fysikaalisissa tilanteissa, esimekiksi jos halutaan tietää missäläpilyönti on todennäköisin suujännitelaitteessa tai mikä on kahden


Matematiikan tukikurssi

Matematiikan tukikurssi Matematiikan tukikurssi Kurssikerta 4 Jatkuvuus Jatkuvan funktion määritelmä Tarkastellaan funktiota f x) jossakin tietyssä pisteessä x 0. Tämä funktio on tässä pisteessä joko jatkuva tai epäjatkuva. Jatkuvuuden


Translationaalinen tutkimus, mitä, miksi, miten?

Translationaalinen tutkimus, mitä, miksi, miten? Translationaalinen tutkimus, mitä, miksi, miten? Mikko Hiltunen, FT, dosentti Tutkimusjohtaja, Akatemiatutkija Kliininen lääketiede Neurologia, ISY mikko.hiltunen@uef.fi Translationaalinen tutkimus, mitä?


Tilastokatsaus 12:2010

Tilastokatsaus 12:2010 Tilastokatsaus 12:2010 15.11.2010 Tietopalvelu B15:2010 Pendelöinti Vantaalle ja Vantaalta vuosina 2001-2008 Vantaalaisten työssäkäyntikunta Vantaalaisista työskenteli vuonna 2008 kotikunnassaan 44,9 prosenttia.


Seulontatutkimusten perusperiaatteet

Seulontatutkimusten perusperiaatteet Seulontatutkimusten perusperiaatteet Ilona Autti-Rämö, dos Finohta / Sikiöseulontojen yhtenäistäminen / Ilona Autti-Rämö 1 Seulontatutkimuksen yleiset periaatteet Tutkitaan sovittu ryhmä oireettomia henkilöitä,


Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet


Reaaliluvut 1/7 Sisältö ESITIEDOT:

Reaaliluvut 1/7 Sisältö ESITIEDOT: Reaaliluvut 1/7 Sisältö Reaalilukujoukko Reaalilukujoukkoa voidaan luonnollisimmin ajatella lukusuorana, molemmissa suunnissa äärettömyyteen ulottuvana suorana, jonka pisteet ja reaaliluvut vastaavat toisiaan:
