Computational personal genomics: selection, regulation, epigenomics, disease
|
|
- Jarkko Koskinen
- 4 vuotta sitten
- Katselukertoja:
Transkriptio
1 Computational personal genomics: selection, regulation, epigenomics, disease Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory
2 TATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG ATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA CTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAAT TAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAATGACTAAATCTCATTCAGAAGAAGTGATTGTACCTGAGTTCAA TAGCGCAAAGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGG TTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTATTGAT GATATGCTTTGCGCCGTCAAAGTTTTGAACGAGAAAAATCCATCCATTACCTTAATAAATGCTGATCCCAAATTTGCTCAAAGGAA CGATTTGCCGTTGGACGGTTCTTATGTCACAATTGATCCTTCTGTGTCGGACTGGTCTAATTACTTTAAATGTGGTCTCCATGTTG ACTCTTTTCTAAAGAAACTTGCACCGGAAAGGTTTGCCAGTGCTCCTCTGGCCGGGCTGCAAGTCTTCTGTGAGGGTGATGTACCA GGCAGTGGATTGTCTTCTTCGGCCGCATTCATTTGTGCCGTTGCTTTAGCTGTTGTTAAAGCGAATATGGGCCCTGGTTATCATAT CAAGCAAAATTTAATGCGTATTACGGTCGTTGCAGAACATTATGTTGGTGTTAACAATGGCGGTATGGATCAGGCTGCCTCTGTTT GTGAGGAAGATCATGCTCTATACGTTGAGTTCAAACCGCAGTTGAAGGCTACTCCGTTTAAATTTCCGCAATTAAAAAACCATGAA AGCTTTGTTATTGCGAACACCCTTGTTGTATCTAACAAGTTTGAAACCGCCCCAACCAACTATAATTTAAGAGTGGTAGAAGTCAC AGCTGCAAATGTTTTAGCTGCCACGTACGGTGTTGTTTTACTTTCTGGAAAAGAAGGATCGAGCACGAATAAAGGTAATCTAAGAG TCATGAACGTTTATTATGCCAGATATCACAACATTTCCACACCCTGGAACGGCGATATTGAATCCGGCATCGAACGGTTAACAAAG CTAGTACTAGTTGAAGAGTCTCTCGCCAATAAGAAACAGGGCTTTAGTGTTGACGATGTCGCACAATCCTTGAATTGTTCTCGCGA ATTCACAAGAGACTACTTAACAACATCTCCAGTGAGATTTCAAGTCTTAAAGCTATATCAGAGGGCTAAGCATGTGTATTCTGAAT TAAGAGTCTTGAAGGCTGTGAAATTAATGACTACAGCGAGCTTTACTGCCGACGAAGACTTTTTCAAGCAATTTGGTGCCTTGATG GAGTCTCAAGCTTCTTGCGATAAACTTTACGAATGTTCTTGTCCAGAGATTGACAAAATTTGTTCCATTGCTTTGTCAAATGGATC TGGTTCCCGTTTGACCGGAGCTGGCTGGGGTGGTTGTACTGTTCACTTGGTTCCAGGGGGCCCAAATGGCAACATAGAAAAGGTAA AAGCCCTTGCCAATGAGTTCTACAAGGTCAAGTACCCTAAGATCACTGATGCTGAGCTAGAAAATGCTATCATCGTCTCTAAACCA TTGGGCAGCTGTCTATATGAATTATAAGTATACTTCTTTTTTTTACTTTGTTCAGAACAACTTCTCATTTTTTTCTACTCATAACT GCATCACAAAATACGCAATAATAACGAGTAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATA TTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGG CCTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAG TTGGCAAGTTGCCAACTGACGAGATGCAGTAAAAAGAGATTGCCGTCTTGAAACTTTTTGTCCTTTTTTTTTTCCGGGGACTCTAC AACCCTTTGTCCTACTGATTAATTTTGTACTGAATTTGGACAATTCAGATTTTAGTAGACAAGCGCGAGGAGGAAAAGAAATGACA AAATTCCGATGGACAAGAAGATAGGAAAAAAAAAAAGCTTTCACCGATTTCCTAGACCGGAAAAAAGTCGTATGACATCAGAATGA ATTTTCAAGTTAGACAAGGACAAAATCAGGACAAATTGTAAAGATATAATAAACTATTTGATTCAGCGCCAATTTGCCCTTTTCCA TCCATTAAATCTCTGTTCTCTCTTACTTATATGATGATTAGGTATCATCTGTATAAAACTCCTTTCTTAATTTCACTCTAAAGCAT CCATAGAGAAGATCTTTCGGTTCGAAGACATTCCTACGCATAATAAGAATAGGAGGGAATAATGCCAGACAATCTATCATTACATT GCGGCTCTTCAAAAAGATTGAACTCTCGCCAACTTATGGAATCTTCCAATGAGACCTTTGCGCCAAATAATGTGGATTTGGAAAAA TATAAGTCATCTCAGAGTAATATAACTACCGAAGTTTATGAGGCATCGAGCTTTGAAGAAAAAGTAAGCTCAGAAAAACCTCAATA CTCATTCTGGAAGAAAATCTATTATGAATATGTGGTCGTTGACAAATCAATCTTGGGTGTTTCTATTCTGGATTCATTTATGTACA AGGACTTGAAGCCCGTCGAAAAAGAAAGGCGGGTTTGGTCCTGGTACAATTATTGTTACTTCTGGCTTGCTGAATGTTTCAATATC ACTTGGCAAATTGCAGCTACAGGTCTACAACTGGGTCTAAATTGGTGGCAGTGTTGGATAACAATTTGGATTGGGTACGGTTTCGT
3 TATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG ATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA CTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAAT TAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAATGACTAAATCTCATTCAGAAGAAGTGATTGTACCTGAGTTCAA TAGCGCAAAGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGG TTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTATTGAT GATATGCTTTGCGCCGTCAAAGTTTTGAACGAGAAAAATCCATCCATTACCTTAATAAATGCTGATCCCAAATTTGCTCAAAGGAA CGATTTGCCGTTGGACGGTTCTTATGTCACAATTGATCCTTCTGTGTCGGACTGGTCTAATTACTTTAAATGTGGTCTCCATGTTG ACTCTTTTCTAAAGAAACTTGCACCGGAAAGGTTTGCCAGTGCTCCTCTGGCCGGGCTGCAAGTCTTCTGTGAGGGTGATGTACCA Genes GGCAGTGGATTGTCTTCTTCGGCCGCATTCATTTGTGCCGTTGCTTTAGCTGTTGTTAAAGCGAATATGGGCCCTGGTTATCATAT Regulatory motifs CAAGCAAAATTTAATGCGTATTACGGTCGTTGCAGAACATTATGTTGGTGTTAACAATGGCGGTATGGATCAGGCTGCCTCTGTTT GTGAGGAAGATCATGCTCTATACGTTGAGTTCAAACCGCAGTTGAAGGCTACTCCGTTTAAATTTCCGCAATTAAAAAACCATGAA Encode AGCTTTGTTATTGCGAACACCCTTGTTGTATCTAACAAGTTTGAAACCGCCCCAACCAACTATAATTTAAGAGTGGTAGAAGTCAC Control AGCTGCAAATGTTTTAGCTGCCACGTACGGTGTTGTTTTACTTTCTGGAAAAGAAGGATCGAGCACGAATAAAGGTAATCTAAGAG proteins TCATGAACGTTTATTATGCCAGATATCACAACATTTCCACACCCTGGAACGGCGATATTGAATCCGGCATCGAACGGTTAACAAAG gene expression CTAGTACTAGTTGAAGAGTCTCTCGCCAATAAGAAACAGGGCTTTAGTGTTGACGATGTCGCACAATCCTTGAATTGTTCTCGCGA ATTCACAAGAGACTACTTAACAACATCTCCAGTGAGATTTCAAGTCTTAAAGCTATATCAGAGGGCTAAGCATGTGTATTCTGAAT TAAGAGTCTTGAAGGCTGTGAAATTAATGACTACAGCGAGCTTTACTGCCGACGAAGACTTTTTCAAGCAATTTGGTGCCTTGATG GAGTCTCAAGCTTCTTGCGATAAACTTTACGAATGTTCTTGTCCAGAGATTGACAAAATTTGTTCCATTGCTTTGTCAAATGGATC TGGTTCCCGTTTGACCGGAGCTGGCTGGGGTGGTTGTACTGTTCACTTGGTTCCAGGGGGCCCAAATGGCAACATAGAAAAGGTAA AAGCCCTTGCCAATGAGTTCTACAAGGTCAAGTACCCTAAGATCACTGATGCTGAGCTAGAAAATGCTATCATCGTCTCTAAACCA TTGGGCAGCTGTCTATATGAATTATAAGTATACTTCTTTTTTTTACTTTGTTCAGAACAACTTCTCATTTTTTTCTACTCATAACT GCATCACAAAATACGCAATAATAACGAGTAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATA TTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGG CCTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAG TTGGCAAGTTGCCAACTGACGAGATGCAGTAAAAAGAGATTGCCGTCTTGAAACTTTTTGTCCTTTTTTTTTTCCGGGGACTCTAC AACCCTTTGTCCTACTGATTAATTTTGTACTGAATTTGGACAATTCAGATTTTAGTAGACAAGCGCGAGGAGGAAAAGAAATGACA AAATTCCGATGGACAAGAAGATAGGAAAAAAAAAAAGCTTTCACCGATTTCCTAGACCGGAAAAAAGTCGTATGACATCAGAATGA ATTTTCAAGTTAGACAAGGACAAAATCAGGACAAATTGTAAAGATATAATAAACTATTTGATTCAGCGCCAATTTGCCCTTTTCCA TCCATTAAATCTCTGTTCTCTCTTACTTATATGATGATTAGGTATCATCTGTATAAAACTCCTTTCTTAATTTCACTCTAAAGCAT CCATAGAGAAGATCTTTCGGTTCGAAGACATTCCTACGCATAATAAGAATAGGAGGGAATAATGCCAGACAATCTATCATTACATT GCGGCTCTTCAAAAAGATTGAACTCTCGCCAACTTATGGAATCTTCCAATGAGACCTTTGCGCCAAATAATGTGGATTTGGAAAAA TATAAGTCATCTCAGAGTAATATAACTACCGAAGTTTATGAGGCATCGAGCTTTGAAGAAAAAGTAAGCTCAGAAAAACCTCAATA CTCATTCTGGAAGAAAATCTATTATGAATATGTGGTCGTTGACAAATCAATCTTGGGTGTTTCTATTCTGGATTCATTTATGTACA AGGACTTGAAGCCCGTCGAAAAAGAAAGGCGGGTTTGGTCCTGGTACAATTATTGTTACTTCTGGCTTGCTGAATGTTTCAATATC ACTTGGCAAATTGCAGCTACAGGTCTACAACTGGGTCTAAATTGGTGGCAGTGTTGGATAACAATTTGGATTGGGTACGGTTTCGT
4 Family Inheritance Personal genomics today: 23 and We Me vs. my brother Recombination breakpoints Dad s mom My dad Mom s dad Disease risk Human ancestry Genomics: Regions mechanisms drugs Systems: genes combinations pathways
5 Understanding human variation and human disease Gene annotation (Coding, 5 /3 UTR, RNAs) Evolutionary signatures Non-coding annotation Chromatin signatures CATGACTG CATGCCTG Disease-associated variant (SNP/CNV/ ) Roles in gene/chromatin regulation Activator/repressor signatures Other evidence of function Signatures of selection (sp/pop) Challenge: from loci to mechanism, pathways, drug targets Goal: A systems-level understanding of genomes and gene regulation: The regulators: Transcription factors, micrornas, sequence specificities The regions: enhancers, promoters, and their tissue-specificity The targets: TFs targets, regulators enhancers, enhancers genes The grammars: Interplay of multiple TFs prediction of gene expression The parts list = Building blocks of gene regulatory networks
6 Tools for interpreting the human genome Evolutionary signatures Genome annotation Distinct signatures for proteins, ncrnas, mirnas, motifs Read-through, excess-constraint, networks,human selection Chromatin signatures Dynamic regulatory regions Define chromatin states from combinations of histone marks Distinct classes of promoter/enhancer/transcribed/repressed Activity signatures Link enhancer networks Activity-based linking of regulators enhancers targets Testing of 1000s of enhancer activator / repressor motifs Personal genomics Interpret disease mechanism Disease-associations: Mechanistic predictions for variants Beyond top hits: GWAS T1D-associated enhancers Global methylation changes in Alzheimer s: NRSF, ELK1, CTCF
7 Evolutionary signatures reveal genes, RNAs, motifs Compare 29 mammals Increased conservation pinpoints functional regions Lindblad-Toh Nature 2011 Stark Nature 2007 Distinct patterns of change distinguish diff. functions Protein-coding genes - Codon Substitution Frequencies - Reading Frame Conservation RNA structures - Compensatory changes - Silent G-U substitutions micrornas - Shape of conservation profile - Structural features: loops, pairs - Relationship with 3 UTR motifs Regulatory motifs - Mutations preserve consensus - Increased Branch Length Score - Genome-wide conservation
8 Compare 29 mammals: Reveal constrained positions NRSF motif Reveal individual transcription factor binding sites Within motif instances reveal position-specific bias More species: motif consensus directly revealed
9 Human constraint outside conserved regions Active regions Average diversity (heterozygosity) Aggregate over the genome Ward and Kellis Science 2012 Non-conserved regions: ENCODE-active regions show reduced diversity Lineage-specific constraint in biochemically-active regions Conserved regions: Non-ENCODE regions show increased diversity Loss of constraint in human when biochemically-inactive
10 Human-specific enhancer functions play regulatory roles Transcription initiation from Pol2 promoter Transcription coactivator activity Transcription factor binding Chromatin binding Negative regulation of transcription, DNA-dependent Transcription factor complex Protein complex Protein kinase activity Nerve growth factor receptor signaling pathway Signal transducer activity Protein serine/threonine kinase activity Negative regulation of transcription from Pol2 prom Protein tyrosine kinase activity In utero embryonic development Regulatory genes: Transcription, Chromatin, Signaling. Developmental enhancers: embryo, nerve growth
11 Tools for interpreting the human genome Evolutionary signatures Genome annotation Distinct signatures for proteins, ncrnas, mirnas, motifs Read-through, excess-constraint, networks,human selection Chromatin signatures Dynamic regulatory regions Define chromatin states from combinations of histone marks Distinct classes of promoter/enhancer/transcribed/repressed Activity signatures Link enhancer networks Activity-based linking of regulators enhancers targets Testing of 1000s of enhancer activator / repressor motifs Personal genomics Interpret disease mechanism Disease-associations: Mechanistic predictions for variants Beyond top hits: GWAS T1D-associated enhancers Global methylation changes in Alzheimer s: NRSF, ELK1, CTCF
12 Integrate epigenomics datasets in multiple cell types 2. DNA methylation 3. DNA accessibility Epigenomic maps 1. Histone modifications Epigenetic modifications DNA/histone/nucleosome Encode epigenetic state Histone code hypothesis Distinct function for distinct combinations of marks? Hundreds of histone marks Astronomical number of histone mark combinations How do we find biologically relevant ones? Unsupervised approach Probabilistic model Explicit combinatorics
13 Chromatin state dynamics across nine cell types Predicted linking Correlated activity Single annotation track for each cell type Summarize cell-type activity at a glance Can study 9-cell activity pattern across
14 Epigenomics Roadmap: 90 complete epigenomes Interpret GWAS, global effects, reveal relevant cell types
15 Enhancer modules associated with tissue identity Clustering of 500,000 distal enhancers Tissue-specific disease-relevant tissues and processes
16 Dissect motifs in 10,000s of human enhancers measurements (x2 cells, 2x repl) Predict activators/repressors based on activity correlations Validate by engineering enhancers disrupting causal motifs
17 Example activator: conserved HNF4 motif match WT expression specific to HepG2 Motif match disruptions reduce expression to background Non-disruptive changes maintain expression Random changes depend on effect to motif match
18 Tools for interpreting the human genome Evolutionary signatures Genome annotation Distinct signatures for proteins, ncrnas, mirnas, motifs Read-through, excess-constraint, networks,human selection Chromatin signatures Dynamic regulatory regions Define chromatin states from combinations of histone marks Distinct classes of promoter/enhancer/transcribed/repressed Activity signatures Link enhancer networks Activity-based linking of regulators enhancers targets Testing of 1000s of enhancer activator / repressor motifs Personal genomics Interpret disease mechanism Disease-associations: Mechanistic predictions for variants Beyond top hits: GWAS T1D-associated enhancers Global methylation changes in Alzheimer s: NRSF, ELK1, CTCF
19 Revisiting diseaseassociated variants xx Disease-associated SNPs enriched for enhancers in relevant cell types E.g. lupus SNP in GM enhancer disrupts Ets1 predicted activator
20 Variation in methylation patterns largely genotype driven Global signature of repression in 1000s regulatory regions: hypermethylation, enhancer states, brain regulator targets G E D: Global repression of brain enhancers in AD MAP Memory and Aging Project + ROS Religious Order Study Dorsolateral PFC Genotype (1M SNPs x700 ind.) Reference Chromatin states Methylation (450k probes x 700 ind)
21 Global hyper-methylation in 1000s of AD-associated loci P-value Top 7000 probes 480,000 probes, ranked by Alzheimer s association Methylation Alzheimer s-associated probes are hypermethylated Global effect across 1000s of probes Rank all probes by Alzheimer s association 7000 probes increase methylation (repressed) Enriched in brain-specific enhancers Near motifs of brain-specific regulators Complex disease: genome-wide effects
22 Covers computational challenges associated with personal genomics: - genotype phasing and haplotype reconstruction resolve mom/dad chromosomes - exploiting linkage for variant imputation co-inheritance patterns in human population - ancestry painting for admixed genomes result of human migration patterns - predicting likely causal variants using functional genomics from regions to mechanism - comparative genomics annotation of coding/non-coding elements gene regulation - relating regulatory variation to gene expression or chromatin quantitative trait loci - measuring recent evolution and human selection selective pressure shaped our genome - using systems/network information to decipher weak contributions combinatorics - challenge of complex multi-genic traits: height, diabetes, Alzheimer's 1000s of genes
23 MIT Computational Biology group Compbio.mit.edu Mike Lin Matt Eaton Stata3 Stata4 Angela Yen Manolis Kellis Ben Holmes Soheil Feizi Jason Ernst Luke Ward Jessica Wu Bob Altshuler Louisa DiStefano Irwin Jungreis Mukul Bansal Daniel Marbach Sushmita Roy Chris Bristow Dave Hendrix Pouya Kheradpour Rachel Sealfon Loyal Goff Stefan Washietl
Genomic and epigenomic signatures for interpreting complex disease
Genomic and epigenomic signatures for interpreting complex disease Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory TATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA
LisätiedotBasset: Learning the regulatory code of the accessible genome with deep convolutional neural networks. David R. Kelley
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks David R. Kelley DNA codes for complex life. How? Kundaje et al. Integrative analysis of 111 reference
LisätiedotFunctional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
LisätiedotState of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
LisätiedotEukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
Lisätiedot11/17/11. Gene Regulation. Gene Regulation. Gene Regulation. Finding Regulatory Motifs in DNA Sequences. Regulatory Proteins
Gene Regulation Finding Regulatory Motifs in DNA Sequences An experiment shows that when X is knocked out, 20 other s are not expressed How can one have such drastic effects? Regulatory Proteins Gene X
LisätiedotChapter 7. Motif finding (week 11) Chapter 8. Sequence binning (week 11)
Course organization Introduction ( Week 1) Part I: Algorithms for Sequence Analysis (Week 1-11) Chapter 1-3, Models and theories» Probability theory and Statistics (Week 2)» Algorithm complexity analysis
LisätiedotCS284A Representations & Algorithms for Molecular Biology. Xiaohui S. Xie University of California, Irvine
CS284A Representations & Algorithms for Molecular Biology Xiaohui S. Xie University of California, Irvine Today s Goals Course information Challenges in computational biology Introduction to molecular
LisätiedotPlasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
LisätiedotGap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
LisätiedotViral DNA as a model for coil to globule transition
Viral DNA as a model for coil to globule transition Marina Rossi Lab. of complex fluids and molecular biophysics LITA (Segrate) UNIVERSITA DEGLI STUDI DI MILANO - PhD Workshop October 14 th, 2013 Temperature
LisätiedotMALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
LisätiedotFETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
Lisätiedot7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
LisätiedotVIIKKI BIOCENTER University of Helsinki
VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja
LisätiedotMaster's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.2017 Life Science Technologies Where Life Sciences meet with Technology
LisätiedotPredicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy
Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy OVERVIEW- Method updated and written by Sarah Louie (6/19/08) Initially
LisätiedotEfficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
LisätiedotEpigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia
Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays
LisätiedotExperimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
LisätiedotLIFE2000 rahoitettavat hankkeet
LIFE2000 rahoitettavat hankkeet Life 2000 tutkimusohjelmaan on valittu kaikkiaan 37 tutkimushanketta: 13 yksittäishanketta ja 24 konsortiota. Tekes tekee rahoituspäätöksensä sille esitetyistä projektiehdotuksista
LisätiedotCollaborative & Co-Creative Design in the Semogen -projects
1 Collaborative & Co-Creative Design in the Semogen -projects Pekka Ranta Project Manager -research group, Intelligent Information Systems Laboratory 2 Semogen -project Supporting design of a machine system
LisätiedotMethods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
LisätiedotSupporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
Lisätiedot7. Product-line architectures
7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software
LisätiedotGenome 373: Genomic Informatics. Professors Elhanan Borenstein and Jay Shendure
Genome 373: Genomic Informatics Professors Elhanan Borenstein and Jay Shendure Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis
LisätiedotValuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
LisätiedotTieteellinen yhteistyö lääkekehityksessä merkittävistä geenivarianteista (IPHG)
16 BIOPANKKI 16 BIOPANKKI... 1 16.001 Tieteellinen yhteistyö lääkekehityksessä merkittävistä geenivarianteista (IPHG)... 2 16.002 Samuli Ripatti et al.... 2 16.003 Aarno Palotie et al.... 3 16.004 Josine
LisätiedotChapter 9 Motif finding. Chaochun Wei Spring 2019
1896 1920 1987 2006 Chapter 9 Motif finding Chaochun Wei Spring 2019 Contents 1. Reading materials 2. Sequence structure modeling Motif finding Regulatory module finding 2 Reading materials Tompa et al
LisätiedotBioinformatics in Laboratory of Computer and Information Science
HELSINKI UNIVERSITY OF TECHNOLOGY LABORATORY OF COMPUTER AND INFORMATION SCIENCE Bioinformatics in Laboratory of Computer and Information Science Samuel Kaski Research Two centers of excellence of the
Lisätiedotarxiv: v1 [stat.ml] 27 Feb 2011
TKK Dissertations in Information and Computer Science Espoo 2010 TKK-ICS-D19 arxiv:1102.5509v1 [stat.ml] 27 Feb 2011 PROBABILISTIC ANALYSIS OF THE HUMAN TRANSCRIPTOME WITH SIDE INFORMATION Leo Lahti Dissertation
LisätiedotTESTBED FOR NEXT GENERATION REASEARCH & INNOVATION
PUBLIC-PRIVATE PARTNERSHIPS FOR NEW INNOVATIONS ACADEMIC RESEARCH INDUSTRY + PHARMA R&D SPEND Important decisions in drug discovery The Problem: It difficult to develop novel therapies that differentiate
LisätiedotBioinformatics. Sequence Analysis: Part III. Pattern Searching and Gene Finding. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Sequence Analysis: Part III. Pattern Searching and Gene Finding Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18
LisätiedotInferring Trichoderma reesei gene regulatory network
Inferring Trichoderma reesei gene regulatory network Oskari Vinko 29.04.2013 Ohjaaja: Merja Oja Valvoja: Harri Ehtamo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta osin
LisätiedotBiopankit ja Big Data terveydenhuollossa: onko open science magic bullet?
Biopankit ja Big Data terveydenhuollossa: onko open science magic bullet?, LT, tutkimusprofessori Terveyden ja hyvinvoinnin laitos Terveys - osasto Genomiikka ja biomarkkerit - yksikkö markus.perola@thl.fi
LisätiedotSupporting information
Supporting information Figure S1. Carotenoid biosynthesis pathway in papaya fruit which is adopted from Blas et al. (2010) (reference 4) and Nisar et al. (2015) (reference 5). Carotenoids are synthesized
LisätiedotManolis Kellis Piotr Indyk
6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Rapid database search Courtsey of CCRNP, The National Cancer Institute. Manolis Kellis Piotr Indyk Protein interaction network Courtesy
LisätiedotPaikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO
Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO Tomi Kauppinen, Eero Hyvönen, Jari Väätäinen Semantic Computing Research Group (SeCo) http://www.seco.tkk.fi/
LisätiedotSmart specialisation for regions and international collaboration Smart Pilots Seminar
Smart specialisation for regions and international collaboration Smart Pilots Seminar 23.5.2017 Krista Taipale Head of Internaltional Affairs Helsinki-Uusimaa Regional Council Internationalisation
LisätiedotAlternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
LisätiedotKONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
Lisätiedottgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
LisätiedotElintarvikealan tutkimus, kehitys ja innovointi Oulun yliopistossa biotieteen näkökulma Hely Häggman
Elintarvikealan tutkimus, kehitys ja innovointi Oulun yliopistossa biotieteen näkökulma Hely Häggman Lasaretti 29.03.2017 Helsingin, Turun ja Kuopion yliopistoissa voi opiskella elintarvikealaa Elintarvikehygienia:
LisätiedotTelecommunication Software
Telecommunication Software Final exam 21.11.2006 COMPUTER ENGINEERING LABORATORY 521265A Vastaukset englanniksi tai suomeksi. / Answers in English or in Finnish. 1. (a) Määrittele sovellusviesti, PersonnelRecord,
LisätiedotSupplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
LisätiedotOther approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
LisätiedotLYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
LisätiedotStatistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
LisätiedotRiitta Kilpeläinen Elia Liitiäinen Belle Selene Xia University of Eastern Finland Department of Forest Sciences Department of Economics and HECER
Riitta Kilpeläinen Elia Liitiäinen Belle Selene Xia University of Eastern Finland Department of Forest Sciences Department of Economics and HECER Suorat oppimistulosten mittaamistavat Suorat mittaamistavat
LisätiedotCapacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
LisätiedotNaisnäkökulma sijoittamiseen. 24.3.2007 Vesa Puttonen
Naisnäkökulma sijoittamiseen 24.3.2007 Vesa Puttonen Miten sukupuolella voi olla mitään tekemistä sijoittamisen kanssa??? Naiset elävät (keskimäärin) pidempään kuin miehet Naiset saavat (keskimäärin) vähemmän
LisätiedotUse of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
LisätiedotEnterprise Architecture TJTSE Yrityksen kokonaisarkkitehtuuri
Enterprise Architecture TJTSE25 2009 Yrityksen kokonaisarkkitehtuuri Jukka (Jups) Heikkilä Professor, IS (ebusiness) Faculty of Information Technology University of Jyväskylä e-mail: jups@cc.jyu.fi tel:
LisätiedotBDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET.
BDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET. Pekka Ollikainen Open Source Microsoft CodePlex bio Verkkosivustovastaava Suomen Sarjakuvaseura
LisätiedotVIIKKI BIOCENTER University of Helsinki
VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri
LisätiedotGOOD WORK LONGER CAREER:
Juhani Ilmarinen, Ville Ilmarinen, Pekka Huuhtanen, Veikko Louhevaara, Ove Näsman GOOD WORK LONGER CAREER: WORK WELL-BEING IN FINNISH TECHNOLOGY INDUSTRIES 2010-2015 Background Collective agreement between
LisätiedotUusi rekisteripohjainen diabetesluokitus kohti täsmähoitoa
Uusi rekisteripohjainen diabetesluokitus kohti täsmähoitoa 26.9.2016 Annemari Käräjämäki Sidonnaisuudet kahden viimeisen vuoden ajalta LL, yleislääketieteen erikoislääkäri Työantajat Vaasan keskussairaala,
LisätiedotA new model of regional development work in habilitation of children - Good habilitation in functional networks
A new model of regional development work in habilitation of children - Good habilitation in functional networks Salla Sipari, PhD, Principal Lecturer Helena Launiainen, M.Ed, Manager Helsinki Metropolia
LisätiedotLand-Use Model for the Helsinki Metropolitan Area
Land-Use Model for the Helsinki Metropolitan Area Paavo Moilanen Introduction & Background Metropolitan Area Council asked 2005: What is good land use for the transport systems plan? At first a literature
LisätiedotVAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto Tämän viestinnän, nykysuomen ja englannin kandidaattiohjelman valintakokeen avulla Arvioidaan viestintävalmiuksia,
LisätiedotBounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
LisätiedotTupakointi ja geenit. Jaakko Kaprio HY ja KTL
Tupakointi ja geenit Jaakko Kaprio HY ja KTL Kansantautien geneettinen tausta Monitekijäisiä Mikä on geenien merkitys Miten tauti periytyy? (yksi geeni vai monitekijäinen tauti)? Tavoitteeni tunnistaa
LisätiedotCo-Design Yhteissuunnittelu
Co-Design Yhteissuunnittelu Tuuli Mattelmäki DA, associate professor Aalto University School of Arts, Design and Architecture School of Arts, Design and Architecture design with and for people Codesign
LisätiedotLataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli. Lataa
Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli Lataa Kirjailija: Pekka Rapeli ISBN: 9789523022232 Sivumäärä: 173 Formaatti: PDF Tiedoston koko: 11.54 Mb Opioid substitution
LisätiedotELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period
1 ELEMET- MOCASTRO Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions Period 20.02-25.05.2012 Diaarinumero Rahoituspäätöksen numero 1114/31/2010 502/10
LisätiedotBiopankit ja Big Data terveydenhuollossa: onko open science magic bullet?
Biopankit ja Big Data terveydenhuollossa: onko open science magic bullet?, LT, tutkimusprofessori Terveyden ja hyvinvoinnin laitos Terveys - osasto Genomiikka ja biomarkkerit - yksikkö markus.perola@thl.fi
LisätiedotMUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LisätiedotTechnische Daten Technical data Tekniset tiedot Hawker perfect plus
Technische Daten Technical data Tekniset tiedot Hawker perfect plus PzS-Zellen Hawker perfect plus, mit Schraubverbindern, Abmessungen gemäß DIN/EN 60254-2 und IEC 254-2 Serie L PzS-cells Hawker perfect
LisätiedotLANSEERAUS LÄHESTYY AIKATAULU OMINAISUUDET. Sähköinen jäsenkortti. Yksinkertainen tapa lähettää viestejä jäsenille
tiedote 2 / 9.3.2017 LANSEERAUS LÄHESTYY AIKATAULU 4.3. ebirdie-jäsenkortti esiteltiin Golfliiton 60-vuotisjuhlaseminaarissa 17.3. ebirdie tulee kaikkien ladattavaksi Golfmessuilla 17.3. klo 12:00 alkaen
LisätiedotGenomin ilmentyminen
Kauppi 17/01/2014 Genomin ilmentyminen LH1, Molekyylibiologia 17.1.2014 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Huone C501b, Biomedicum 1 Transkriptiofaktorin mutaatio voi
LisätiedotUusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
LisätiedotIAA Regulation Committee
IAA Regulation Committee Mikä IRC on? Insurance Regulation Committee Insurance Regulation Committee ORSA Working Group Insurance Regulation Committee Reinsurance Insurance Regulation Committee Solvency
LisätiedotToimintamallit happamuuden ennakoimiseksi ja riskien hallitsemiseksi turvetuotantoalueilla (Sulfa II)
Toimintamallit happamuuden ennakoimiseksi ja riskien hallitsemiseksi turvetuotantoalueilla (Sulfa II) Happamuuskuormituksen ennustaminen valuma-aluetasolla Marie Korppoo ja Markus Huttunen 13.5.2019 Päämäärä
LisätiedotInnovation Platform Thinking Jukka P. Saarinen Mika M. Raunio Nadja Nordling Taina Ketola Anniina Heinikangas Petri Räsänen
Innovation Platform Thinking 17.6.2015 Jukka P. Saarinen Mika M. Raunio Nadja Nordling Taina Ketola Anniina Heinikangas Petri Räsänen Motivation for platform thinking... Normal project with different phases:
LisätiedotSFS/SR315 Tekoäly Tekoälyn standardisointi
SFS/SR315 Tekoäly Tekoälyn standardisointi Meri Seistola Toiminnanjohtaja, Mediakasvatuskeskus Metka ry SR 315 Tekoäly - Puheenjohtaja: Jarkko Vesa 1 SC42 Artificial Intelligence ISO/IEC JTC1 SC42 Artificial
LisätiedotDigitally signed by Hans Vadbäck DN: cn=hans Vadbäck, o, ou=fcg Suunnittelu ja Tekniikka Oy, email=hans.vadback@fcg.fi, c=fi Date: 2016.12.20 15:45:35 +02'00' Jakob Kjellman Digitally signed by Jakob Kjellman
LisätiedotNational Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
LisätiedotBLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
LisätiedotSearching (Sub-)Strings. Ulf Leser
Searching (Sub-)Strings Ulf Leser This Lecture Exact substring search Naïve Boyer-Moore Searching with profiles Sequence profiles Ungapped approximate search Statistical evaluation of search results Ulf
LisätiedotELINPATOLOGIAN RYHMÄOPETUS MUNUAINEN
ELINPATOLOGIAN RYHMÄOPETUS MUNUAINEN KYSYMYKSET: 1. Glomeruluksen rakenne. Mihin seikkoihin perustuu valikoiva läpäiseväisyys veri- ja virtsatilan välillä? 2. Glomerulusvaurion mekanismit A. Immunologiset
LisätiedotOstamisen muutos muutti myynnin. Technopolis Business Breakfast 21.8.2014
Ostamisen muutos muutti myynnin Technopolis Business Breakfast 21.8.2014 Taking Sales to a Higher Level Mercuri International on maailman suurin myynnin konsultointiyritys. Autamme asiakkaitamme parantamaan
LisätiedotSärmäystyökalut kuvasto Press brake tools catalogue
Finnish sheet metal machinery know-how since 1978 Särmäystyökalut kuvasto Press brake tools catalogue www.aliko.fi ALIKO bending chart Required capacity in kn (T) in relation to V-opening. V R A S = plates
LisätiedotDigitalisaation ja IT:n johtamisen vaatimat kyvykkyydet ja osaamisen kehittäminen
ISM-opiskelijat: Digitalisaation ja IT:n johtamisen vaatimat kyvykkyydet ja osaamisen kehittäminen Emma Falck, Joona Åström, Teemu Laiho & Roni Luoma ILF - IAC Iltapuhde 11.9.2018 ISM - Information and
LisätiedotGLP-vaatimukset ATMP-valmisteiden turvallisuustutkimuksille
GLP-vaatimukset ATMP-valmisteiden turvallisuustutkimuksille Tiina Palomäki Fimea 2.9.2015 Advanced therapy medicinal products (ATMPs) Somatic cell therapy medicinal products Tissue engineered products
LisätiedotLD Score regression for estimating and partitioning heritability of lipid levels in the Finnish population
LD Score regression for estimating and partitioning heritability of lipid levels in the Finnish population Heidi Marika Hautakangas Master s thesis Statistics Department of Mathematics and Statistics University
LisätiedotProAgria. Opportunities For Success
ProAgria Opportunities For Success Association of ProAgria Centres and ProAgria Centres 11 regional Finnish ProAgria Centres offer their members Leadership-, planning-, monitoring-, development- and consulting
LisätiedotSomaattinen sairaus nuoruudessa ja mielenterveyden häiriön puhkeamisen riski
+ Somaattinen sairaus nuoruudessa ja mielenterveyden häiriön puhkeamisen riski LINNEA KARLSSON + Riskitekijöitä n Ulkonäköön liittyvät muutokset n Toimintakyvyn menetykset n Ikätovereista eroon joutuminen
LisätiedotInfrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
LisätiedotMitä Piilaaksossa & globaalisti tapahtuu ja mitä Tekes voi tarjota yrityksille
KASVAVAT MOBIILI-MARKKINAT: Mitä Piilaaksossa & globaalisti tapahtuu ja mitä Tekes voi tarjota yrityksille HITECH BUSINESS BREAKFAST, Oulu 10.2.2010 Kari Inberg Liiketoiminta-asiantuntija / Tekes-palvelut
LisätiedotBenchmarking Controlled Trial - a novel concept covering all observational effectiveness studies
Benchmarking Controlled Trial - a novel concept covering all observational effectiveness studies Antti Malmivaara, MD, PhD, Chief Physician Centre for Health and Social Economics National Institute for
LisätiedotLiikunnan vaikuttavuus ja kuntoutus
Liikunnan vaikuttavuus ja kuntoutus Urho Kujala Liikuntalääketieteen erikoislääkäri Liikuntalääketieteen professori Terveystieteiden yksikkö, Liikuntatieteellinen tiedekunta Jyväskylän yliopisto urho.m.kujala@jyu.fi
LisätiedotWAMS 2010,Ylivieska Monitoring service of energy efficiency in housing. 13.10.2010 Jan Nyman, jan.nyman@posintra.fi
WAMS 2010,Ylivieska Monitoring service of energy efficiency in housing 13.10.2010 Jan Nyman, jan.nyman@posintra.fi Background info STOK: development center for technology related to building automation
LisätiedotEncapsulation. Imperative programming abstraction via subprograms Modular programming data abstraction. TTY Ohjelmistotekniikka
Encapsulation Imperative programming abstraction via subprograms Modular programming data abstraction Encapsulation grouping of subprograms and the data they manipulate Information hiding abstract data
LisätiedotRANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla
TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua
LisätiedotTIEKE Verkottaja Service Tools for electronic data interchange utilizers. Heikki Laaksamo
TIEKE Verkottaja Service Tools for electronic data interchange utilizers Heikki Laaksamo TIEKE Finnish Information Society Development Centre (TIEKE Tietoyhteiskunnan kehittämiskeskus ry) TIEKE is a neutral,
LisätiedotElixir of life Elixir for Mind and Body
Elixir of life Elixir for Mind and Body Session C: Horizontality of Industries and future services SHOK Summit April 20th, 2010 Katja Hatakka, PhD, Development Manager, Valio R&D Case Susan Facts about
LisätiedotGenomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma
Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LisätiedotKuolevaisuuden & Kuolemattomuuden Biologia
Kuolevaisuuden & Kuolemattomuuden Biologia Seppo Vainio Kehitysbiologian professori Oulun yliopisto, Biocenter Oulu Suomen Akatemian Solu-Matrix Tutkimuksen Huippuyksikkö 2012-2017 Finnish pioneers in
Lisätiedot