1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
|
|
- Tuomo Ahonen
- 6 vuotta sitten
- Katselukertoja:
Transkriptio
1 START
2 START
3 SIT
4 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise.
5 SIT STAND
6 2. SIT STAND. The handler and dog stop with the dog sitting at heel. The handler then cues the dog to stand. When the dog is standing, the handler cues the dog to heel forward. This is a static exercise.
7 SIT DOWN
8 3. SIT DOWN. The handler and dog stop with the dog sitting at heel. The handler then cues the dog to down. When the dog is down, the handler cues the dog to heel forward. This is a static exercise.
9 SIT DOWN SIT
10 4. SIT DOWN SIT. The first part of this exercise is performed as described in Exercise 3. When the dog is down, the handler cues the dog into a sit position. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise.
11 RIGHT TURN
12 5. RIGHT TURN. This is an accurate 90-degree right turn.
13 LEFT TURN
14 6. LEFT TURN. This is an accurate 90-degree left turn.
15 ABOUT TURN RIGHT
16 7. ABOUT TURN RIGHT. This is a 180-degree accurate turn to the handler s right.
17 ABOUT TURN LEFT
18 8. ABOUT TURN LEFT. This is a 180-degree accurate turn to the handler s left.
19 270º RIGHT
20 DEGREE RIGHT (Turn). While heeling, the dog/handler team makes a 270-degree turn that begins to the handler s right. The final direction taken toward the next exercise is to the left of the dog/handler team s original position.
21 360º RIGHT
22 DEGREE RIGHT (Turn). While heeling, the dog/handler team makes a 360-degree turn (a complete circle) that begins to the handler s right. The final direction is the same as that of the dog/handler team before starting the exercise.
23 CALL FRONT FORWARD RIGHT
24 11. CALL FRONT FORWARD RIGHT. While heeling the handler stops his/her forward motion approximately level with the sign and calls the dog to the front position. The dog continues to move during this portion of the exercise the dog does not sit as it goes to the front position. The handler may step backwards as the dog turns and moves to sit in front of and facing the handler. The backward movement of the handler must be no more than three steps taken straight back. The handler is not to move to the side to position him/herself in front of the dog; the dog must move to sit directly in front of the handler. The dog may go past the sign to accomplish this. For the second part of the exercise, the handler cues the dog to move from the front position to the handler s right, around behind the handler and into the heel position as the handler continues forward. The dog does not sit in the heel position.
25 CALL FRONT FORWARD LEFT
26 12. CALL FRONT FORWARD LEFT. The Call Front part of this exercise is performed as in Exercise 11. For the second part, the handler cues the dog to move from the front position to the handler s left and into the heel position as the handler continues forward. The dog does not sit and the handler moves forward as the dog comes into heel position.
27 CALL FRONT FINISH RIGHT
28 13. CALL FRONT FINISH RIGHT. The Call Front portion of this exercise is performed as in Exercise 11. For the second part, the handler cues the dog to finish by moving from the front position to the handler s right, around behind the handler and finally sitting in the heel position. The handler then cues the dog to heel and moves forward. This is a static exercise.
29 CALL FRONT FINISH LEFT
30 14. CALL FRONT FINISH LEFT. The Call Dog Front portion of this exercise is performed as in Exercise 11. For the second part, the handler cues the dog to finish, moving from the front position to the handler s left, and sitting in the heel position. The handler then cues the dog to heel and moves forward. This is a static exercise.
31 SLOW PACE
32 15. SLOW PACE. As the dog/handler team draw level with the sign they decrease their pace so that there is a noticeable difference from the dog s normal pace. In Level 1-5 this exercise must be followed by Exercise 17 (Normal Pace), or it may be placed as the last exercise on the course, in which case the exercise and performance are concluded as the dog/handler team crosses the Finish Line. In Level 6 it is permissible for this exercise to be followed by either Exercise 5 (Right Turn) or Exercise 6 (Left Turn) but this must then be followed by either Exercise 17 (Normal Pace) or the Finish sign.
33 FAST PACE
34 16. FAST PACE. As the dog/handler team draw level with the sign they increase their pace so that there is a noticeable difference from the dog s normal pace. This exercise must be followed by Exercise 17 (Normal Pace), or it may be placed as the last exercise on the course, in which case the exercise and performance are concluded as the dog/handler team crosses the Finish Line. This exercise requires approximately 4 metres between Exercise 16 (Fast Pace) and Exercise 17 (Normal Pace) or the Finish.
35 NORMAL PACE
36 17. NORMAL PACE. As the dog/handler team draw level with the sign they move forward at a normal pace that is comfortable for the dog and handler. NB: At Levels 1 and 2 this is a separate exercise but at Level 3 or above the change in pace and return to normal pace is judged as one complete exercise.
37 MOVING SIDE STEP RIGHT
38 18. MOVING SIDE STEP RIGHT. While heeling past the sign, the handler takes one diagonal step with his/her right foot, forward and to the right with the sign on the right. The handler then steps with the left foot, also forward and to the right, along the newly established line. The exercise is performed AFTER the sign.
39 SIT RIGHT TURN FORWARD
40 19. SIT RIGHT TURN FORWARD. The handler and dog stop with the dog sitting at heel. They then execute a 90 degree turn to the handler s right, the dog moves with the handler as they turn. They then heel forward.
41 SIT LEFT TURN FORWARD
42 20. SIT LEFT TURN FORWARD. The handler and dog stop with the dog sitting at heel. They then execute a 90 degree turn to the handler s left, the dog moves with the handler as they turn. They then heel forward.
43 FIGURE 8
44 21. FIGURE 8. Four cones are placed in a straight line approximately 1.5 metres apart. The sign is placed near the first cone in the line. Entry into the weaving pattern is between the first and second cone with the first cone on the dog/handler team s left. Dog and handler weave through the cones, loop the end cone and weave back to the beginning of the pattern. The exit direction from the pattern is dependent on the placement of the next exercise.
45 SERPENTINE
46 22. SERPENTINE. Four cones are placed in a straight line approximately 1.5 metres apart. The dog/handler team enters with the first cone on their left, weaves through the cones and exits at the last cone. The dog/handler team does not weave back through the cones.
47 FINISH
48 FINISH
49 BONUS
50 BONUS
51 BONUS CALL FRONT SIDE STEP RIGHT/LEFT
52 BONUS EXERCISE 1. CALL FRONT SIDE STEP RIGHT OR LEFT. The Call Front part of this exercise is performed as in Exercise 11. Once the dog is sitting in front, the handler takes one full step to either the right or left. The dog must move sideways with the handler and after moving, must sit in the front position. Once the dog has moved sideways and is sitting in front, the exercise is complete.
53 BONUS CALL FRONT TURN RIGHT/LEFT
54 BONUS EXERCISE 2. CALL FRONT TURN RIGHT OR LEFT. The Call Front part of this exercise is performed as in Exercise 11. Once the dog is sitting in front, the handler executes a 90 degree turn to the left or the right. The dog moves with the handler and sits in the front position once the handler has executed their turn. The dog should stand up to execute the turn. The handler may take up to three steps backwards.
55 BONUS SIT 3 STEPS SIT
56 BONUS EXERCISE 3. SIT 3 STEPS SIT. The handler and dog stop with the dog sitting at heel. The handler cues the dog to move and takes three steps forward, then stops with the dog sitting at heel.
Exercise 1. (session: )
EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You
Ajettavat luokat: SM: S1 (25 aika-ajon nopeinta)
SUPERMOTO SM 2013 OULU Lisämääräys ja ohje Oulun Moottorikerho ry ja Oulun Formula K-125ry toivottaa SuperMoto kuljettajat osallistumaan SuperMoto SM 2013 Oulu osakilpailuun. Kilpailu ajetaan karting radalla
Counting quantities 1-3
Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X. Rastita Tick (X) (X) the kummassa box that has laatikossa
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting
FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
Peruskuviot WDSF IDTA ISTD
Valssi Peruskuviot 1 Natural Turn N (123) (123) x x x 2 Reverse Turn N (123) (123) x x x 3 Closed Changes N 123 x x x 4 Outside Change N, N-P 123 x x x 5 Whisk N-P 123 x x x 6 Chasse from PP P-N 12&3 x
Small Number Counts to 100. Story transcript: English and Blackfoot
Small Number Counts to 100. Story transcript: English and Blackfoot Small Number is a 5 year-old boy who gets into a lot of mischief. He lives with his Grandma and Grandpa, who patiently put up with his
Siirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools
Siirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools Akateemisten asioiden komitea Academic Affairs Committee 11 October 2016 Eija Zitting
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site
Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site Note! Before starting download and install a fresh version of OfficeProfessionalPlus_x64_en-us. The instructions are in the beginning of the exercise.
SAGA 150. Asennusohjeet. Mittaa oven korkeus. Piirrä seinään oven kiinni -päätyyn seinäkannattimen kohdalle vaakaviiva korkeudelle ovi + 75mm + 20 mm.
SAGA 150 Asennusohjeet 500 1 2 Mittaa oven korkeus. Piirrä seinään oven kiinni -päätyyn seinäkannattimen kohdalle vaakaviiva korkeudelle ovi + 75mm + 20 mm. 3 Piirrä vesivaa an avulla viiva myös kiskon
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Huom. tämä kulma on yhtä suuri kuin ohjauskulman muutos. lasketaan ajoneuvon keskipisteen ympyräkaaren jänteen pituus
AS-84.327 Paikannus- ja navigointimenetelmät Ratkaisut 2.. a) Kun kuvan ajoneuvon kumpaakin pyörää pyöritetään tasaisella nopeudella, ajoneuvon rata on ympyränkaaren segmentin muotoinen. Hitaammin kulkeva
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
SUOMEN TANSSINOPETTAJAIN LIITTO STOL ry TANSSIURHEILUAOKSEN 2. ASTEEN TUTKINTO ELI DIPLOMITUTKINTO
SUOMEN TANSSINOPETTAJAIN LIITTO STOL ry TANSSIURHEILUAOKSEN 2. ASTEEN TUTKINTO ELI DIPLOMITUTKINTO TUTKINTOVAATIMUKSET A. Tutkintoon osallistuminen B. Tutkintovaatimukset C. Tutkinnon arviointi ja todistus
S-55.1100 SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA
S-55.00 SÄHKÖKNKKA A KONKKA. välikoe 2..2008. Saat vastata vain neljään tehtävään!. aske jännite U. = 4 Ω, 2 = Ω, = Ω, = 2, 2 =, = A, 2 = U 2 2 2 2. ännitelähde tuottaa hetkestä t = t < 0 alkaen kaksiportaisen
The Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
Counting quantities 1-3
Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X 2. Rastita Tick (X) (X) the kummassa box that has
Tietoa Joensuun Eliittikisoista
Tietoa Joensuun Eliittikisoista Harjoittelu ja verryttely Yleisurheilukenttä (Keskuskenttä) Kisan aikana Joensuu Areena + kuntosali Pesäpallokenttä ja Louhelan kenttä heitoille Uimahalli Vesikko + kuntosali
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?
Curriculum. Gym card
A new school year Curriculum Fast Track Final Grading Gym card TET A new school year Work Ethic Detention Own work Organisation and independence Wilma TMU Support Services Well-Being CURRICULUM FAST TRACK
You can check above like this: Start->Control Panel->Programs->find if Microsoft Lync or Microsoft Lync Attendeed is listed
Online Meeting Guest Online Meeting for Guest Participant Lync Attendee Installation Online kokous vierailevalle osallistujalle Lync Attendee Asennus www.ruukki.com Overview Before you can join to Ruukki
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto If you are searched for a book by Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice over LTE (VoLTE) in pdf form, then you have come
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
Matkustaminen Liikkuminen
- Sijainti I am lost. Et tiedä missä olet. Can you show me where it is on the map? Tietyn sijainnin kysymistä kartalta Where can I find? Tietyn rakennuksen / n sijainnin tiedustelu I am lost. Can you show
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
Timing D-SAMBA Hold Feet Comments Time/s
SAMBA D KOREOGRAFIA Nr Timing D-SAMBA Hold Feet Comments Time/s 1 1a2 Whisk to L A LF, (RF) 1,2 2 3a4 Whisk to R A RF, (LF) 2,4 3 5a6 Whisk to L (Lady's Spot Turn to R under left arm) B LF, (RF) 3,6 4
S Sähkön jakelu ja markkinat S Electricity Distribution and Markets
S-18.3153 Sähkön jakelu ja markkinat S-18.3154 Electricity Distribution and Markets Voltage Sag 1) Kolmivaiheinen vastukseton oikosulku tapahtuu 20 kv lähdöllä etäisyydellä 1 km, 3 km, 5 km, 8 km, 10 km
Salasanan vaihto uuteen / How to change password
Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change
KMTK lentoestetyöpaja - Osa 2
KMTK lentoestetyöpaja - Osa 2 Veijo Pätynen 18.10.2016 Pasila YHTEISTYÖSSÄ: Ilmailun paikkatiedon hallintamalli Ilmailun paikkatiedon hallintamalli (v0.9 4.3.2016) 4.4 Maanmittauslaitoksen rooli ja vastuut...
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Valuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
1.3Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 81122P (4 ov.) 30.5.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
Virtually Oy. Laadukas tyynysarja vaativaan käyttöön IMMOBILISAATIO. Arpegia. y-tunnus: puh.
Arpegia 07/1340 Taille 1 long. 200 cm haut. 18 cm 07/1345 Taille 2 long. 245 cm haut. 18 cm 07/1350 Taille 3 long. 280 cm haut. 18 cm 07/1440 Taille 1 long. 200 cm haut. 10 cm 07/1445 Taille 2 long. 245
03 PYÖRIEN SIIRTÄMINEN
78 03 PYÖRIEN SIIRTÄMINEN Wheels and tyres are heavy. Their handling may involve heavy lifting at the workshop. We have developed a logical ergonomic method for transporting wheels. The focus here is our
Rotarypiiri 1420 Piiriapurahoista myönnettävät stipendit
Rotarypiiri 1420 Piiriapurahoista myönnettävät stipendit Ø Rotarypiiri myöntää stipendejä sille osoitettujen hakemusten perusteella ensisijaisesti rotaryaatteen mukaisiin tarkoituksiin. Ø Stipendejä myönnetään
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
Opiskelijoiden ajatuksia koulun alkuun liittyen / students thoughts about the beginning of their studies at KSYK
Opiskelijoiden ajatuksia koulun alkuun liittyen / students thoughts about the beginning of their studies at KSYK Helppoa/mukavaa/palkitsevaa - easy/nice/rewarding - uudet ystävät/ new friends - koulun
SIMULINK S-funktiot. SIMULINK S-funktiot
S-funktio on ohjelmointikielellä (Matlab, C, Fortran) laadittu oma algoritmi tai dynaamisen järjestelmän kuvaus, jota voidaan käyttää Simulink-malleissa kuin mitä tahansa valmista lohkoa. S-funktion rakenne
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
21~--~--~r--1~~--~--~~r--1~
- K.Loberg FYSE420 DIGITAL ELECTRONICS 13.05.2011 1. Toteuta alla esitetyn sekvenssin tuottava asynkroninen pun. Anna heratefunktiot, siirtotaulukko ja kokonaistilataulukko ( exitation functions, transition
MUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
26. - 27.5.2012. Roadbook
26. - 27.5.2012 Roadbook Sisällysluettelo - Index - 3 - Sivu Page Reittimerkkien selitteet / Route marker descriptions 4 Roadbook sivun merkintöjen selite / Roadbook entry description 6 Tehtävämerkkien
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
The Fastest Kid on Albert Street
The Fastest Kid on Albert Street by Melanie Rook Welling 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 I m the fastest kid on Albert Street! yelled Matt. Oh, really? said Kelsey. You think so? It was Saturday afternoon.
Exercise 3. (session: )
1 EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 3 (session: 7.2.2017) Problem 3 will be graded. The deadline for the return is on 28.2. at 12:00 am (before the exercise session). You
1.3 Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 811122P (5 op.) 12.12.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
PAINEILMALETKUKELA-AUTOMAATTI AUTOMATIC AIR HOSE REEL
MAV4 MAV5 MAV6 PAINEILMALETKUKELA-AUTOMAATTI AUTOMATIC AIR HOSE REEL Käyttöohje Instruction manual HUOMIO! Lue käyttöohjeet huolellisesti ennen laitteen käyttöä ja noudata kaikkia annettuja ohjeita. Säilytä
WindPRO version joulu 2012 Printed/Page :47 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
Matkustaminen Liikkuminen
- Sijainti I am lost. Et tiedä missä olet. Can you show me where it is on the map? Tietyn sijainnin kysymistä kartalta Where can I find? Tietyn rakennuksen / n sijainnin tiedustelu... a bathroom?... a
2_1----~--~r--1.~--~--~--,.~~
K.Loberg FYSE420 DIGITAL ELECTRONICS 3.06.2011 1. Toteuta alia esitetyn sekvenssin tuottava asynkroninen pun. Anna heditefunktiot, siirtotaulukko ja kokonaistilataulukko ( exitation functions, transition
Metsälamminkankaan tuulivoimapuiston osayleiskaava
VAALAN KUNTA TUULISAIMAA OY Metsälamminkankaan tuulivoimapuiston osayleiskaava Liite 3. Varjostusmallinnus FCG SUUNNITTELU JA TEKNIIKKA OY 12.5.2015 P25370 SHADOW - Main Result Assumptions for shadow calculations
4x4cup Rastikuvien tulkinta
4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.9.269
Travel Getting Around
- Location I am lost. Not knowing where you are Can you show me where it is on the map? Asking for a specific location on a map Where can I find? Asking for a specific Olen eksyksissä. Voisitko näyttää
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 5.11.2013 16:44 / 1 Minimum
Lab A1.FARM_Hyper-V.v3
Lab A1.FARM_Hyper-V Installing SharePoint Server 2013 SharePoint Server 2013 -asennus Scenario To install and configure SharePoint 2013 on a single server (Server 2012, AD and SQL Server), you will follow
( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145
OX2 9 x N131 x HH145 Rakennuskanta Asuinrakennus Lomarakennus Liike- tai julkinen rakennus Teollinen rakennus Kirkko tai kirkollinen rak. Muu rakennus Allas Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 2 km
Alueellinen yhteistoiminta
Alueellinen yhteistoiminta Kokemuksia alueellisesta toiminnasta Tavoitteet ja hyödyt Perusterveydenhuollon yksikön näkökulmasta Matti Rekiaro Ylilääkäri Perusterveydenhuollon ja terveyden edistämisen yksikkö
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto Tämän viestinnän, nykysuomen ja englannin kandidaattiohjelman valintakokeen avulla Arvioidaan viestintävalmiuksia,
Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä
Arkkitehtuuritietoisku eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Esikysymys Kuinka moni aikoo suunnitella projektityönsä arkkitehtuurin? Onko tämä arkkitehtuuria?
Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a
, Tuulivoimahanke Layout 9 x N131 x HH145 Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 km 2 SHADOW - Main Result Assumptions for shadow calculations
Travel Getting Around
- Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?
WindPRO version joulu 2012 Printed/Page :42 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 13.6.2013 19:42 / 1 Minimum
TIKIT a) Suorassa tikissä ristiommel jää nahan alle piiloon. b) Ristitikissä ommel jää näkyviin.
CML WHEEL COVER -RUORINAHKAN OMPELUOHJE Liota nahkoja lämpimässä vedessä n. 15 minuuttia ennen ompelua. Pidä nahka kosteana koko ompelun ajan esim. sumutepullolla. Pidä ommellessa kevyt kireys nahkaan,
TM ETRS-TM35FIN-ETRS89 WTG
VE1 SHADOW - Main Result Calculation: 8 x Nordex N131 x HH145m Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please
OP1. PreDP StudyPlan
OP1 PreDP StudyPlan PreDP The preparatory year classes are in accordance with the Finnish national curriculum, with the distinction that most of the compulsory courses are taught in English to familiarize
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
1/4. Resetointi ja vianmääritys. 22.11.2013 ntr
A400-64176 Sähköpöydät 1/4 Resetointi ja vianmääritys Pöydän resetointi tehdään aina ennen käyttöönottoa ja tarvittaessa häiriötilanteessa. Määritä pöydän tyyppi käyttökytkimen ja jalustan mukaan ja tee
Karkaavatko ylläpitokustannukset miten kustannukset ja tuotot johdetaan hallitusti?
For professional use only Not for public distribution Karkaavatko ylläpitokustannukset miten kustannukset ja tuotot johdetaan hallitusti? 08.02.2012 Jyrki Merjamaa, Head of Asset Management Aberdeen Asset
Toppila/Kivistö 10.01.2013 Vastaa kaikkin neljään tehtävään, jotka kukin arvostellaan asteikolla 0-6 pistettä.
..23 Vastaa kaikkin neljään tehtävään, jotka kukin arvostellaan asteikolla -6 pistettä. Tehtävä Ovatko seuraavat väittämät oikein vai väärin? Perustele vastauksesi. (a) Lineaarisen kokonaislukutehtävän
Sääntöseminaari Mitä teen?
Sääntöseminaari 2019 Mitä teen? Muista Mitä epävarmempi kilpailunjohtaja, sitä enemmän tarvitaan sääntöjä Lähtö SW 4.4 Interpretation issued on 7th September 2015: After all swimmers are stationary (SW
Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä
M a t t i K a t t a i n e n O T M 1 1. 0 9. 2 0 1 9 Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä Ympäristöoikeustieteen
,0 Yes ,0 120, ,8
SHADOW - Main Result Calculation: Alue 2 ( x 9 x HH120) TuuliSaimaa kaavaluonnos Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
OFFICE 365 OPISKELIJOILLE
OFFICE 365 OPISKELIJOILLE Table of Contents Articles... 3 Ohjeet Office 365 käyttöönottoon... 4 One Driveen tallennetun videon palauttaminen oppimisympäristön palautuskansioon... 5 Changing default language
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 22.12.2014 11:33 / 1 Minimum
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Calculation: N117 x 9 x HH141 Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
THE NEW SHELTER PROJECT. PRO ANIMALS ROMANIA & PRO ANIMALS FINLAND The project continues as soon as funds are collected to do so
The new shelter area of Pro Animals Romania in April 2011 Pro Animals Romanian uuden tarhan aluetta huhtikuussa 2011 THE NEW SHELTER PROJECT PRO ANIMALS ROMANIA & PRO ANIMALS FINLAND 2011-2012 The project
FI GB. Asennus-, käyttöohjeet. Installation, operation instructions
FI GB Asennus-, käyttöohjeet Installation, operation instructions Asennus FI Keinuripustuksen asennus Tekstin sulkeissa olevat numerot viittaavat kuvien 1, 2, 3 ja 4 numerointiin. Kiinnitä keinuripustuksen
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
MEETING PEOPLE COMMUNICATIVE QUESTIONS
Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.
Biojätteen keruu QuattroSelect - monilokerojärjestelmällä. 21.10.2015 Tiila Korhonen SUEZ
Biojätteen keruu QuattroSelect - monilokerojärjestelmällä 21.10.2015 Tiila Korhonen SUEZ Agenda 1 SITA Suomi on SUEZ 2 QS, mikä se on? 3 QS maailmalla 4 QS Suomessa 5 QS Vaasassa SITA Suomi Oy ja kaikki