Eukaryotic Comparative Genomics
|
|
|
- Aili Järvenpää
- 5 vuotta sitten
- Katselukertoja:
Transkriptio
1 Eukaryotic Comparative Genomics
2 Detecting Conserved Sequences Charles Darwin Motoo Kimura
3 Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T T GC A G GA GT A GT C G T A * * * * * * * * * * * * * * * * * * * * * * * * *
4 Evolution of Non-Neutral DNA A CT T AG T C CG A T G T G CG T A C C G A C C A T A AG G A TG AC C A * C GT A T AC C A T G T G G T A TC C G AT C C A T A A G CA T A CT * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
5 Multi-Species Alignment ATGTGGCGCAGCCTGTGCCAGCTGGACGATCGA ATGTAGCCTAGCCAGTGCCAGCTGGACGATCGA GTACATCGATAGCTTAGAATGCTGGACGATCTC GTACGTCGATAGCATAGAATGCTGGACGATCTC * * * * ***********
6 How to do Comparative Genomics 1. Choose species to analyze 2. Align sequences 3. Identify streches of highly conserved nucleotides
7 Choose species closely related species distantly related species Closely Related Species align well not many changes Distantly Related Species hard to align lots of changes
8 ~10Mya ~20Mya S.cerevisiae S. cariocanus S. paradoxus S. mikatae S. kudriavzevii S. bayanus S. pastorianus S. servazzii S. unisporus S. exiguus S. diarenensis S. castellii S. kluyveri ~150Mya >350Mya Kluyveromyces lactis Schizosaccharomyces pombe
9 Case Study: Coding vs.non-coding ATG. ORF TAA Non-Coding DNA -regulatory functions -short (5-15 bp) -degenerate -variable spacing Coding DNA -codes for protein -triplet code -open reading frame (ORF) -tend to be long ( bp) -highly constrained
10 CASE 1: Non-Coding ATG GAL4 TAA
11 ~10Mya ~20Mya S.cerevisiae S. cariocanus S. paradoxus S. mikatae S. kudriavzevii S. bayanus S. pastorianus S. servazzii S. unisporus S. exiguus S. diarenensis S. castellii S. kluyveri ~150Mya >350Mya Kluyveromyces lactis Schizosaccharomyces pombe
12 Closely-related sequences are uninformative ATG GAL4 paradoxus TCTTCTGAGACAGCATCACTTCTTCTTNTTTTTTACATAACTTATTCTTCTATAATTTTC cerevisiae TCCTTTGAGACAGCATTCGCCCAGTATTTTTTTTATTCTACA-AACCTTCTATAATTT-C ** * *********** * * ******* ** * ************ * paradoxus AACGTATTTACATAGTTCTGTATCAGTTTAATCACCATAATATTGTTTTCCCTCAACTAA cerevisiae AAAGTATTTACATAATTCTGTATCAGTTTAATCACCATAATATCGTTTTCT-----TTGT ** *********** **************************** ****** * paradoxus TGAATGCAATTAGATTTTCTTATTGTTCCCTCGCGGCTTTTTTTTGTTTTATAATCTATT cerevisiae TTAGTGCAATTAATTTTTCCTATTGTTACTTCG-GGCCTTTTTCTGTTTTATGAGCTATT * * ******** ***** ******* * *** *** ***** ******** * ***** paradoxus TTTTCCGTCATTTCTTCCCCAGATTTCCAACTTCATCTCCAGATTGTGTCTATGTAATGC cerevisiae TTTTCCGTCATC-CTTCCCCAGATTTTCAGCTTCATCTCCAGATTGTGTCTACGTAATGC *********** ************* ** ********************** ******* paradoxus ATGCTATCATATTGAGAAAAGATAGAGAAACAACCCTCCTGAAAAATGAAGCTACTGTCT cerevisiae ACGCCATCATTTTAAGAGAGGACAGAGAAGCAAGCCTCCTGAAAGATGAAGCTACTGTCT * ** ***** ** *** * ** ****** *** ********** ***************
13 ~10Mya ~20Mya S.cerevisiae S. cariocanus S. paradoxus S. mikatae S. kudriavzevii S. bayanus S. pastorianus S. servazzii S. unisporus S. exiguus S. diarenensis S. castellii S. kluyveri ~150Mya >350Mya Kluyveromyces lactis Schizosaccharomyces pombe
14 Distantly-related sequences do not align ATG GAL4 Noncoding (Promoter) cerevisiae ACTTACCAT-CAAC-CATAGATGGGTAAAC---GGTTAGTAACTAGGAACACGAT castelli AGA-GTCAAACTTTTCGT ATA--TATATATAATATGTCTGATTGCTGGTT---T * ** * * * * * * * * *
15 ~10Mya ~20Mya S.cerevisiae S. cariocanus S. paradoxus S. mikatae S. kudriavzevii S. bayanus S. pastorianus S. servazzii S. unisporus S. exiguus S. diarenensis S. castellii S. kluyveri ~150Mya >350Mya Kluyveromyces lactis Schizosaccharomyces pombe
16 Multiple sequence alignments reveal conserved elements cerevisiae TGAGACAGCAT-CACTTCTT-CTTNTTTTTTACATAACTTATTCTTCTATAATTTTCAAC mikatae Bayanus TGAGACAGCATTCACTTCTTTCTTTTTTTTTACATATCTTATTCTTCTATAATTTTCAAC TGAGACAGCATTCGCCCAGT--ATTTTTTTTAT-TCTACAAACCTTCTATAATTT-CAAA kudriadzevi TGAGACTGCACTCCC TCTTCCTTTC TCCATAACTT---AC ****** *** * * * ** ** ** **** ** * paradoxus kluyveri cerevisiae bayanus UAS1 ATG UAS2 GAL4 GTATTTACATAGTTCTGTATCAGTTTAATCACCATAAT------ATTGTTTTCCCTCAAC GTATTTACATAGTTCTGTATCAGTTTAATCACCATAAT------ATTGTTTTCCCTCAAC GTATTTACATAATTCTGTATCAGTTTAATCACCATAAT------ATCGTTTTCTTTGT-- TTATTTACATAGTTTTGTATCAGTTTAATCACCATAATCGTAACACCGTTTTACCTCACC ********** ** *********************** * ***** * paradoxus kluyveri cerevisiae bayanus paradoxus kluyveri cerevisiae bayanus paradoxus kluyveri cerevisiae bayanus TAATGAATGCAATTAGATTTTC-TTATTGTTCCC-TCGCGGCTTTTTTTTGTTTTATAAT TAATGAATGCAATTAGATTTTCCTTATTGTTCCCCTCGCGGCTTTTTTTTGTTTTATAAT ---TTAGTGCAATTAATTTTTC-CTATTGTTACT-TCG-GGCCTTTTTCTGTTTTATGAG TGATGCGGG--A---ATCCTTC-AGACCGTTCTC-TCGCGC * * * *** * *** *** * UES MIG1 MIG1 -CTATTTTTTCCGTCATTTCTTCCCC-AGATTTCCAACTTCAT-CTCCAGATTGTGTCTA ACTATTTTTTCCGTCATTTCTTCCCCCAGATTTCCAACTTCATACTCCAGATTGTGTCTA -CTATTTTTTCCGTCATC-CTTCCCC-AGATTTTCAGCTTCAT-CTCCAGATTGTGTCTA -CTTTTTTTTTCGTCATTTCTTCCCC-AGATCTACAACTTTAA-CTCCAGACGGTGTATA ** ****** ****** ******* **** * ** *** * ******* **** ** TGTAATGCATGCTATCATATTGAGAAAAGATAGAGAAACAACCCTCCTGAAAAATGAAGC TGTAATGCATGCTATCATATTGAGAAAAGATAGAGAAACAACCCTCCTGAAAAATGAAGC CGTAATGCACGCCATCATTTTAAGAGAGGACAGAGAAGCAAGCCTCCTGAAAGATGAAGC GGCAGTACAAGCAGTGCTTTTGGGAAGAGGCAAAGCTGCAGACCTCGAGAACAATGAAGC * * * ** ** * * ** ** * * ** ** **** *** *******
17 CASE 2: Coding ATG CLN3 TAA
18 ~10Mya ~20Mya S.cerevisiae S. cariocanus S. paradoxus S. mikatae S. kudriavzevii S. bayanus S. pastorianus S. servazzii S. unisporus S. exiguus S. diarenensis S. castellii S. kluyveri ~150Mya >350Mya Kluyveromyces lactis Schizosaccharomyces pombe
19 Closely-related sequences are uninformative
20 ~10Mya ~20Mya S.cerevisiae S. cariocanus S. paradoxus S. mikatae S. kudriavzevii S. bayanus S. pastorianus S. servazzii S. unisporus S. exiguus S. diarenensis S. castellii S. kluyveri ~150Mya >350Mya Kluyveromyces lactis Schizosaccharomyces pombe
21 Less distantly related species not informative either
22 ~10Mya ~20Mya S.cerevisiae S. cariocanus S. paradoxus S. mikatae S. kudriavzevii S. bayanus S. pastorianus S. servazzii S. unisporus S. exiguus S. diarenensis S. castellii S. kluyveri ~150Mya >350Mya Kluyveromyces lactis Schizosaccharomyces pombe
23 Distanly related species reveal functional protein domains
24 Identification of Multi-Species Conserved Regions (MCS) Human Chimp Mouse Rat Dog cccattcttttccaagtgtctccg--cctgcagcgattaggttagaaagcatttctctct cccattcttttccaagtgtctccg--cctgcagcgattaggttagaaagcatttctctct ttcagtcgtttcccagtgtctctga-cattcagagactactttagtaagcattt-tctct tcagtccttccctggcatctccag-cactcaa-gactactttagtaagcattt-tctctg tcaatgactttcccagtctcttctactgggaagagattaggttgcaaatcatttttctct * * * * * * ** How can we decide if this region in conserved? Margulies et al (2003) Gen. Res. 13:
25 Binomial-Based Method for Detection of MCS Human: AATGG Mouse: AATCG Status: CCCDC p = chance that a site is the same between human and mouse, q = 1-p For an alignment N base pairs long with n identities calculate the cumulative binomial probability as: P ( X ³ n) = N å i= n p i q N -i æ ç è N i ö ø Margulies et al (2003) Gen. Res. 13:
26
27 How to score human-mouse conservation? score = M - σ µ 1) Look at 50 bp windows that align 2) M is the number of identical bases in a particular 50 bp alignment 3) µ is the average number of identical residues in 50 bp alignments of local ancient, syntenic repeats (neutral) 4) s is the standard deviation of µ Nature (2002) 420:
28 5% Conserved between Human-Mouse Red = neutral Blue = observed genomic Gray = estimated selection (20% of windows under selection)(25% of bp in alignments) = 5% Nature (2002) 420:
29 What does 5% conservation mean? Only 1.5% of the genome is coding sequence 5 UTRs, 3 UTRs, promoters, and introns do not make up the difference
30 Problem with resolution Answer: Sequence more genomes (maybe)! Eddy 2005: Binomial model for power calculations
31
32 Tree Topology Influences Power Star Phylogeny Actual Phylogeny species A species F species B species E species C species D
33
34 Ultraconserved Sequences 481 sequences longer than 200 bp are 100% identical between orthologous regions of human, mouse, and rat Most conserved at 99% in chicken and dog too 5000 sequences longer than 100 bp are 100% identical in these species Bejerano et al (2004) Science 304:
35 Olig2 100 Kb upstream of Olig2
36 So what do they do?
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
lpar1 IPB004065, IPB002277, and IPB Restriction Enyzme Differences from REBASE Gained in Variant Lost from Reference
lpar1 IPB465, IPB2277, and IPB5385 Genomic Sequence Coding Sequence For help interpreting these results, view the PARSENP Introduction page. # View On Sequence Nucleotide Change Effect Restriction Enyzme
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Functional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
State of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Enseigner l'évolution
AATTTTCGTATCTGTTGGAGTTAGATAAGCCTACGCTTGATGGACCGTTGGGTGGCTTTCTAAGTGAGCTCGTGCCATCACAATTAATATAAGGAATTGTAGATGTTTCTTTCGTTATAGGTATTTCAAAAT TTATAAGAACCTACGCCCTCGTCTTTCTCCATTGGAACAGTTGCCGTTTTCGCAGTTCTTTTTGGTTCAGTCCTCATATCATGTGATTCCCCTGGCTCTCCTGATCTTTTTATACTTACTTTGAAATCGTCA
EVALUATION FOR THE ERASMUS+-PROJECT, STUDENTSE
#1 Aloitettu: 6. marraskuuta 2015 9:03:38 Muokattu viimeksi: 6. marraskuuta 2015 9:05:26 Käytetty aika: 00:01:47 IP-osoite: 83.245.241.86 K1: Nationality Finnish K2: The program of the week has been very
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks. David R. Kelley
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks David R. Kelley DNA codes for complex life. How? Kundaje et al. Integrative analysis of 111 reference
T Statistical Natural Language Processing Answers 6 Collocations Version 1.0
T-61.5020 Statistical Natural Language Processing Answers 6 Collocations Version 1.0 1. Let s start by calculating the results for pair valkoinen, talo manually: Frequency: Bigrams valkoinen, talo occurred
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
Viral DNA as a model for coil to globule transition
Viral DNA as a model for coil to globule transition Marina Rossi Lab. of complex fluids and molecular biophysics LITA (Segrate) UNIVERSITA DEGLI STUDI DI MILANO - PhD Workshop October 14 th, 2013 Temperature
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Metsälamminkankaan tuulivoimapuiston osayleiskaava
VAALAN KUNTA TUULISAIMAA OY Metsälamminkankaan tuulivoimapuiston osayleiskaava Liite 3. Varjostusmallinnus FCG SUUNNITTELU JA TEKNIIKKA OY 12.5.2015 P25370 SHADOW - Main Result Assumptions for shadow calculations
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
Alueellinen yhteistoiminta
Alueellinen yhteistoiminta Kokemuksia alueellisesta toiminnasta Tavoitteet ja hyödyt Perusterveydenhuollon yksikön näkökulmasta Matti Rekiaro Ylilääkäri Perusterveydenhuollon ja terveyden edistämisen yksikkö
( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145
OX2 9 x N131 x HH145 Rakennuskanta Asuinrakennus Lomarakennus Liike- tai julkinen rakennus Teollinen rakennus Kirkko tai kirkollinen rak. Muu rakennus Allas Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 2 km
WindPRO version joulu 2012 Printed/Page :42 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 13.6.2013 19:42 / 1 Minimum
Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a
, Tuulivoimahanke Layout 9 x N131 x HH145 Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 km 2 SHADOW - Main Result Assumptions for shadow calculations
( ,5 1 1,5 2 km
Tuulivoimala Rakennukset Asuinrakennus Liikerak. tai Julkinen rak. Lomarakennus Teollinen rakennus Kirkollinen rakennus Varjostus "real case" h/a 1 h/a 8 h/a 20 h/a 4 5 3 1 2 6 7 8 9 10 0 0,5 1 1,5 2 km
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy
Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy OVERVIEW- Method updated and written by Sarah Louie (6/19/08) Initially
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
WindPRO version joulu 2012 Printed/Page :47 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 22.12.2014 11:33 / 1 Minimum
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Calculation: N117 x 9 x HH141 Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.9.269
rapid evolution in copy number, location and sequence, with diverse turnover mechanisms.
Repetitive DNA and its evolution: genomic strategies to understand the processes and exploit biodiversity rapid evolution in copy number, location and sequence, with diverse turnover mechanisms. often
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 5.11.2013 16:44 / 1 Minimum
The Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
TM ETRS-TM35FIN-ETRS89 WTG
VE1 SHADOW - Main Result Calculation: 8 x Nordex N131 x HH145m Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
EUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
,0 Yes ,0 120, ,8
SHADOW - Main Result Calculation: Alue 2 ( x 9 x HH120) TuuliSaimaa kaavaluonnos Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered
VIIKKI BIOCENTER University of Helsinki
VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Genome 373: Genomic Informatics. Professors Elhanan Borenstein and Jay Shendure
Genome 373: Genomic Informatics Professors Elhanan Borenstein and Jay Shendure Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis
1.3Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 81122P (4 ov.) 30.5.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
A DEA Game II. Juha Saloheimo S ysteemianalyysin. Laboratorio. Teknillinen korkeakoulu
A DEA Game II Juha Salohemo 12.12.2007 Content Recap of the Example The Shapley Value Margnal Contrbuton, Ordered Coaltons, Soluton to the Example DEA Mn Game Summary Home Assgnment Recap of the Example
AYYE 9/ HOUSING POLICY
AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Uusi Ajatus Löytyy
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
You can check above like this: Start->Control Panel->Programs->find if Microsoft Lync or Microsoft Lync Attendeed is listed
Online Meeting Guest Online Meeting for Guest Participant Lync Attendee Installation Online kokous vierailevalle osallistujalle Lync Attendee Asennus www.ruukki.com Overview Before you can join to Ruukki
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
CS284A Representations & Algorithms for Molecular Biology. Xiaohui S. Xie University of California, Irvine
CS284A Representations & Algorithms for Molecular Biology Xiaohui S. Xie University of California, Irvine Today s Goals Course information Challenges in computational biology Introduction to molecular
Rakennukset Varjostus "real case" h/a 0,5 1,5
Tuulivoimala Rakennukset Asuinrakennus Liikerak. tai Julkinen rak. Lomarakennus Teollinen rakennus Kirkollinen rakennus Varjostus "real case" h/a 1 h/a 8 h/a 20 h/a 1 2 3 5 8 4 6 7 9 10 0 0,5 1 1,5 2 km
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
7. Product-line architectures
7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
OP1. PreDP StudyPlan
OP1 PreDP StudyPlan PreDP The preparatory year classes are in accordance with the Finnish national curriculum, with the distinction that most of the compulsory courses are taught in English to familiarize
VIIKKI BIOCENTER University of Helsinki
VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri
Statistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
Bioinformatics. Sequence Analysis: Part III. Pattern Searching and Gene Finding. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Sequence Analysis: Part III. Pattern Searching and Gene Finding Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18
6.095/ Computational Biology: Genomes, Networks, Evolution. Sequence Alignment and Dynamic Programming
6.095/6.895 - Computational Biology: Genomes, Networks, Evolution Sequence lignment and Dynamic Programming Tue Sept 13, 2005 Challenges in Computational Biology 4 Genome ssembly 5 Regulatory motif discovery
RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla
TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä
M a t t i K a t t a i n e n O T M 1 1. 0 9. 2 0 1 9 Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä Ympäristöoikeustieteen
I. Principles of Pointer Year Analysis
I. Principles of Pointer Year Analysis Fig 1. Maximum (red) and minimum (blue) pointer years. 1 Fig 2. Principle of pointer year calculation. Fig 3. Skeleton plot graph created by Kinsys/Kigraph programme.
Keskeisiä näkökulmia RCE-verkoston rakentamisessa Central viewpoints to consider when constructing RCE
Keskeisiä näkökulmia RCE-verkoston rakentamisessa Central viewpoints to consider when constructing RCE Koordinaattorin valinta ja rooli Selection and role of the coordinator Painopiste: tiede hallinto
Suihkukoneet 1:73 ja pienemmät. Potkurikoneet 1:72-1:49. Suihkukoneet 1:72-1:49. Potkurikoneet 1:35 ja suuremmat. Suihkukoneet 1:35 ja suuremmat
Kilpailuluokat Ohessa kilpailuluokat NC 2016 ja IPMS Open. Ilma-alukset Potkurikoneet 1:73 ja pienemmät Suihkukoneet 1:73 ja pienemmät Potkurikoneet 1:72-1:49 Suihkukoneet 1:72-1:49 Potkurikoneet 1:48
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä
812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
SIMULINK S-funktiot. SIMULINK S-funktiot
S-funktio on ohjelmointikielellä (Matlab, C, Fortran) laadittu oma algoritmi tai dynaamisen järjestelmän kuvaus, jota voidaan käyttää Simulink-malleissa kuin mitä tahansa valmista lohkoa. S-funktion rakenne
Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition)
Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition) Click here if your download doesn"t start automatically
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
Chapter 7. Motif finding (week 11) Chapter 8. Sequence binning (week 11)
Course organization Introduction ( Week 1) Part I: Algorithms for Sequence Analysis (Week 1-11) Chapter 1-3, Models and theories» Probability theory and Statistics (Week 2)» Algorithm complexity analysis
Ohjelmointikielet ja -paradigmat 5op. Markus Norrena
Ohjelmointikielet ja -paradigmat 5op Markus Norrena Kotitehtävä 6, toteuttakaa alla olevan luokka ja attribuutit (muuttujat) Kotitehtävä 6, toteuttakaa alla olevan luokka ja attribuutit (muuttujat) Huom!
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? 10.10.01 Tuomo Suortti Ohjelman päällikkö Riina Antikainen Ohjelman koordinaattori 10/11/01 Tilaisuuden teema Kansainvälistymiseen
Data Quality Master Data Management
Data Quality Master Data Management TDWI Finland, 28.1.2011 Johdanto: Petri Hakanen Agenda 08.30-09.00 Coffee 09.00-09.30 Welcome by IBM! Introduction by TDWI 09.30-10.30 Dario Bezzina: The Data Quality
( N117 x HH141 ( Honkajoki N117 x 9 x HH120 tv-alueet ( ( ( ( ( ( ( ( ( ( m. Honkajoki & Kankaanpää tuulivoimahankkeet
Honkajoki & Kankaanpää tuulivoimahankkeet N117 x HH141 Honkajoki N117 x 9 x HH120 tv-alueet Alahonkajoki_kaava_alueen_raja_polyline Asuinrakennus Julkinen tai liiker rak. Lomarakennus Teollinen rak. Allas
Naisnäkökulma sijoittamiseen. 24.3.2007 Vesa Puttonen
Naisnäkökulma sijoittamiseen 24.3.2007 Vesa Puttonen Miten sukupuolella voi olla mitään tekemistä sijoittamisen kanssa??? Naiset elävät (keskimäärin) pidempään kuin miehet Naiset saavat (keskimäärin) vähemmän
4x4cup Rastikuvien tulkinta
4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,
Python Libraries 1 / 14
Python Libraries 1 / 14 Gzip, CSV https://docs.python.org/3/library/gzip.html https://docs.python.org/3/library/csv.html https://daler.github.io/pybedtools/ - PyBed tools http://biopython.org/wiki/gff_parsing