In situ hybridization
|
|
- Aleksi Laaksonen
- 8 vuotta sitten
- Katselukertoja:
Transkriptio
1 In situ hybridization
2 ISH Detection of DNA or RNA Single or double stranded Chromosomal or cellular nucleic acids
3 ISH Type of a hybrid? DNA-DNA In situ renaturation of target DNA in ISH cannot be prevented since the probe and the target have the same thermal stability!
4 ISH DNA-RNA More thermally stabel hybrids Choice of hybridization conditions that favour DNA-RNA hybridization instead of DNA-DNA hybridization
5 ISH RNA-RNA Choice of the complementary probe sequence for detection of tissue mrna method of choice when gene activity needs to be monitored Choice of the hybridization conditions: thermally the most stable form of hybridization
6 ISH For tissue/whole mount -ISH, single stranded probes are recommended: The probe is not self-annealing in the solution Large concatenates that would penetrate sections or whole chromosomes poorly, do not occur
7 Probes Today it is possible to order short nucleic acid probes, clone probes, use PCR for probe preparation or use genomic DNA The method of choice depends on WHAT NEEDS TO BE DETECTED and WHAT ARE THE POSSIBILITIES IN YOUR LAB!
8 Probes
9 Labels Non-radioactive methods are sensitive, give more possibilities in the choice of label, are quick, give good resolution in single cell level, give a possibility to double-labelling or even combination of ISH and immunohistochemistry, BUT YOU HAVE TO KNOW HOW TO DO IT!
10 Labels Non-radioactive labels: Direct or indirect labelling In direct label the reporter is directly bound to the nucleic acid label and can be monitored immediately after the hybridization In indirect labels the reporter is not directly subject to harsh hybridization- and washing conditions The indirect reporter does not interfere with the hybridization!
11 Labels Digoxigenin From the plant Digitalis purpurea or Digitalis lantana Does not occur in animals Easy to raise detection methods (antibodies) that do not give background Can be incorporated relatively easily into uridine via random priming, nick translation, PCR, 3 -end labeling or in vitro transcription
12 Labels Biotin First enzymatic labeling of biotin-dutp now also other biotinylated nucleotides available Direct detection with biotin antibodies or with biotin-streptavidin methods
13 Labels Fluorochromes Fluorescein coupled to UTP In direct method, no additional visualization needed More specificity required with non-direct detection via antibodies
14 Labels Multiple labeling and detection Combinations of DIG, biotin and fluorochromelabled probes makes it possible to do multiple ISH or ISH combined with immunohistochemistry Utilizes different fluorochromes: FITC TRITC- AMCA
15 MULTI ISH/immunohistochemistry
16 Kinetics of hybridization In principal: Basic knowledge of the kinetics of nucleic acid re-annealing is required when choosing the method and to ideally use the method that was chosen!!!
17 Nucleic acid hybridization Hybridization depends on the ability of denatured DNA or RNA to re-anneal with complementary strand in an environment just below their melting point (T m )
18 Kinetics of hybridization T m is the temperature at which half of the DNA is present in a denatured form Different in genomic DNA isolated from different organisms! Depends on GC content in the sequence
19 Kinetics of hybridization Temperature Theoretically maximal rate for DNA hybridization is at C The rate and temperature relationship is however quite broad and hybridization can be done in temperatures 16 0 C 32 0 C BELOW the T m
20 Kinetics of hybridization ph Not critical, hybridization rate is maximal in ph from 5-9 at 25 0 C Neutral ph buffers are used More stringent hybridization conditions are obtained in higher ph
21 Kinetics of hybridization Monovalent cations Sodium ions (salt) interact electrostatically with nucleic acids In practice higher salt conditions increase the stability of the hybrid Low salt concentrations make more stringent conditions
22 Kinetics of hybridization Divalent cations Free divalent cations strongly stabilize duplex nucleic acid For denaturation they have to be removed from the mixture For stringency they have to be removed or complexed by citrate or EDTA
23 Kinetics of hybridization Formamide Allows hybridization in lower temperatures than the melting point as it reduces the thermal stability of double-stranded polynucleotides DNA-DNA /DNA-RNA/ RNA-RNA hybridization can be done in 30 0 C-45 0 C in 50% of formamide If higher temperatures are needed for stingency, formamide concentration can be increased
24 Kinetics of hybridization Probe length Maximal hybridization rates are obtained with long probes However, in whole-mount ISH, probe penetration may be a limiting factor Probe length affects the thermal stability: Change in T m x n = 500 (n=nucleotides) - this gives you the value which relates the shortest fragment length in a duplex molecule to change in T m
25 Kinetics of hybridization Probe length: In practice: the longer the probe, the higher the hybridization temperature can be used If oligonucleotide probes are used, the hybridization temperature is low, the formamide concentration low, the salt concentration high If long probes (DNA or RNA) are used, the higher the temperature, the higher the formamide concentration and the lower the salt concentration
26 Kinetics of hybridization Probe concentration There has to be enough probe for the nucleation reaction This is the reaction at which the first few base pairs are hybridized probe concentration affects the rate and efficiency of the nucleation reaction = rate limiting step in hybridization
27 Kinetics of hybridization Probe concentration The higher the probe concentration, the higher the re-annealing rate However, high probe concentrations require also high stringency conditions and good washing conditions and does not usually give better end results
28 Kinetics of hybridization Dextran sulphate Affects the probe concentration and gives higher hybridization rates in aqueous solutions In such solutions dextran sulphate is strongly hydrated and prevents the macromolecules to be solved in water
29 Kinetics of hybridization Blocking agents: Denhardt s solution Prevents the non-specific attachment of the probe to slide or any surface Used in combination with salmon sperm DNA/yeast DNA and detergents
30 Kinetics of hybridization Powdered non-fat milk Easier and cheaper than Denhardt s but for RNA probes must be RNAase-free!!
31 Kinetics of hybridization Heparin Used as a blocking agent If dextran sulfate is used in hybridization mix, used at a concentration of 500 g/ml, if no Dextran is added, 50 g/ml is enough
32 Whole-mount ISH
33 The protocol Whole mount in situ hybridization, based on Wilkinson protocol, modified by Murray Hargrave Koopman lab, and Sariola lab (Satu Kuure, )
34 The result
35 Analysis Fgf3 expression in the developing pharyngeal region. Whole-mount in situ hybridization of a 8 somite stage embryo. Note expression in the ectoderm covering the future 2nd branchial arch. BA1 and 2; branchial arch 1 and 2; R4, 5 and 6, rhombomeres 4, 5 and 6.
36 Drapc1 expression from E7.5 to E8.5. Whole-mount in situ hybridization (A C,F), in situ hybridization on sections (D,E,G). (A)
37 Expression of Fgfr1 and Fgfr2. Wholemount and radioactive in situ hybridization analysis of the expression
38 The conditional Fgfr1 allele, Fgfr1flox, and its inactivation by En1-Cre and Wnt1- Cre. (A) Schematic presentation of the Fgfr1flox allele and its inactivation by the Cre-recombinase. The structures of the FGFR1 protein
39
40
41 Double labeling
42 Intavis InSituPro
43 InSituPro
44 InSituPro
45 What is the real benefit of automated ISH?
46
Section in situ hybridization
Section in situ hybridization Section / cellular ISH types Radioactive ISH for cells and tissue sections radiolabeling of probes and detection by autoradiography Non-radioactive ISH probes labeled with
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL Ville Liljeström, Micha Matusewicz, Kari Pirkkalainen, Jussi-Petteri Suuronen and Ritva Serimaa 13.3.2012
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
State of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
Miksi Suomi on Suomi (Finnish Edition)
Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Click here if your download doesn"t start automatically Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Miksi Suomi on Suomi (Finnish Edition)
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)
Tilasto T1106120-s2012palaute Kyselyn T1106120+T1106120-s2012palaute yhteenveto: vastauksia (4) Kysymys 1 Degree programme: (4) TIK: TIK 1 25% ************** INF: INF 0 0% EST: EST 0 0% TLT: TLT 0 0% BIO:
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
AYYE 9/ HOUSING POLICY
AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
Operatioanalyysi 2011, Harjoitus 4, viikko 40
Operatioanalyysi 2011, Harjoitus 4, viikko 40 H4t1, Exercise 4.2. H4t2, Exercise 4.3. H4t3, Exercise 4.4. H4t4, Exercise 4.5. H4t5, Exercise 4.6. (Exercise 4.2.) 1 4.2. Solve the LP max z = x 1 + 2x 2
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
The Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
Tutkimusdata ja julkaiseminen Suomen Akatemian ja EU:n H2020 projekteissa
Tutkimusdata ja julkaiseminen Suomen Akatemian ja EU:n H2020 projekteissa Tutkimusasiamies Kaisa Männikkö Tutkimus- ja innovaatiopalvelut Suomen Akatemian projektit Suomen Akatemia kehottaa avoimeen tieteelliseen
Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen
The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project
Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site
Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site Note! Before starting download and install a fresh version of OfficeProfessionalPlus_x64_en-us. The instructions are in the beginning of the exercise.
Salasanan vaihto uuteen / How to change password
Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change
Särmäystyökalut kuvasto Press brake tools catalogue
Finnish sheet metal machinery know-how since 1978 Särmäystyökalut kuvasto Press brake tools catalogue www.aliko.fi ALIKO bending chart Required capacity in kn (T) in relation to V-opening. V R A S = plates
Tork Paperipyyhe. etu. tuotteen ominaisuudet. kuvaus. Väri: Valkoinen Malli: Vetopyyhe
etu Monikäyttöpaperi hoitaa useimmat pyyhintätehtävät Sopiva lasipintojen pyyhintään Sopii käsien kuivaamiseen Elintarvikekäyttöön hyväksytty Tork Easy Handling, pakkaus, jota on helppo kantaa mukana,
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?
Exercise 1. (session: )
EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
Co-Design Yhteissuunnittelu
Co-Design Yhteissuunnittelu Tuuli Mattelmäki DA, associate professor Aalto University School of Arts, Design and Architecture School of Arts, Design and Architecture design with and for people Codesign
Vertaispalaute. Vertaispalaute, /9
Vertaispalaute Vertaispalaute, 18.3.2014 1/9 Mistä on kyse? opiskelijat antavat palautetta toistensa töistä palaute ei vaikuta arvosanaan (palautteen antaminen voi vaikuttaa) opiskelija on työskennellyt
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Valuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
Mitä Master Class:ssa opittiin?
Mitä Master Class:ssa opittiin? Tutkimuskoordinaattori Kaisa Korhonen-Kurki, Helsingin yliopisto Tutkija Katriina Soini, Helsingin yliopisto Yliopistopedagogi Henna Asikainen, Helsingin yliopisto Tausta
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
S-55.1100 SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA
S-55.00 SÄHKÖKNKKA A KONKKA. välikoe 2..2008. Saat vastata vain neljään tehtävään!. aske jännite U. = 4 Ω, 2 = Ω, = Ω, = 2, 2 =, = A, 2 = U 2 2 2 2. ännitelähde tuottaa hetkestä t = t < 0 alkaen kaksiportaisen
EUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
Viral DNA as a model for coil to globule transition
Viral DNA as a model for coil to globule transition Marina Rossi Lab. of complex fluids and molecular biophysics LITA (Segrate) UNIVERSITA DEGLI STUDI DI MILANO - PhD Workshop October 14 th, 2013 Temperature
T Statistical Natural Language Processing Answers 6 Collocations Version 1.0
T-61.5020 Statistical Natural Language Processing Answers 6 Collocations Version 1.0 1. Let s start by calculating the results for pair valkoinen, talo manually: Frequency: Bigrams valkoinen, talo occurred
Rekisteröiminen - FAQ
Rekisteröiminen - FAQ Miten Akun/laturin rekisteröiminen tehdään Akun/laturin rekisteröiminen tapahtuu samalla tavalla kuin nykyinen takuurekisteröityminen koneille. Nykyistä tietokantaa on muokattu niin,
Matkustaminen Majoittuminen
- Majoituspaikan löytäminen Where can I find? Ohjeiden kysyminen majoituspaikan löytämiseksi Where can I find?... a room to rent?... a room to rent?... a hostel?... a hostel?... a hotel?... a hotel?...
4x4cup Rastikuvien tulkinta
4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,
Matkustaminen Majoittuminen
- Majoituspaikan löytäminen Where can I find? Ohjeiden kysyminen majoituspaikan löytämiseksi... a room to rent?... a hostel?... a hotel?... a bed and breakfast?... a camping site? What are the prices like
OP1. PreDP StudyPlan
OP1 PreDP StudyPlan PreDP The preparatory year classes are in accordance with the Finnish national curriculum, with the distinction that most of the compulsory courses are taught in English to familiarize
812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting
FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists
Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition)
Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition) Click here if your download doesn"t start automatically
Siirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools
Siirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools Akateemisten asioiden komitea Academic Affairs Committee 11 October 2016 Eija Zitting
Guidebook for Multicultural TUT Users
1 Guidebook for Multicultural TUT Users WORKPLACE PIRKANMAA-hankkeen KESKUSTELUTILAISUUS 16.12.2010 Hyvää käytäntöä kehittämässä - vuorovaikutusopas kansainvälisille opiskelijoille TTY Teknis-taloudellinen
Hankkeen toiminnot työsuunnitelman laatiminen
Hankkeen toiminnot työsuunnitelman laatiminen Hanketyöpaja LLP-ohjelman keskitettyjä hankkeita (Leonardo & Poikittaisohjelma) valmisteleville11.11.2011 Työsuunnitelma Vastaa kysymykseen mitä projektissa
Data protection template
Data protection template Aihe: rekisteriseloste ja informointipohja Topic: information about the register and information to users (related to General Data Protection Regulation (GDPR) (EU) 2016/679) Mallina
Business Opening. Arvoisa Herra Presidentti Very formal, recipient has a special title that must be used in place of their name
- Opening Finnish Norwegian Arvoisa Herra Presidentti Very formal, recipient has a special title that must be used in place of their name Hyvä Herra, Formal, male recipient, name unknown Hyvä Rouva Formal,
RINNAKKAINEN OHJELMOINTI A,
RINNAKKAINEN OHJELMOINTI 815301A, 18.6.2005 1. Vastaa lyhyesti (2p kustakin): a) Mitkä ovat rinnakkaisen ohjelman oikeellisuuskriteerit? b) Mitä tarkoittaa laiska säikeen luominen? c) Mitä ovat kohtaaminen
Tilausvahvistus. Anttolan Urheilijat HENNA-RIIKKA HAIKONEN KUMMANNIEMENTIE 5 B RAHULA. Anttolan Urheilijat
7.80.4 Asiakasnumero: 3000359 KALLE MANNINEN KOVASTENLUODONTIE 46 51600 HAUKIVUORI Toimitusosoite: KUMMANNIEMENTIE 5 B 51720 RAHULA Viitteenne: Henna-Riikka Haikonen Viitteemme: Pyry Niemi +358400874498
LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet
LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50
The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region
The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region The BaltCICA Project is designed to focus on the most imminent problems that climate change is likely to cause
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
Expression of interest
Expression of interest Avoin hakemus tohtorikoulutettavaksi käytäntö Miksi? Dear Ms. Terhi virkki-hatakka I am writing to introduce myself as a volunteer who have the eagerness to study in your university.
RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla
TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua
Travel Getting Around
- Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto If you are searched for a book by Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice over LTE (VoLTE) in pdf form, then you have come
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel. Kalle Lehto, Aalto-yliopisto 5.5.
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel Kalle Lehto, Aalto-yliopisto 5.5.2011 Otaniemi ReFuel a three year research project (2009-2011) goal utilize the
Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds
PhD Anne Hemmi 14.2.2013 RRR 2013 Conference in Greifswald, Germany Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds Eutrophication in surface waters High nutrient
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä
Väite Argument "Yhteiskunnan velvollisuus on tarjota virkistysalueita ja -palveluita." "Recreation sites and service
Olisiko vastaaja valmis maksamaan... Would the respondent be willing to pay for... Luonto-opastuksesta Nature guide services Autiotuvan käytöstä Use of wilderness huts Tulipaikan käytöstä (polttopuut,
koiran omistajille ja kasvattajille 2013 for dog owners and breeders in 2013
Irlanninsusikoiran luonnekysely A survey of the temperament of Irish wolfhounds koiran omistajille ja kasvattajille 213 for dog owners and breeders in 213 Teksti / author: Jalostustoimikunta / breeding
ETELÄESPLANADI 2 00130 HELSINKI
00130 HELSINKI MODERNIA TOIMISTOTILAA Noin VUOKRATAAN Ainutlaatuinen tilaisuus vuokrata huipputason Helsingin näköalapaikalta Toimi pian! Lisätietoja KALLE JASKARA Myyntijohtaja +358 50 324 0404 kalle.jaskara@tkoy.fi
TU-C2030 Operations Management Project. Introduction lecture November 2nd, 2016 Lotta Lundell, Rinna Toikka, Timo Seppälä
TU-C2030 Operations Management Project Introduction lecture November 2nd, 2016 Lotta Lundell, Rinna Toikka, Timo Seppälä Welcome to the course! Today s agenda Introduction to cases and schedule/ Timo Seppälä
ELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period
1 ELEMET- MOCASTRO Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions Period 20.02-25.05.2012 Diaarinumero Rahoituspäätöksen numero 1114/31/2010 502/10
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
Toimintamallit happamuuden ennakoimiseksi ja riskien hallitsemiseksi turvetuotantoalueilla (Sulfa II)
Toimintamallit happamuuden ennakoimiseksi ja riskien hallitsemiseksi turvetuotantoalueilla (Sulfa II) Happamuuskuormituksen ennustaminen valuma-aluetasolla Marie Korppoo ja Markus Huttunen 13.5.2019 Päämäärä
ProAgria. Opportunities For Success
ProAgria Opportunities For Success Association of ProAgria Centres and ProAgria Centres 11 regional Finnish ProAgria Centres offer their members Leadership-, planning-, monitoring-, development- and consulting
Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Uusi Ajatus Löytyy
VUOSI 2015 / YEAR 2015
VUOSI 2015 / YEAR 2015 Kansainvälisen opetuksen ja tutkimustoiminnan kehittäminen Developing international teaching and research activities Rehtorin strateginen rahoitus vuosille 2014-2016 / Strategic
Skene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene
Skene Muokkaa perustyyl. Games Refueled napsautt. @Games for Health, Kuopio Muokkaa alaotsikon perustyyliä napsautt. 2013 kari.korhonen@tekes.fi www.tekes.fi/skene 10.9.201 3 Muokkaa Skene boosts perustyyl.
Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa. Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio
Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio Päättääkö opettaja ohjelmasta? Vai voisivatko opiskelijat itse suunnitella
TIEKE Verkottaja Service Tools for electronic data interchange utilizers. Heikki Laaksamo
TIEKE Verkottaja Service Tools for electronic data interchange utilizers Heikki Laaksamo TIEKE Finnish Information Society Development Centre (TIEKE Tietoyhteiskunnan kehittämiskeskus ry) TIEKE is a neutral,
TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015
1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? 10.10.01 Tuomo Suortti Ohjelman päällikkö Riina Antikainen Ohjelman koordinaattori 10/11/01 Tilaisuuden teema Kansainvälistymiseen
Pojan Sydan: Loytoretki Isan Rakkauteen (Finnish Edition)
Pojan Sydan: Loytoretki Isan Rakkauteen (Finnish Edition) M. James Jordan Click here if your download doesn"t start automatically Pojan Sydan: Loytoretki Isan Rakkauteen (Finnish Edition) M. James Jordan