Bioinformatics. Sequence Analysis: Part III. Pattern Searching and Gene Finding. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
|
|
- Kauko Lahtinen
- 6 vuotta sitten
- Katselukertoja:
Transkriptio
1 Bioinformatics Sequence Analysis: Part III. Pattern Searching and Gene Finding Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
2 Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18 Feb 25 Sequence Analysis I. Pairwise alignments, database searching including BLAST (FL) [1, 2, 3] Sequence Analysis II. Database searching (continued), Pattern searching(fl)[7] No Class - Martin Luther King Holiday Sequence Analysis III. Hidden Markov models, gene finding algorithms (FL)[8] Computational Methods I. Genomic Resources and Unix (GB) Computational Methods II. Sequence analysis with Perl. (GB) No Class - President's Birthday Computational Methods III. Sequence analysis with Perl and BioPerl (GB) Mar 4 Proteins I. Multiple sequence alignments, phylogenetic trees (RL) [4, 6] Mar 11 Proteins II. Profile searches of databases, revealing protein motifs (RL) [9] Mar 18 Proteins III.Structural Genomics:structural comparisons and predictions (RL) Mar 25 Microarrays: designing chips, clustering methods (FL) WIBR Bioinformatics Course, Whitehead Institute,
3 Topics to Cover Pattern searching Gene Finding algorithms WIBR Bioinformatics Course, Whitehead Institute,
4 GGATTGTAAGAGTTACTGTTACATTTTCTGGCCTACTACCTTTAAAATTCCTGTTGCATTTCTTTGTATTTACAAGGAAAAGACTGAACTTTTTCTCATCAAAACTAG CTTTTTTCTCACAGGTTAAACTTGCACCAATGTCTGCTCTTTTTTTTTAATGTTTTTGGTACTCTGGGCAGACTTCAGTTTTTTAAAAAATAAAGATTCTAATGCAGC TATCTTGGCATTCCCTTTAAATACCTGTCTTAACCTCCTACTTTTATTTCCTACTCCTTTCCACACACATGCATACAATCCTTTACCTTTTAAAGAATCATTAAGACT GTCACACATTAGGAACTCTTTCGCTCACTCTTCTGTCATTTGCTGCAATATTGAAATTCTTATTTTGACCATCAATGCCTATTAATTCTTCTAATACATGAAGAAAAT GATTGAGTAGCAGCAGTACTATAGGTGGGAAATACAGTTTAACTGCTGAATTTTTATACCTCTCTGATTTATAGCTTGCTAATTAAATTGCTATTAATAGTTTGTTTG Status of Sequencing GCTTAATTAGACTTAAGAAAACAACAGGGCATGAGGAGAGAATTGTATGTAACCAGTGATATGATTATTCCTGAATGTACAGACAGAAGTAAGCCTGGACATTGTTTA (12/31/2001) ATTTAAAAACTTTAGTCCCTGCTTTAAGGGAATATGATAATGTATACTATGACAAATGTACTTTATTCTTCTAACACAGTAAGAATTACTTGGAACTTTTTCCTGAAA CTAAGTGCAGGAAAGCCCTGTGTGTCTTGGTTTAGTGATGGTTTCATTTCTAGCCATACAACTGATGGATTGTATACAATTTTTGTTAGTGCCAAAATAATCTGTTAT ATGAACAGACTTCTAAAATAATTTCTGTATATTATATATGTAAGAAGGCTTTTATTGAACAGCTTATTTTCCACTTGCAAGTTTATGGAAATATCAATATGTCAAAAT AAAAAGTGGGACAATTCTTTGCTGTTAGAAGAATGTGCTTATTATTTTGATTTCTTAAATGGTACATAATCAAAGTACTGCTGAACTATAGGTGCAGTATTCTACTAA ACATTTCGCTAGTAATACCACTGATTTAGAAACAAAACTGTTTATTTTTGCTTTCTGAATTTAGAATGCTGGGATTACCTGTTTAAATATGTTTTAGGGAATATAGAG ATTAAATCTGTACATACCTGTGCACATATATTCATGCACCCTCTGATTTTGGTTTTCTCGTTTTTGAGTTCTTAGAAAGTATCCACATACTCTTCTTTTAGTAGAAGT AGCTGTTTTAGAGAGAAGAAAAGGATGAGACTTTAAATAGTTGATTCTTTTTGTGTTTTCTACAAACTTTTTTGAATTTTAAATCACAAGCAAACTAATTTTCTGGTT TTTAGAAAGTAGATGATGATTTCAGAGGAGTAAGACATGCCAAACAGCGTGCTCGGTAGGATTTTAGGTAGTCAAATGCAGCTGAGAAAAAGTATTTTCAAGTCATAA GTTGCTAATTGATATGCTATGAACTAGTCAAAATAGGAACCATATGATTCATGTTAGATTTTCCTCTAGAGATGGATCTGAATGTTCAGTTCCAGCCAAGGTAGATTT 2% TACTTTCAACTTTTTAATCAATATCACTTTCTGTGCTTAATCTCTTTGGTGTTACCTTGTCCATTTTCATTTGTCTAAAATTCTGCAGGGATGACTACAATTTGGCAT AATGGTATAAATGAATTGTTAAGGGTAACTTTAAGTTGAAGATTAAAGCAAGATGCCATTTTCCCCATGTCTTTCATTTTGTTTACATTTTTTCCCTTTAAGTTAGTA TACACTACACATACTACAATAAAATATAATAATATGAAAAGGATTGTAAGAGTTACTGTTACATTTTCTGGCCTACTACCTTTAAAATTCCTGTTGCATTTCTTTGTA TTTACAAGGAAAAGACTGAACTTTTTCTCATCAAAACTAGCTTTTTTCTCACAGGTTAAACTTGCACCAATGTCTGCTCTTTTTTTTTAATGTTTTTGGTACTCTGGG CAGACTTCAGTTTTTTAAAAAATAAAGATTCTAATGCAGCTATCTTGGCATTCCCTTTAAATACCTGTCTTAACCTCCTACTTTTATTTCCTACTCCTTTCCACACAC Finished ATGCATACAATCCTTTACCTTTTAAAGAATCATTAAGACTGTCACACATTAGGAACTCTTTCGCTCACTCTTCTGTCATTTGCTGCAATATTGAAATTCTTATTTTGA CCATCAATGCCTATTAATTCTTCTAATACATGAAGAAAATGATTGAGTAGCAGCAGTACTATAGGTGGGAAATACAGTTTAACTGCTGAATTTTTATACCTCTCTGAT Unfinished TTATAGCTTGCTAATTAAATTGCTATTAATAGTTTGTTTGGCTTAATTAGACTTAAGAAAACAACAGGGCATGAGGAGAGAATTGTATGTAACCAGTGATATGATTAT 35% Not Sequenced TCCTGAATGTACAGACAGAAGTAAGCCTGGACATTGTTTAATTTAAAAACTTTAGTCCCTGCTTTAAGGGAATATGATAATGTATACTATGACAAATGTACTTTATTC TTCTAACACAGTAAGAATTACTTGGAACTTTTTCCTGAAACTAAGTGCAGGAAAGCCCTGTGTGTCTTGGTTTAGTGATGGTTTCATTTCTAGCCATACAACTGATGG ATTGTATACAATTTTTGTTAGTGCCAAAATAATCTGTTATATGAACAGACTTCTAAAATAATTTCTGTATATTATATATGTAAGAAGGCTTTTATTGAACAGCTTATT TTCCACTTGCAAGTTTATGGAAATATCAATATGTCAAAATAAAAAGTGGGACAATTCTTTGCTGTTAGAAGAATGTGCTTATTATTTTGATTTCTTAAATGGTACATA ATCAAAGTACTGCTGAACTATAGGTGCAGTATTCTACTAAACATTTCAGCTAGTAATACCACTGATTTAGAAACAAAACTGTTTATTTTTGCTTTCTGAATTTAGAAT GCTGGGATTACCTGTTTAAATATGTTTTAGGGAATATAGAGATTAAATCTGTACATACCTGTGCACATATATTCATGCACCCTCTGATTTTGGTTTTCTCGTTTTTGA GTTCTTAGAAAGTATCCACATACTCTTCTTTTAGTAGAAGTAGCTGTTTTAGAGAGAAGAAAAGGATGAGACTTTAAATAGTTGATTCTTTTTGTGTTTTCTACAAAC TTTTTTGAATTTTAAATCACAAGCAAACTAATTTTCTGGTTTTTAGAAAGTAGATGATGATTTCAGAGGAGTAAGACATGCCAAACAGCGTGCTCGGTAGGATTTTAG GTAGTCAAATGCAGCTGAGAAAAAGTATTTTCAAGTCATAAGTTGCTAATTGATATGCTATGAACTAGTCAAAATAGGAACCATATGATTCATGTTAGATTTTCCTCT 63% AGAGATGGATCTGAATGTTCAGTTCCAGCCAAGGTAGATTTTACTTTCAACTTTTTAATCAATATCACTTTCTGTGCTTAATCTCTTTGGTGTTACCTTGTCCATTTT CATTTGTCTAAAATTCTGCAGGGATGACTACAATTTGGCATAATGGTATAAATGAATTGTTAAGGGTAACTTTAAGTTGAAGATTAAAGCAAGATGCCATTTTCCCCA TGTCTTTCATTTTGTTTACATTTTTTCCCTTTAAGTTAGTATACACTACACATACTACAATAAAATATAATAATATGAAAAGGATTGATTCATGTTAGATTTTCCTCT AGAGATGGATCTGAATGTTCAGTTCCAGCCAAGGTAGATTTTACTTTCAACTTTTTAATCAATATCACTTTCTGTGCTTAATCTCTTTGGTGTTACCTTGTCCATTTT CATTTGTCTAAAATTCTGCAGGGATGACTACAATTTGGCATAATGGTATAAATGAATTGTTAAGGGTAACTTTAAGTTGAAGATTAAAGCAAGATGCCATTTTCCCC ATGTCTTTCATTTTGTTTACATTTTTTCCCTTTAAGTTAGTATACACTACACATACTACAATAAAATATAATAATATGAAAAGGATTGATTCATGTTAGATTTTCCTC TAGAGATGGATCTGAATGTTCAGTTCCAGCCAAGGTAGATTTTACTTTCAACTTTTTAATCAATATCACTTTCTGTGCTTAATCTCTTTGGTGTTACCTTGTCCATTT WIBR Bioinformatics Course, Whitehead Institute,
5 Topics to Cover Pattern searching Gene Finding algorithms WIBR Bioinformatics Course, Whitehead Institute,
6 Pattern Searching RRRRYYYY TATAA[1,0,0] 4 purines followed by 4 pyrimidines TATAA, allowing 1 mismatch p1=6...8 GAGA ~p1 a hairpin with GAGA as the loop p1= p1 p1= p1[1,1,1] exact 6 character repeat separated by up to 8 allow one mismatch, deletion and insertion WIBR Bioinformatics Course, Whitehead Institute,
7 Pattern Searching Programs Patscan findpatterns fuzznuc, fuzzprot, fuzztrans, dreg scan_for_matches patfile < inputfile gcg; findpatterns EMBOSS programs; web and Unix WIBR Bioinformatics Course, Whitehead Institute,
8 Topics to Cover Pattern searching Gene Finding algorithms WIBR Bioinformatics Course, Whitehead Institute,
9 Problem to Solve WIBR Bioinformatics Course, Whitehead Institute,
10 Types of Signals to Detect Transcriptional TSS TATA box PolyA Translational Kozak (CC A/G CCAUGG) Termination codon (UAA, UAG, UGA) Splicing Introns - GT AG WIBR Bioinformatics Course, Whitehead Institute,
11 Gene Finding Strategies Content-based methods codon usage, compositional complexity Site-based methods presence or absence of specific pattern or sequence Comparative methods determination based on homology WIBR Bioinformatics Course, Whitehead Institute,
12 Evolution of Gene Finding Programs 1980 ORF Codon Usage 1990 Splice Sites/Exons 2000??? Whole genes Multiple genes Alternative splicing Functional RNAs Nested genes WIBR Bioinformatics Course, Whitehead Institute,
13 RepeatMasker WIBR Bioinformatics Course, Whitehead Institute,
14 RepeatMasker WIBR Bioinformatics Course, Whitehead Institute,
15 RepeatMasker Summary: Total length: 8750 bp GC level: 35.61% Bases masked: 6803 bp (77.75%) WIBR Bioinformatics Course, Whitehead Institute,
16 Coding Measures Look at frequencies of codons (e.g. redundancy of genetic code; Leucine = UUA, UUG, CUU, CUC, CUA, CUG) 6-tuple or hexamer approach ACCTCG TACTCG GCCCTC Thr Ser Tyr Ser Ala Leu WIBR Bioinformatics Course, Whitehead Institute,
17 Fifth Order Markov Models Periodic fifth order Markov model. Circles represent consecutive DNA bases, numbers indicate codon position, and the arrows indicate that the next base is generated conditionally on the previous five and on the codon position. Burge and Karlin, Current Opinions in Structural Biology 1998, 8: WIBR Bioinformatics Course, Whitehead Institute,
18 Hidden Markov Models unobserved or hidden states (e.g. coding or noncoding) states generated according to a first order Markov chain observable DNA bases each base generated conditionally on identity of corresponding hidden state Burge and Karlin, Current Opinions in Structural Biology 1998, 8: WIBR Bioinformatics Course, Whitehead Institute,
19 GENSCAN MM - prob for a given nuc to occur at position p depends on nuc occupying previous k postions Generalized Hidden Markov Model (GHMM) Optimize module performing signal recognition Incorporates influence of C+G content Considers gene models on both strands Can identify multiple genes Burge and Karlin, JMB:268:78-94, 1997 WIBR Bioinformatics Course, Whitehead Institute,
20 GENSCAN Burge and Karlin, JMB:268:78-94, 1997 WIBR Bioinformatics Course, Whitehead Institute,
21 Gene Finding Programs FGENES - Sanger Center, UK GeneMark HMM - Georgia Tech Genie - UCSC Genscan - Stanford and MIT HMMgene - CBS, Denmark Morgan - John Hopkins MZEF - Cold Spring Harbor WIBR Bioinformatics Course, Whitehead Institute,
22 HMR195 Test Set 103 human, 82 mouse, 10 rat sequences Sequence new since August, 1997 Genomic sequences containing exactly one gene No mrna sequences, pseudogenes or alternatively spliced genes The mean length of sequences is 7,096 bp Rogic, Mackworth and Ouellette, Genome Research 11: , 2001 WIBR Bioinformatics Course, Whitehead Institute,
23 HMR195 Test Set (con t) 43 single-exon genes; 152 multi-exon genes Average number of exons per gene is 4.86 Mean exon length = 208 bp, mean intron length = 678 bp, mean coding length per gene = 1,015 bp (~330 aa) Coding sequence 14%, intronic sequence 46% and intergenic DNA 40%. Rogic, Mackworth and Ouellette, Genome Research 11: , 2001 WIBR Bioinformatics Course, Whitehead Institute,
24 Definitions Sensitivity: the proportion of true sites(e.g., exons or donor splice sites) which are correctly predicted = TP/(TP + FN) Specificity: the proportion of predicted sites which are correct = TP/(TP + FP) WIBR Bioinformatics Course, Whitehead Institute,
25 Results of Program Comparisons Genscan and HMMgene had reliable scores for exons Nucleotide Sn =.95 for Genscan and.93 for HMMgene. Sp =.90 and.93, respectively Accuracy dependent on G+C content Rogic, Mackworth and Ouellette, Genome Research 11: , 2001 WIBR Bioinformatics Course, Whitehead Institute,
26 GenomeScan Combines exon-intron and splice signal models with similarity to know proteins Used to identify genes in human draft sequence Uses GENSCAN and BLASTX Procrustes and Genewise similar but can only predict one gene per genomic sequence Yeh, Lim, and Burge, Genome Research 11: , WIBR Bioinformatics Course, Whitehead Institute,
27 GenomeScan Yeh, Lim, and Burge, Genome Research 11: , WIBR Bioinformatics Course, Whitehead Institute,
28 GenomeScan Yeh, Lim, and Burge, Genome Research 11: , WIBR Bioinformatics Course, Whitehead Institute,
29 GenomeScan Yeh, Lim, and Burge, Genome Research 11: , WIBR Bioinformatics Course, Whitehead Institute,
30 Other Approaches Use microarrays to identify expressed genes based on the coexpression of sets of adjacent exons as predicted by GENSCAN (Shoemaker, et al, Nature 409: , 2001) RT-PCR with radio-labeled primers targeted to pairs of adjecent predicted exons, followed by sequencing of the amplified product (Burge et al, in preparation) WIBR Bioinformatics Course, Whitehead Institute,
31 Future Challenges Alternative Splicing Gene products functioning at RNA level Nested genes 5' end of genes Other unusual characteristics WIBR Bioinformatics Course, Whitehead Institute,
32 Coming attractions Next section on Computational Methods Unix accounts Course Projects WIBR Bioinformatics Course, Whitehead Institute,
Functional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
State of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
Chapter 7. Motif finding (week 11) Chapter 8. Sequence binning (week 11)
Course organization Introduction ( Week 1) Part I: Algorithms for Sequence Analysis (Week 1-11) Chapter 1-3, Models and theories» Probability theory and Statistics (Week 2)» Algorithm complexity analysis
Eukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
Genome 373: Genomic Informatics. Professors Elhanan Borenstein and Jay Shendure
Genome 373: Genomic Informatics Professors Elhanan Borenstein and Jay Shendure Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis
CS284A Representations & Algorithms for Molecular Biology. Xiaohui S. Xie University of California, Irvine
CS284A Representations & Algorithms for Molecular Biology Xiaohui S. Xie University of California, Irvine Today s Goals Course information Challenges in computational biology Introduction to molecular
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks. David R. Kelley
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks David R. Kelley DNA codes for complex life. How? Kundaje et al. Integrative analysis of 111 reference
Searching (Sub-)Strings. Ulf Leser
Searching (Sub-)Strings Ulf Leser This Lecture Exact substring search Naïve Boyer-Moore Searching with profiles Sequence profiles Ungapped approximate search Statistical evaluation of search results Ulf
Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy
Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy OVERVIEW- Method updated and written by Sarah Louie (6/19/08) Initially
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Large Scale Sequence Analysis with Applications to Genomics
Large Scale Sequence Analysis with Applications to Genomics Gunnar Rätsch, Max Planck Society Tübingen, Germany Talk at CWI, Amsterdam October 23, 2009 Gunnar Rätsch (FML, Tübingen) Large Scale Sequence
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
Strain or plasmid Description a Reference or source b. 168 trpc2 Laboratory. 1A780 trpc2 sigb::spc BGSC
TABLE S1 Bacterial strains and plasmids Strain or plasmid Description a Reference or source b B. subtilis 168 trpc2 Laboratory stock 1A780 trpc2 sigb::spc BGSC BM1010 trpc2 htpx::pgs1582; Em r BM1302 trpc2
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
Supporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
VIIKKI BIOCENTER University of Helsinki
VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja
CSC:n käyttäjätunnukset - myös opiskelijoille
CSC:n käyttäjätunnukset - myös opiskelijoille http://www.csc.fi/asiakkaaksi/korkeakoulut/kayttol upahakemukset/index_html Ohjaajan nimeksi Petri Törönen Perusteluiksi opiskelu ja luentokurssin nimi (Geneettisen
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
rapid evolution in copy number, location and sequence, with diverse turnover mechanisms.
Repetitive DNA and its evolution: genomic strategies to understand the processes and exploit biodiversity rapid evolution in copy number, location and sequence, with diverse turnover mechanisms. often
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
Supporting information
Supporting information Figure S1. Carotenoid biosynthesis pathway in papaya fruit which is adopted from Blas et al. (2010) (reference 4) and Nisar et al. (2015) (reference 5). Carotenoids are synthesized
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
Manolis Kellis Piotr Indyk
6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Rapid database search Courtsey of CCRNP, The National Cancer Institute. Manolis Kellis Piotr Indyk Protein interaction network Courtesy
Enseigner l'évolution
AATTTTCGTATCTGTTGGAGTTAGATAAGCCTACGCTTGATGGACCGTTGGGTGGCTTTCTAAGTGAGCTCGTGCCATCACAATTAATATAAGGAATTGTAGATGTTTCTTTCGTTATAGGTATTTCAAAAT TTATAAGAACCTACGCCCTCGTCTTTCTCCATTGGAACAGTTGCCGTTTTCGCAGTTCTTTTTGGTTCAGTCCTCATATCATGTGATTCCCCTGGCTCTCCTGATCTTTTTATACTTACTTTGAAATCGTCA
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
Chapter 9 Motif finding. Chaochun Wei Spring 2019
1896 1920 1987 2006 Chapter 9 Motif finding Chaochun Wei Spring 2019 Contents 1. Reading materials 2. Sequence structure modeling Motif finding Regulatory module finding 2 Reading materials Tompa et al
Large Scale Sequence Analysis with Applications to Genomics
Large Scale Sequence Analysis with Applications to Genomics Gunnar Rätsch, Max Planck Society Tübingen, Germany Talk at CSML, University College London March 18, 2009 Gunnar Rätsch (FML, Tübingen) Large
RINNAKKAINEN OHJELMOINTI A,
RINNAKKAINEN OHJELMOINTI 815301A, 18.6.2005 1. Vastaa lyhyesti (2p kustakin): a) Mitkä ovat rinnakkaisen ohjelman oikeellisuuskriteerit? b) Mitä tarkoittaa laiska säikeen luominen? c) Mitä ovat kohtaaminen
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
Python Libraries 1 / 14
Python Libraries 1 / 14 Gzip, CSV https://docs.python.org/3/library/gzip.html https://docs.python.org/3/library/csv.html https://daler.github.io/pybedtools/ - PyBed tools http://biopython.org/wiki/gff_parsing
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
7. Product-line architectures
7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software
HARJOITUS- PAKETTI A
Logistiikka A35A00310 Tuotantotalouden perusteet HARJOITUS- PAKETTI A (6 pistettä) TUTA 19 Luento 3.Ennustaminen County General 1 piste The number of heart surgeries performed at County General Hospital
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
VIIKKI BIOCENTER University of Helsinki
VIIKKI BIOCENTER University of Helsinki Mitä uudet DNA sekvensointimenetelmät voivat paljastaa luonnonjärjestelmästä? Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Petri
Capacity utilization
Mat-2.4142 Seminar on optimization Capacity utilization 12.12.2007 Contents Summary of chapter 14 Related DEA-solver models Illustrative examples Measure of technical capacity utilization Price-based measure
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
Lampiran 1 Komposisi media pertumbuhan yang digunakan A. Media nutrien agar (NA) - Agar 1.5% - Nutrient broth 0.8%
LAMPIRAN 8 9 Lampiran 1 Komposisi media pertumbuhan yang digunakan A. Media nutrien agar (NA) - Agar 1.5% - Nutrient broth 0.8% B. Media King s B agar - Agar 1.5% - Pepton 2% - K 2 HPO 4 0.15% - MgSO 4.4H
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
Viral DNA as a model for coil to globule transition
Viral DNA as a model for coil to globule transition Marina Rossi Lab. of complex fluids and molecular biophysics LITA (Segrate) UNIVERSITA DEGLI STUDI DI MILANO - PhD Workshop October 14 th, 2013 Temperature
WindPRO version joulu 2012 Printed/Page :47 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)
Tilasto T1106120-s2012palaute Kyselyn T1106120+T1106120-s2012palaute yhteenveto: vastauksia (4) Kysymys 1 Degree programme: (4) TIK: TIK 1 25% ************** INF: INF 0 0% EST: EST 0 0% TLT: TLT 0 0% BIO:
11/17/11. Gene Regulation. Gene Regulation. Gene Regulation. Finding Regulatory Motifs in DNA Sequences. Regulatory Proteins
Gene Regulation Finding Regulatory Motifs in DNA Sequences An experiment shows that when X is knocked out, 20 other s are not expressed How can one have such drastic effects? Regulatory Proteins Gene X
Hankkeen toiminnot työsuunnitelman laatiminen
Hankkeen toiminnot työsuunnitelman laatiminen Hanketyöpaja LLP-ohjelman keskitettyjä hankkeita (Leonardo & Poikittaisohjelma) valmisteleville11.11.2011 Työsuunnitelma Vastaa kysymykseen mitä projektissa
Bioinformatiikan maisteriohjelma
Bioinformatiikan maisteriohjelma Avajaiset 5.9.2006 Esa Pitkänen Ohjelma Esittelykierros Juhon ja Samin alkusanat Lukuvuoden 06-07 opetus ja käytännön asioita MBI-webbisivut Tarjoilua! Opiskelijoiden ohjaus
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 5.11.2013 16:44 / 1 Minimum
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
Työsuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016. Peter Michelsson Wallstreet Asset Management Oy
Työsuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016 Peter Michelsson Wallstreet Asset Management Oy Wallstreet lyhyesti Perustettu vuonna 2006, SiPa toimilupa myönnetty 3/2014 Täysin kotimainen,
,0 Yes ,0 120, ,8
SHADOW - Main Result Calculation: Alue 2 ( x 9 x HH120) TuuliSaimaa kaavaluonnos Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered
LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet
LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50
Increase of opioid use in Finland when is there enough key indicator data to state a trend?
Increase of opioid use in Finland when is there enough key indicator data to state a trend? Martta Forsell, Finnish Focal Point 28.9.2015 Esityksen nimi / Tekijä 1 Martta Forsell Master of Social Sciences
TEST REPORT Nro VTT-S Air tightness and strength tests for Furanflex exhaust air ducts
TEST REPORT Nro VTT-S-04515-08 19.5.008 Air tightness and strength tests for Furanflex exhaust air ducts Requested by: Hormex Oy TEST REPORT NRO VTT-S-04515-08 1 () Requested by Order Hormex Oy Linnanherrankuja
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
lpar1 IPB004065, IPB002277, and IPB Restriction Enyzme Differences from REBASE Gained in Variant Lost from Reference
lpar1 IPB465, IPB2277, and IPB5385 Genomic Sequence Coding Sequence For help interpreting these results, view the PARSENP Introduction page. # View On Sequence Nucleotide Change Effect Restriction Enyzme
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä
M a t t i K a t t a i n e n O T M 1 1. 0 9. 2 0 1 9 Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä Ympäristöoikeustieteen
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Plasmid construction PCR reactions were carried out with Pfu or Pfu turbo polymerases (Stratagene) unless otherwise stated.
Expanding the Genetic Code of Yeast for Incorporation of Diverse Unnatural Amino Acids via a Pyrrolysyl-tRNA Synthetase/tRNA Pair Susan M. Hancock 1, Rajendra Uprety 2, Alexander Deiters 2 & Jason W. Chin
BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
MOOC toiveita ja pelkoja. Jaakko Kurhila opintoesimies tietojenkäsittelytieteen laitos Helsingin yliopisto
MOOC toiveita ja pelkoja Jaakko Kurhila opintoesimies tietojenkäsittelytieteen laitos Helsingin yliopisto Messukeskus 2.12.2013 massive open online course 1980 jokaisella on pilvi taskussa 1869 2013 Aika
Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO
Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO Tomi Kauppinen, Eero Hyvönen, Jari Väätäinen Semantic Computing Research Group (SeCo) http://www.seco.tkk.fi/
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Yliopisto-opinnoissa karttuvat työelämätaidot. Eila Pajarre, Mira Valkonen ja Sanna Kivimäki TTY
Yliopisto-opinnoissa karttuvat työelämätaidot Eila Pajarre, Mira Valkonen ja Sanna Kivimäki TTY Top 5 desirable future work skills Judgment and decision making: Considering the relative costs and benefits
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
Bioinformatics in Laboratory of Computer and Information Science
HELSINKI UNIVERSITY OF TECHNOLOGY LABORATORY OF COMPUTER AND INFORMATION SCIENCE Bioinformatics in Laboratory of Computer and Information Science Samuel Kaski Research Two centers of excellence of the
arxiv: v1 [stat.ml] 27 Feb 2011
TKK Dissertations in Information and Computer Science Espoo 2010 TKK-ICS-D19 arxiv:1102.5509v1 [stat.ml] 27 Feb 2011 PROBABILISTIC ANALYSIS OF THE HUMAN TRANSCRIPTOME WITH SIDE INFORMATION Leo Lahti Dissertation
WP3 Decision Support Technologies
WP3 Decision Support Technologies 1 WP3 Decision Support Technologies WP Leader: Jarmo Laitinen Proposed budget: 185 000, VTT 100 000, TUT 85 000. WP3 focuses in utilizing decision support technologies
Counting quantities 1-3
Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X 2. Rastita Tick (X) (X) the kummassa box that has
Rakennukset Varjostus "real case" h/a 0,5 1,5
Tuulivoimala Rakennukset Asuinrakennus Liikerak. tai Julkinen rak. Lomarakennus Teollinen rakennus Kirkollinen rakennus Varjostus "real case" h/a 1 h/a 8 h/a 20 h/a 1 2 3 5 8 4 6 7 9 10 0 0,5 1 1,5 2 km
MUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.9.269
Telecommunication Software
Telecommunication Software Final exam 21.11.2006 COMPUTER ENGINEERING LABORATORY 521265A Vastaukset englanniksi tai suomeksi. / Answers in English or in Finnish. 1. (a) Määrittele sovellusviesti, PersonnelRecord,
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Guideline on Similar biological medicinal products containing biotechnology-derived proteins as active substance: non-clinical and clinical issues
Guideline on Similar biological medicinal products containing biotechnology-derived proteins as active substance: non-clinical and clinical issues EMA Workshop on Biosimilars, 31 October 2014 Pekka Kurki
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto Tämän viestinnän, nykysuomen ja englannin kandidaattiohjelman valintakokeen avulla Arvioidaan viestintävalmiuksia,
AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY VERKOTAN OY VERKOTAN LTD.
T287/M03/2017 Liite 1 / Appendix 1 Sivu / Page 1(5) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY VERKOTAN OY VERKOTAN LTD. Tunnus Code Laboratorio Laboratory Osoite Address www www T287
Alternatives to the DFT
Alternatives to the DFT Doru Balcan Carnegie Mellon University joint work with Aliaksei Sandryhaila, Jonathan Gross, and Markus Püschel - appeared in IEEE ICASSP 08 - Introduction Discrete time signal
HITSAUKSEN TUOTTAVUUSRATKAISUT
Kemppi ARC YOU GET WHAT YOU MEASURE OR BE CAREFUL WHAT YOU WISH FOR HITSAUKSEN TUOTTAVUUSRATKAISUT Puolitetaan hitsauskustannukset seminaari 9.4.2008 Mikko Veikkolainen, Ratkaisuliiketoimintapäällikkö
QUALITATIVE COMPARATIVE ANALYSIS
Methods circle 27 November 2015 QUALITATIVE COMPARATIVE ANALYSIS A VERY SHORT INTRODUCTION Laura Elena Sibinescu 27.11.2015 1 TOPICS Set-theoretic approaches in social sciences What is QCA? What kind of
Tilausvahvistus. Anttolan Urheilijat HENNA-RIIKKA HAIKONEN KUMMANNIEMENTIE 5 B RAHULA. Anttolan Urheilijat
7.80.4 Asiakasnumero: 3000359 KALLE MANNINEN KOVASTENLUODONTIE 46 51600 HAUKIVUORI Toimitusosoite: KUMMANNIEMENTIE 5 B 51720 RAHULA Viitteenne: Henna-Riikka Haikonen Viitteemme: Pyry Niemi +358400874498
Robert S. Broadhead, Ph.D., University of Connecticut Pavlo Smyrnov, Oleksandra Datsenko and Oksana Matiyash International HIV/AIDS Alliance in
Robert S. Broadhead, Ph.D., University of Connecticut Pavlo Smyrnov, Oleksandra Datsenko and Oksana Matiyash International HIV/AIDS Alliance in Ukraine Robert S. Broadhead, Ph.D., University of Connecticut
Innovation Platform Thinking Jukka P. Saarinen Mika M. Raunio Nadja Nordling Taina Ketola Anniina Heinikangas Petri Räsänen
Innovation Platform Thinking 17.6.2015 Jukka P. Saarinen Mika M. Raunio Nadja Nordling Taina Ketola Anniina Heinikangas Petri Räsänen Motivation for platform thinking... Normal project with different phases:
WindPRO version joulu 2012 Printed/Page :42 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 13.6.2013 19:42 / 1 Minimum
TM ETRS-TM35FIN-ETRS89 WTG
VE1 SHADOW - Main Result Calculation: 8 x Nordex N131 x HH145m Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please
S-55.1100 SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA
S-55.00 SÄHKÖKNKKA A KONKKA. välikoe 2..2008. Saat vastata vain neljään tehtävään!. aske jännite U. = 4 Ω, 2 = Ω, = Ω, = 2, 2 =, = A, 2 = U 2 2 2 2. ännitelähde tuottaa hetkestä t = t < 0 alkaen kaksiportaisen
Poraustyökierrot ja piirteiden tunnistus
Poraustyökierrot ja piirteiden tunnistus 2.5 to 5-Axis Drilling Operations Create a Spot Drilling Operation Create a Drilling Operation Create a Drilling Dwell Delay Operation Create a Drilling Deep Hole
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579