52739 Bioinformatiikan perusteet Kevät 2013

Koko: px
Aloita esitys sivulta:

Download "52739 Bioinformatiikan perusteet Kevät 2013"

Transkriptio

1 52739 Bioinformatiikan perusteet Kevät 2013 Petri Törönen Materiaalia kommentoineet: Pekka Kohonen, Petri Auvinen, Liisa Holm Kiitokset

2 Päivi Onkamo äitiyslomalla Petri Törönen tuuraamassa petri DOT toronen AT helsinki DOT fi Biokeskus 2, D-porras, 7. krs Huone 7002

3 Bioinformatiikan perusteet, 3 op (52739) Luennot , ti, to klo , BIOK2 AUD1041. Kurssin kotisivut: Flammassa työn alla, alla, alla. WWW: Kuulustelu: klo , Infotalo, auditorio 2. Uusinnat: Ensimmäinen uusinta??? Kotitehtävät: tehtävänannot tulevat perjantaisin kurssin kotisivuille. Tarkastetaan yhteisesti seuraavan keskiviikon luennoilla. Omia vastauksia ei siis palauteta luennoijalle. Luennoitsijat: FT Petri Törönen, Dos. Rainer Lehtonen

4 Oheislukemistoa: CSC:n Sekvenssianalyysiopas (lataa pdf osoitteesta tai tilaa painettuna CSC:ltä hintaan 15 kpl) Bioinformatiikan perusteet (kirj. Tuimala J), ladattavissa pdf:nä tai tilattavissa (kuten edellä) Xiong: Essential Bioinformatics, 2006 (osin, tämä teos on myös yksi perimän cum laude -tenttikirjoista) Zvelebil & Baum: Understanding Bioinformatics, 2008 Pevsner: Bioinformatics and Functional Genomics, 2009.

5 WWW Google: bioinformatics tutorial OR guide. otutorials.aspx NIH:n kokoelma WWW-kursseista nal.pcbi Kokoelma WWW-kurseista. Kurssien plussat ja miinukset kuvattu! GOBLET-organisaation kokoelma WWW-oppaita EBI:in ohjelmien opetusta

6 Tiedoksi JOO-opiskelijoille Yliopiston verkkotunnuksista: JOO-opiskelijoille kuuluu HY:n mikroverkkotunnus. Sen saa Impact factorysta opintopalvelupisteestä. Ota mukaan JOO-hyväksymisilmoitus ja jos sieltä ei saa, tiedustele Heikki Tuuralalta: Heikki Tuurala suunnittelija Helsingin yliopisto Bio- ja ympäristötieteiden laitos Puh

7 Luentokurssin sisältö Johdanto bioinformatiikan tärkeimpiin menetelmiin Kurssilla käsitellään sekvenssianalyysiin liittyviä menetelmiä: kahden ja useamman sekvenssin rinnastuksen teoriaa (esim.dot-plot, progressiivinen rinnastus, ClustalX, Muscle), tietokantahakualgoritmeja (BLAST). Yleisimmin käytettyjä tietokantoja (NCBI, EMBL, Uniprot), fylogeneettistä analyysiä, geenikartoitusta, mikrosiru- ja promoottorianalyysejä, sekä hiukan farmakogenomiikkaa Kurssin suorittaminen: Hyväksytty tentti (vähintään 50% pisteistä ansaittu).

8 Tentti Aineistotenttinä: luentomateriaalin saa ottaa mukaan tenttiin. Tenttikysymykset laaditaan luennoilla läpikäytyjen asioiden pohjalta, ja ne ovat luonteeltaan soveltavia Tentti arvostellaan normaalisti asteikolla 1-5 (siis arvosanan 1/5 saavuttamiseksi vähintään 50% max-pisteistä täytyy olla ansaittuna).

9 Luentojen aiheet, aikataulu Johdanto, pisteytysmatriisit Kahden sekvenssin rinnastus BLAST Biotietokannat I Biotietokannat II Usean sekvenssin rinnastus 4.2. Molekyylisystematiikka I 6.2. Molekyylisystematiikka II Geeniekspressio: Mikrosirut Genomiikka Geenikartoitus I. Tutkimusprojektin esittely Geenikartoitus II. Farmakogenetiikka TENTTI

10 Mitä bioinformatiikka on?

11 Mitä bioinformatiikka on? Informaatiotieteen ja biologian välimaastoa Tieteenala, joka kehittää informaatio- ja tietoteknisiä välineitä biologisten ongelmien ratkaisemiseksi Informaatioteknologian ala, jota käytetään biologisen informaation tallentamiseen, ylläpitämiseen ja analysoimiseen Bioinformatiikka on osa laskennallista biologiaa Perustuu J.Tuimalan originaaleihin

12 Mitä bioinformatiikka on? Tieteellisiä kysymyksiä pyritään ratkaisemaan käymällä laajoja biologisia aineistoja läpi Aineisto voi olla tutkimusryhmän omaa tai se voi olla peräisin julkisista tietokannoista Aineistojen suuruuden takia tarvitaan tietojenkäsittelyn tarjoamia menetelmiä Analyysitehtävät voivat olla myös manuaalisesti vaikeita/mahdottomia ratkaista

13 Bioinformatiikan osuus kasvussa Tietokantojen koko on kasvanut räjähdysmäisesti High Throughput-menetelmät Käytettävissä oleva laskentateho (tietokoneiden tehokkuus) on kasvanut Uusien menetelmien kehittyminen bioinformatiikan, tilastotieteen ja tietojenkäsittelyn (koneoppimisen) saralla

14 Tietokantojen sisällön kasvu Tilastoja, European Nucleotide Archive (ENA) eli geenipankki : Eri lajien osuudet tietokannassa olevista nukleotideista 2010: Total nucleotides 2010: 301,119,983,275, of which Homo sapiens Mus musculus Rattus norvegicus Bos taurus marine metagenome Pan troglodytes Danio rerio Zea mays Canis lupus familiaris Sus scrofa Other

15 Tietokantojen sisällön kasvu Tietokannat kasvavat eksponentiaalisesti Moreover, the volume of data is increasing exponentially with a doubling time of approximately 10 months

16 Kokonaan sekvensoituja genomeja * Prokaryootteja Arkkeja Eukaryootteja joista sieniä 16, kasveja 7, eläimiä 6, ja alkueliöitä (protists) 10. Valmiina mm: hiiva, sukkulamadot (2 lajia), banaanikärpänen (2 lajia), ihminen, simpanssi, sika, hiiri, pallokala, riisi, lituruohovehnä, maissi, hamppu. Nearly-there : Eläimistä: jättiläispanda, koira, marsu, siili, kissa, opossumi, elefantti, 9-vyövyötiäinen, nauta, hevonen, vesipuhveli, mehiläinen, kimalainen, kana, seeprakala, malariahyttynen, jne. Kasveista: koivu, omena, ohra, soija, jättipoppeli, tomaatti, vehnä, papaija, durra, kookospalmu, mung-papu, papaija, aitoviini jne. seeprakala opossumi *http://www.ncbi.nlm.nih.gov/genomes/static/gpstat.html

17 Kokonaan sekvensoituja genomeja PAH!!! EDELLINEN KALVO VANHA Tämäkin lukumäärä kasvaa eksponentiaalisesti 2013: Arhaea: 181, Bacteria: 3762, Eukaryotes: 183 (*) 2014: Arhaea: 277, Bacteria: 11777, Eukaryotes: 312 (**) * **

18 Laboratoriomenetelmien mullistus Laboratorioanalyysi siirtynyt kokonaisten eliöiden kaikkien geenien samanaikaiseen tutkimiseen Mikrosiru-menetelmät High Throughput-menetelmät Uuden sukupolven sekvensointi Proteomics & metabolomics

19 Mikrosirumenetelmät Kehitetty tutkimaan ~ geenin aktiivisuutta biologisessa näytteessä Menetelmä kuvataan luennoilla myöhemmin Mahdollistaa kaikkien tunnettujen geenien samanaikaisen tutkimisen näytteestä Mikrosirut on suunniteltu eliökohtaisesti Eivät (tavallisesti) sovellu populaatioihin

20 Mikrosirumenetelmät Sovelluksia: Geenien aktiivisuus laboratoriotestin aikana Geenien aktiivisuuksien vertailu erilaisten genotyyppien välillä Geenien aktiivisuuksien vertailu terveen ja tautikudoksen välillä

21 High Throughput menetelmät Laboratoriotutkimusta rinnakkaistettuna Käytetään robotiikkaa ja testataan erilaisia olosuhteita / reagensseja Usein testataan esim. kaikkia tutkittavan eliön geenejä Koneellinen kuva-analyysi voi tallentaa esim. solujen morfologisia muutoksia käsittelyn jälkeen

22 High Throughput menetelmät Sovelluksia: Gene knockout / RNA-silencing studies High throughput drug screening Proteiinien sitoutuminen toisiinsa eliötasolla

23 Next Generation Sequencing Laitteita jotka sekvensoivat vahvasti rinnakkaisesti ( sekvenssijaksoa/analyysi) Jokainen jakso nukleotidia pitkä Tulos saadaan kun jaksot yhdistetään Sovelluksia: Genomin de novo-sekvensointi Genomin re-sekvensointi RNA-sekvensointi

24 Next Generation Sequencing Genomin de-novo-sekvensointi Luodaan tutkittavan eliön genomisekvenssi pelkästään sekvensointituloksien avulla Ei aikaisempaa genomisekvenssiä Genomin re-sekvensointi Tutkitaan esim. potilaita tai syöpäkudoksia Sekvensoidaan genomi ja haetaan (yhteisiä) eroja muuhun populaatioon

25 Next Generation Sequencing RNA-sekvensointi Mikrosirutekniikat selvittävät karkeasti RNA:n määrän Analyysistä uupuu Splice Variants, SNP, alleelispesifinen ekspressio RNA sekvensoinnissa sekvensoidaan lähes kaikki löydetyt RNA-sekvenssit Metagenomiikka Tutkitaan esim. mikrobipopulaatioita sekvensoimalla kaikki genominen DNA näytteestä

26 Suurien aineistojen yhdistely In-house gene expression data vs. gene expression data in web Gene expression data vs. protein-protein interaction data Large scale data comparisons across different species

27 Bioinformatiikan sovelluksia Taudinaiheuttajien tunnistus, mikrobidiagnostiikka Geneettinen neuvonta + Personalized Medicine Lääkeaineiden pää- ja sivuvaikutuksien vertailu Lääkeaineiden valinta (screening)..

28 Mitä tällä informaatiolla voi tehdä? Mihin bioinformatiikkaa tarvitsee? ESIM: Meksikossa puhkeaa vaarallinen virusepidemia Eristetään virus potilasnäytteistä ja sekvensoidaan sen perimä näyttää influenssavirukselta Etsitään viruksen sukulaisia - sekvenssirinnastus, fylogenia -> H1N1 Antaa tietoa siitä, mitä epidemialta voidaan odottaa, mitä muita taudinaiheuttajia ja tauteja se voisi muistuttaa? Miten virus on syntynyt? Epidemian seuranta Selvitetään viruksen tuottamat proteiinit - sekvenssirinnastus Miten virus pääsee soluun? Voitaisiinko sitä estää? Proteiinien rakenne Homologiamallinnus - miten tämä virus eroaa muista ja miksi se voi olla tappava? Lääkeainesuunnittelu? Mahdollisten rokotteeksi sopivien rakenteiden tunnistaminen Perustuu J.Tuimalan originaaleihin

29 Molekulaarinen fylogenetiikka Tutkija on hankkinut DNA-näytteitä joukosta hyljelajeja, ja sekvensoinut joitakin geenejä. Miten sekvenssijoukko on kehittynyt? Miten lajijoukko on kehittynyt? Millaisia yhteisiä piirteitä tiettyjen lajien genomeilla on? Perustuu J.Tuimalan originaaleihin

30 Hiivasoluille on annettu lämpöshokki käsittely. Mitkä geenit ekspressoituvat normaalitasoa voimakkaammin tai heikommin heti shokin jälkeen? Entä tunti, 2 tuntia sen jälkeen? Miten näiden geenien toiminta saattaisi liittyä toisiinsa (julkisissa tietokannoissa olevan tiedon perusteella - huomaa, että tämä on aivan liian laajaa käsin tutkittavaksi!) Geeniekspressioaineiston ryhmittelyanalyysi:

31 Lisää sovellusalueita Mitä samanlaisten geenisäätelytekijöiden sitoutumissekvenssejä keskenään samanaikaisesti ilmeneviltä geeneiltä löytyy? (Vaikkapa heat shockin jälkeen?)

32 Lisää sovellusalueita tai miten löytää DNA-sekvensseistä upouusia säätelytekijöitä, joista ei vielä edes tiedetä minkälaista sekvenssinpätkää ollaan etsimässä? Olet sekvensoinut DNA:ta tai jonkin proteiinin; sekvenssin tehtävä ei selviä itse sekvenssistä, se ei siis muistuta mitään ennestään tunnettua niin selvästi että erehtymisen vaaraa ei olisi. Mihin toisiin geeneihin/proteiineihin ja eliölajeihin sekvenssillä olisi vastaavuutta? Mitä nämä geenit/proteiinit tekevät? (Liikaa manuaalisesti tutkittavaksi!) Geenikartoituksen menetelmin on genomista löydetty tautigeenin todennäköisin sijaintialue, mutta tällä alueella on edelleen ainakin 30 eri geeniä, joista periaatteessa mikä tahansa voisi olla tautigeeni. Mitä nämä tunnetut geenit tekevät? Mikä tai mitkä niistä olisivat potentiaalisimpia tautiriskiin vaikuttavia geenejä?

33 Jokamiehen bioinformatiikkaa Sekvenssien rinnastus Sekvenssien haku tietokannasta sekvenssillä Sekvenssien haku avainsanojen avulla

34 Sekvenssien rinnastus Kahden sekvenssin rinnastus Kuinka samankaltaisia kaksi sekvenssiä ovat keskimäärin? Löytyykö sekvensseistä lyhyempiä samankaltaisia alueita, vaikka ne keskimäärin olisivat varsin erilaisia? Usean sekvenssin rinnastus Rinnastetaan monta sekvenssiä joilla sama funktio Löytyykö sekvensseistä yhteisiä, samankaltaisia alueita? Mahdollinen aktiivinen keskus Molekyylisystematiikka fylogenia

35 Sekvenssihaut Tietokantahaut Löytyykö sekvenssi tietokannasta asiasanahaulla? Esim. hemoglobin and human? Sekvenssihaut Mitä sekvenssejä tietokannasta löytyy, kun tiedossamme on ehkä vain pätkä sekvenssiä? ACGTACGTACGTCCCCAGTCTAGAG Perustuu J.Tuimalan originaaleihin

36 Muistakaa tämä Monet bioinformatiikan menetelmät tuottavat aina jotain tuloksia Tulokset täytyy varmistaa riippumattomalla menetelmällä Parhaassa tutkimuksessa laboratorio- ja bioinformatiikkamenetelmät tukevat toisiaan

37 Sekvenssirinnastus ja pisteytysmatriisit

38 Rinnastus (Alignment) Bioinformatiikan keskeisimpiä tehtäviä Keino selvittää kuinka samanlaisia kaksi sekvenssiä on Sekvenssit voivat olla proteiineja, DNA-alueita Rinnastus usein piilossa muiden tehtävien sisällä Eniten samanlaisten sekvenssien haku tietokannoista Monen sekvenssin rinnastus Onnistunut rinnastus on usein vaatimus muiden monimutkikkaampien tehtävien onnistumiselle Rinnastuksella siirretään usein tietoa sekvenssistä toiseen

39 Mitä on rinnastus? I Tarkoittaa sitä, että eri sekvensseissä samoilla kohdin olevat samanlaiset aminohapot tai nukleotidit asetetaan kohdakkain. Esimerkiksi ACGTACGT ACGTACGT ACGTACGT ACTACT AC-TACT AC-TAC-T Rinnastukseen voidaan lisätä aukkoja (gap, merkitään yleensä -, toisinaan myös.) siten, että samanlaiset aminohapot tai nukleotidit osuvat kohdakkain. Perustuu J.Tuimalan originaaleihin

40 Mitä on rinnastus II Rinnastuksella pyritään siis asettamaan sekvenssien samankaltaiset alueet kohdakkain. Tällä tavalla pyritään löytämään eri sekvensseissä olevia homologisia alueita. Samankaltaisuus (yleisesti) Mistä tahansa syystä johtuva kahden sekvenssin samanlainen tai samantapainen rakenne Homologia Sekvenssien evolutiivisista suhteista johtuva samankaltaisuus. Samankaltaisuus johtuu siis siitä, että eri sekvenssit periytyvät yhteisestä kantamuodosta. Perustuu J.Tuimalan originaaleihin

41 Rinnastaminen Mikä seuraavista on paras rinnastus? ACGTACGT ACGTACGT ACGTACGT ACTACT AC-TAC-T A-CTAC-T Kuinka samankaltaisia eri nukleotidit ovat? Miten luoduista aukoista rankaistaan? Tarvitaan jokin pisteytystapa Pisteytysmatriisi! (Engl. scoring matrix tai substitution matrix) Perustuu J.Tuimalan originaaleihin

42 Pisteytysmatriisi = Substituutiomatriisi Taulukko, jossa kerrotaan aminohappojen tai nukleotidien muutosfrekvenssit (tai muutostodennäköisyydet) Kuvastaa aminohapoilla myös sitä kuinka samanlainen kyseinen pari on ominaisuuksiltaan. Lisäksi tarvitaan joku pisteytys rinnastuksen aukoille (aukkosakkoparametrit)

43 Esim: DNA-pisteytysmatriisit Identity matrix A T C G A T C G Suom. yksikkö- eli identiteettimatriisi BLAST matrix A T C G A T C G

44 DNA-pisteytysmatriisit Transition transversion matrix A T C G A T C G Aukkosakkoparametrit: -16 aukon avaamiselle ja -4 jatkamiselle.

45 Miten lasketaan rinnastuksen pistemäärä? ACGTACGT ACGTACGT ACGTACGT ACTACT AC-TAC-T A-CTAC-T Rinnastus 2: ACGTACGT AC-TAC-T Transitio-transversio-matriisi: A +1 C +1 Huomaa: Aukosta T +1 sakotetaan A pistettä C T +1 Yht =-26

46 Rinnastusten 1 ja 3 pistemäärät? Mikä rinnastus on paras (tällä pisteytysmatriisilla ja aukkosakoilla)?

47 Pisteytysmatriisit Kaikki pisteytysmatriisit ovat yrityksiä kvantifioida evolutiivisten muutoksien tapahtumistodennäköisyyksiä DNA:lle ja aminohapoille on OMAT pisteytysmatriisinsa Joidenkin aminohappojen säilyminen samana on proteiinin rakenteen (ja niinmuodoin funktion) säilymisen kannalta tärkeämpää kuin toisten siksi isompi sakko muuttumiselle! Aminohappojen pisteytysmatriisit yrittävät kertoa siitä, josko tietty mutaatio säilyttää tai muuttaa (tuhoaa) proteiinin funktion Mutaatio voi vaikuttaa myös proteiinin rakenteeseen Useimmiten symmetrisiä, toisinaan epäsymmetrisiä. symmetrisyys: muutoksen todennäköisyys on kumpaankin suuntaan sama P(Ala -> Cys) = P(Cys -> Ala) Perustuu J.Tuimalan originaaleihin

48 Matriisien käyttötarkoitukset? Kahden sekvenssin rinnastamisessa, mutta myös... Tietokantahauissa (BLAST) Molekyylisystematiikassa Sekvenssien välisten etäisyyksien laskeminen (proteiinit) Pisteytysmatriiseja aminohapoille: PAM, Blosum, JTT DNA:lle: IUB (osuma 1.9, huti 0) Rinnastukset tehdään nykyisin tietokoneella Aminohappojen pisteytysmatriisit perustuvat niiden muodostamiin ryhmiin Perustuu J.Tuimalan originaaleihin

49 Aminohapporyhmät (huomaa virhe!) Aminohappojen samankaltaisuus perustuu niiden muodostamiin ryhmiin Saman ryhmän jäsenet korvaavat usein toisiaan proteiinisekvenssissä

50 Otetaas uusiksi:

51 Aminohappomatriisit Aminohappomatriisit pyrkivät esittämään aminohappojen edellä näytettyjä samankaltaisuuksia Kaksi käytetyintä matriisi-ryhmää: PAM-matriisit BLOSUM-matriisit

52 Blosum62-matriisi Aukon avaamissakko 12 ja jatkamissakko 4 toimivat suhteellisen hyvin.

53 PAM250-matriisi

54 Aminohappomatriisit PAM-matriisien numeroarvo ilmoittaa matriisin point accepted mutation-arvon (seuraavalla kalvolla tästä lisää), joka ei vastaa tismalleen sekvenssien erilaisuutta prosentteina, mutta on sinne päin. BLOSUM-matriisien numeroarvo ilmoittaa sen sekvenssijoukon samankaltaisuuden, jonka pohjalta matriisi on muodostettu. Perustuu J.Tuimalan originaaleihin

55 Näkyvien sekvenssieroavaisuuksien suhde PAM-lukuun Perustuu J.Tuimalan originaaleihin

56 PAM-matriisit PAM matriisit perustuvat sekvenssien linjauksista tehtyihin puihin. Puussa sekvenssejä vertaillaan puun rakenteessa ja seurataan kuinka aminohapot muuttuvat (linkki 1) Tämä matriisien muodostus keskittyy erityisesti muutoksiin lähinaapureiden välillä Perustuu J.Tuimalan originaaleihin

57 BLOSUM-matriisit BLOSUM-matriisit perustuvat aukottomiin sekvenssien linjauksiin Aminohappojen muutoksia ei rajata lähinaapureiden välille. Jokainen sekvenssi voi muuttua miksi tahansa toiseksi sekvenssiksi Tämä matriisien muodostus painottaa enemmän kaukaisten sukulaisten välisiin samankaltaisuuksiin Perustuu J.Tuimalan originaaleihin

58 Aminohappomatriisit Kun rinnastetaan sekvenssejä tai muodostetaan fylogeneettisiä puita, tulee valita tilanteeseen sopiva matriisi. Esimerkiksi PAM50-matriisia tulisi käyttää 40% samankaltaisten sekvenssien rinnastamiseen. (kts. aikaisempi kuvaaja) Vastaavasti BLOSUM40-matriisia tulisi käyttää 40% samankaltaisten sekvenssien rinnastamiseen. Perustuu J.Tuimalan originaaleihin

59 Aminohappomatriisit Miten voi tietää sekvenssien samankaltaisuuden jo ennen niiden rinnastamista? Rinnastus ei ole objektiivista (aloitetaan akateemisella arvauksella :) Menetelmä vaatii useinkin kokeilemista erilaisilla asetuksilla tai matriiseilla. Haittaako, jos sekvenssijoukossa on kovin erilaisia sekvenssejä? Luultavasti, mutta sellaisten rinnastamiseen on tiettyjä menetelmiä, jolla ongelma voidaan kiertää. Perustuu J.Tuimalan originaaleihin

60

61 Yhteenveto rinnastuksesta Rinnastuksen tulos riippuu käytetystä pisteytysmatriisista. Valitse matriisi joka sopii hyvin tutkituille sekvensseille Sekvenssien samankaltaisuus keskeinen tekijä Perustuu J.Tuimalan originaaleihin

62 Yhteenveto rinnastuksesta Rinnastus pyrkii sijoittamaan sekvenssien toisiaan vastaavat alueet päällekkäin Rinnastuksen tulos riippuu siitä mitkä aminohapot arvioidaan keskenään samanlaisiksi Rinnastusalgoritmit käyttävät pisteytysmatriiseja, jotka arvioivat aminohappojen samankaltaisuutta. Perustuu J.Tuimalan originaaleihin

63 Ylimääräiset kalvot Luentokokonaisuuksien lopussa on kalvoja jotka olen jättänyt pois Usein näissä on silti hyödyllistä tietoa. Näitä ei käydä luennoilla Perustuu J.Tuimalan originaaleihin

64 Mistä pisteytysmatriisit tulevat? Empiiriset pisteytysmatriisit: Tietyn verran toisistaan eroavia proteiinisekvenssijoukkoja käyttäen on määritetty aminohappojen todennäköisyydet muuttua toisikseen log odds matriisi Perustuu J.Tuimalan originaaleihin

65 Matriisin muodostaminen II Empiiristen matriisien lähtömateriaalit PAM (1978) Evolutiivinen malli (puu) taustalla, 71 proteiiniryhmää BLOSUM (1992) BLOCKS-tietokanta GONNET (1992) Koko sekvenssitietokannan rinnastus JTT (1992) Evolutiivinen malli (puu) taustalla, mutta muodostamiseen käytetty suurempaa aineistoa kuin PAM-matriisien muodostamiseen Perustuu J.Tuimalan originaaleihin

66 Esim. PAM-matriisien muodostaminen PAM = percent accepted mutation Proteiinit etääntyvät (muuttuvat) alkuperäissekvenssistä siten, että niihin kerääntyy mutaatioita. Mutaatiot ovat sellaisia, että luonnonvalinta ei ole niitä karsinut, ja niitä voi siis löytyä populaatiosta. Tällaiset mutaatiot ovat niin sanotusti hyväksyttyjä (accepted). Mutaatioita tarkastellaan irrallaan niiden ympäristöstä ja historiasta. Perustuu J.Tuimalan originaaleihin

67 Esim. PAM-matriisien muodostaminen PAM on yksi kahden sekvenssin välillä tapahtunut hyväksytty pistemutaatio sataa aminohappoa kohden. Tietyt aminohappokohdat ovat voineet muuttua enemmän kuin kerran, mutta kahta sekvenssiä tarkasteltaessa voidaan kuitenkin aina havaita vain yksi muutos. Tällöin kahden sekvenssin välinen etäisyys on oikeasti suurempi kuin havaittujen muutosten määrä. Tämä täytyy ottaa ja otetaankin huomioon! Perustuu J.Tuimalan originaaleihin

68 Esim. PAM-matriisien muodostaminen PAM-matriisin muodostaminen alkaa fylogeneettisen puun piirtämisellä. Dayhoff et. al valitsivat proteiineja, joiden samankaltaisuus oli 85% tai enemmän, jotta useilta muutoksilta samassa kohdassa vältyttäisiin. Koska sekvenssit ovat suhteellisen samankaltaisia, on fylogeneettisen puunkin piirtäminen jokseenkin helppoa. Puun perusteella voidaan identifioida ja laskea hyväksytyt muutokset. Perustuu J.Tuimalan originaaleihin

69 Esim. PAM-matriisien muodostaminen Kun tiedetään Muutosten suunta (puu) Muutosten määrä Sekvenssien pituudet voidaan laskea matriisi, joka kuvaa muutostodennäköisyyksiä tai oikeammin niiden suhteita: kuinka tod.näk. tietty muutos on verrattuna kaikkiin ko. aminohapolle tapahtuneisiin muutoksiin Perustuu J.Tuimalan originaaleihin

70 Log odds-matriisi: Muutostodennäköisyyksien suhteista otetaan vielä logaritmi: p (0.02) <=> log 2 (0.02) <=> -5.6 ~ -6 P (2) <=> log 2 (2) <=> 1 ~ 1 Jos käytetään 2-kantaista logaritmia -> bittejä Usein käytetään myös ln(2)/3 = log10(2)/3 Engl. Scale Log odds-matriisi on siis sama asia kuin pisteytysmatriisi, esimerkiksi PAM250! Perustuu J.Tuimalan originaaleihin

71 Blosum Blosum-matriisien taustalla ei ole oletusta (puuta) sekvenssien evoluutiosta Muodostettu Blocks-tietokannassa olevien proteiinien konservoituneiden alueiden avulla Muutostodennäköisyydet laskettu olettaen, että muutos voi tapahtua mistä sekvenssistä miksi sekvenssiksi tahansa. Perustuu J.Tuimalan originaaleihin

72 Mikä on algoritmi? Perustuu J.Tuimalan originaaleihin

73 Algoritmi I Algoritmi on se joukko toimenpiteitä, joilla jokin haluttu (tai annettu) tehtävä saadaan suoritettua. Miten neuvoisit kaveriasi tulemaan Rautatieasemalta Biokeskukseen? Tule osoitteeseen Viikinkaari 9 A. Olettaa, että kaverisi osaa lukea karttaa. Ota taksi, ja aja osoitteeseen Viikinkaari 9 A. Kallis opintotuella elävälle kaverillesi. Perustuu J.Tuimalan originaaleihin

74 Algoritmi II Tarkennettu ohje voisi olla seuraavanlainen: Valitse seuraavista: Jos kellonaika on välillä 7-20: - kävele Rautatientorille - nouse bussiin 68 Jos sinulla on rahaa tai saat kimpan: - ota taksi. Mikäli ei rahaa tai haluat ulkoilla - kävele. Perustuu J.Tuimalan originaaleihin

75 Algoritmi III Käytännössä algoritmi on sijoitettu tietokoneohjelman osaksi. Yhdessä tietokoneohjelmassa voi olla useita algoritmeja. Algoritmien yhteistoiminta ratkaisee varsinaisen ongelman. Tämän jälkeen algoritmien ympärille kyhätty ohjelma (käyttöliittymä ja muut osaset) ilmoittaa tuloksen käyttäjälle sopivassa muodossa. Perustuu J.Tuimalan originaaleihin

S Laskennallinen systeemibiologia

S Laskennallinen systeemibiologia S-114.2510 Laskennallinen systeemibiologia 3. Harjoitus 1. Koska tilanne on Hardy-Weinbergin tasapainossa luonnonvalintaa lukuunottamatta, saadaan alleeleista muodostuvien eri tsygoottien genotyyppifrekvenssit

Lisätiedot

Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä

Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä Evoluutio ja luominen Mian tekemä esitys Jannen esittämänä Väite: tiedemiehet ovat todistaneet evoluutioteorian todeksi Evoluutioteorialla tässä tarkoitan teoriaa, jonka mukaan kaikki elollinen on kehittynyt

Lisätiedot

MAB3 - Harjoitustehtävien ratkaisut:

MAB3 - Harjoitustehtävien ratkaisut: MAB - Harjoitustehtävien ratkaisut: Funktio. Piirretään koordinaatistoakselit ja sijoitetaan pisteet:. a) Funktioiden nollakohdat löydetään etsimällä kuvaajien ja - akselin leikkauspisteitä. Funktiolla

Lisätiedot

Akateemisen ajattelun alkeiskurssi

Akateemisen ajattelun alkeiskurssi CHEM-A1600: Aalto-kurssi, 3 op Akateemisen ajattelun alkeiskurssi sami.franssila@aalto.fi 11.9-4.12.2015: 12 kertaa Mitä ajattelu on? Ajattelua on se hukka-aika, joka kuluu jonkun näkemisestä siihen kun

Lisätiedot

Molekyylisystematiikka 1.osa

Molekyylisystematiikka 1.osa Molekyylisystematiikka 1.osa Johdanto Käsitteet Sukulaisuuksien esittäminen eri formaateissa Puut: eri tavat muodostaa puu, algoritmeja, ohjelmistoja, esimerkki Petri Törönen Vanha materiaali: Päivi Onkamo,

Lisätiedot

Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus

Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus Katri Kärkkäinen Matti Haapanen Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus Katri Kärkkäinen ja Matti Haapanen Metsäntutkimuslaitos Vantaan tutkimuskeskus

Lisätiedot

Königsbergin sillat. Königsberg 1700-luvulla. Leonhard Euler ( )

Königsbergin sillat. Königsberg 1700-luvulla. Leonhard Euler ( ) Königsbergin sillat 1700-luvun Königsbergin (nykyisen Kaliningradin) läpi virtasi joki, jonka ylitti seitsemän siltaa. Sanotaan, että kaupungin asukkaat yrittivät löytää reittiä, joka lähtisi heidän kotoaan,

Lisätiedot

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli

Lisätiedot

Algoritmit 1. Luento 1 Ti Timo Männikkö

Algoritmit 1. Luento 1 Ti Timo Männikkö Algoritmit 1 Luento 1 Ti 10.1.2017 Timo Männikkö Luento 1 Algoritmi Algoritmin toteutus Ongelman ratkaiseminen Algoritmin tehokkuus Algoritmin suoritusaika Algoritmin analysointi Algoritmit 1 Kevät 2017

Lisätiedot

Opetusmateriaali. Fermat'n periaatteen esittely

Opetusmateriaali. Fermat'n periaatteen esittely Opetusmateriaali Fermat'n periaatteen esittely Hengenpelastajan tehtävässä kuvataan miten hengenpelastaja yrittää hakea nopeinta reittiä vedessä apua tarvitsevan ihmisen luo - olettaen, että hengenpelastaja

Lisätiedot

VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen

Lisätiedot

Darwin: Tutkimusprojektin esittely

Darwin: Tutkimusprojektin esittely 1 Darwin: Tutkimusprojektin esittely Tutkimusongelma: voidaanko ohjelmistoarkkitehtuuri generoida automaattisesti? Suomen Akatemian rahoittama tutkimusprojekti 2009-2011 TTY & TaY yhteistyö Ks. http://practise.cs.tut.fi/project.php?project=darwin

Lisätiedot

Proteiinien kontaktiresidyjen ennustaminen. Tuomo Hartonen Teoreettisen fysiikan syventävien opintojen seminaari

Proteiinien kontaktiresidyjen ennustaminen. Tuomo Hartonen Teoreettisen fysiikan syventävien opintojen seminaari Proteiinien kontaktiresidyjen ennustaminen Tuomo Hartonen Teoreettisen fysiikan syventävien opintojen seminaari 13.12.12 Terminologiaa Aminohappo = proteiinien rakennuspalikka, luonto käyttää 20 erilaista

Lisätiedot

FM-opiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo)

FM-opiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo) FMopiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo) 1. PERINNÖLLISYYSTIETEEN SYVENTÄVÄT OPINNOT (527050), 94 op 1.1. Pakolliset

Lisätiedot

verkkojen G ja H välinen isomorfismi. Nyt kuvaus f on bijektio, joka säilyttää kyseisissä verkoissa esiintyvät särmät, joten pari

verkkojen G ja H välinen isomorfismi. Nyt kuvaus f on bijektio, joka säilyttää kyseisissä verkoissa esiintyvät särmät, joten pari Tehtävä 9 : 1 Merkitään kirjaimella G tehtäväpaperin kuvan vasemmanpuoleista verkkoa sekä kirjaimella H tehtäväpaperin kuvan oikeanpuoleista verkkoa. Kuvan perusteella voidaan havaita, että verkko G on

Lisätiedot

Tehtäväsarja I Seuraavat tehtävät liittyvät kurssimateriaalin lukuun 7 eli vapauden käsitteeseen ja homogeenisiin

Tehtäväsarja I Seuraavat tehtävät liittyvät kurssimateriaalin lukuun 7 eli vapauden käsitteeseen ja homogeenisiin HY / Avoin yliopisto Lineaarialgebra ja matriisilaskenta I, kesä 2015 Harjoitus 4 Ratkaisut palautettava viimeistään maanantaina 862015 klo 1615 Tehtäväsarja I Seuraavat tehtävät liittyvät kurssimateriaalin

Lisätiedot

Bayesilainen päätöksenteko / Bayesian decision theory

Bayesilainen päätöksenteko / Bayesian decision theory Bayesilainen päätöksenteko / Bayesian decision theory Todennäköisyysteoria voidaan perustella ilman päätösteoriaa, mutta vasta päätösteorian avulla siitä on oikeasti hyötyä Todennäköisyyteoriassa tavoitteena

Lisätiedot

Evoluutiovoimat. Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa?

Evoluutiovoimat. Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa? Evoluutiovoimat Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa? -sattuman sysäily: populaatiokoon vaikutus -valinta: positiivinen, tasapainottava ja negatiivinen -mutaatiot: neutraalien,

Lisätiedot

Luku 8. Aluekyselyt. 8.1 Summataulukko

Luku 8. Aluekyselyt. 8.1 Summataulukko Luku 8 Aluekyselyt Aluekysely on tiettyä taulukon väliä koskeva kysely. Tyypillisiä aluekyselyitä ovat, mikä on taulukon välin lukujen summa tai pienin luku välillä. Esimerkiksi seuraavassa taulukossa

Lisätiedot

MS-A0502 Todennäköisyyslaskennan ja tilastotieteen peruskurssi

MS-A0502 Todennäköisyyslaskennan ja tilastotieteen peruskurssi MS-A0502 Todennäköisyyslaskennan ja tilastotieteen peruskurssi 4A Parametrien estimointi Lasse Leskelä Matematiikan ja systeemianalyysin laitos Perustieteiden korkeakoulu Aalto-yliopisto Syksy 2016, periodi

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset EU:ssa ei ole yleisesti hyväksyttyä elintarvikepetosten määritelmää. Yleinen ohjeistus löytyy elintarvikelainsäädäntöä

Lisätiedot

Radiologisten tutkimusten ja toimenpiteiden lukumäärien keskitetty kerääminen nykymalli ja toiveet tulevasta

Radiologisten tutkimusten ja toimenpiteiden lukumäärien keskitetty kerääminen nykymalli ja toiveet tulevasta Radiologisten tutkimusten ja toimenpiteiden lukumäärien keskitetty kerääminen nykymalli ja toiveet tulevasta Terveydenhuollon röntgentoiminnan asiantuntijoiden neuvottelupäivät 13.-14.4.2015, Siikaranta,

Lisätiedot

Tähtitieteen käytännön menetelmiä Kevät 2009

Tähtitieteen käytännön menetelmiä Kevät 2009 Tähtitieteen käytännön menetelmiä Kevät 2009 2009-01-12 Yleistä Luennot Luennoija hannu.p.parviainen@helsinki.fi Aikataulu Observatoriolla Maanantaisin 10.00-12.00 Ohjattua harjoittelua maanantaisin 9.00-10.00

Lisätiedot

MAT Todennäköisyyslaskenta Tentti / Kimmo Vattulainen

MAT Todennäköisyyslaskenta Tentti / Kimmo Vattulainen MAT-200 Todennäköisyyslaskenta Tentti 29.04.20 / Kimmo Vattulainen Funktiolaskin sallittu.. a) Pelaajat A ja B heittävät noppaa vuorotellen ja pelin voittaa se, joka saa ensimmäiseksi kuutosen. A aloittaa

Lisätiedot

Paikannuksen matematiikka MAT

Paikannuksen matematiikka MAT TA M P E R E U N I V E R S I T Y O F T E C H N O L O G Y M a t h e m a t i c s Paikannuksen matematiikka MAT-45800 4..008. p.1/4 Käytännön järjestelyt Kotisivu: http://math.tut.fi/courses/mat-45800/ Luennot:

Lisätiedot

4. Funktion arvioimisesta eli approksimoimisesta

4. Funktion arvioimisesta eli approksimoimisesta 4. Funktion arvioimisesta eli approksimoimisesta Vaikka nykyaikaiset laskimet osaavatkin melkein kaiken muun välttämättömän paitsi kahvinkeiton, niin joskus, milloin mistäkin syystä, löytää itsensä tilanteessa,

Lisätiedot

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio

Lisätiedot

T Luonnollisten kielten tilastollinen käsittely Vastaukset 11, ke , 12:15 14:00 Puheentunnistus ja kielimallien evaluointi Versio 1.

T Luonnollisten kielten tilastollinen käsittely Vastaukset 11, ke , 12:15 14:00 Puheentunnistus ja kielimallien evaluointi Versio 1. T-61.020 Luonnollisten kielten tilastollinen käsittely Vastaukset 11, ke 18.4.2007, 12:1 14:00 Puheentunnistus ja kielimallien evaluointi Versio 1.0 1. Käytämme siis jälleen viterbi-algoritmia todennäköisimmän

Lisätiedot

Neuroverkkojen soveltaminen vakuutusdatojen luokitteluun

Neuroverkkojen soveltaminen vakuutusdatojen luokitteluun Neuroverkkojen soveltaminen vakuutusdatojen luokitteluun Sami Hokuni 12 Syyskuuta, 2012 1/ 54 Sami Hokuni Neuroverkkojen soveltaminen vakuutusdatojen luokitteluun Turun Yliopisto. Gradu tehty 2012 kevään

Lisätiedot

Uolevin reitti. Kuvaus. Syöte (stdin) Tuloste (stdout) Esimerkki 1. Esimerkki 2

Uolevin reitti. Kuvaus. Syöte (stdin) Tuloste (stdout) Esimerkki 1. Esimerkki 2 Uolevin reitti Kuvaus Uolevi on ruudukon vasemmassa ylänurkassa ja haluaisi päästä oikeaan alanurkkaan. Uolevi voi liikkua joka askeleella ruudun verran vasemmalle, oikealle, ylöspäin tai alaspäin. Lisäksi

Lisätiedot

KJR-C2002 Kontinuumimekaniikan perusteet Kurssiesite

KJR-C2002 Kontinuumimekaniikan perusteet Kurssiesite KJR-C2002 Kontinuumimekaniikan perusteet Kurssiesite Menestyminen nykypäivän poikkitieteellisissä työtehtävissä vaatii vahvan ymmärryksen eri insinöörialojen perusteista. Mekaniikan perusteiden ymmärtäminen

Lisätiedot

806109P TILASTOTIETEEN PERUSMENETELMÄT I Hanna Heikkinen Esimerkkejä estimoinnista ja merkitsevyystestauksesta, syksy (1 α) = 99 1 α = 0.

806109P TILASTOTIETEEN PERUSMENETELMÄT I Hanna Heikkinen Esimerkkejä estimoinnista ja merkitsevyystestauksesta, syksy (1 α) = 99 1 α = 0. 806109P TILASTOTIETEEN PERUSMENETELMÄT I Hanna Heikkinen Esimerkkejä estimoinnista ja merkitsevyystestauksesta, syksy 2012 1. Olkoon (X 1,X 2,...,X 25 ) satunnaisotos normaalijakaumasta N(µ,3 2 ) eli µ

Lisätiedot

Matematiikan tukikurssi, kurssikerta 3

Matematiikan tukikurssi, kurssikerta 3 Matematiikan tukikurssi, kurssikerta 3 1 Epäyhtälöitä Aivan aluksi lienee syytä esittää luvun itseisarvon määritelmä: { x kun x 0 x = x kun x < 0 Siispä esimerkiksi 10 = 10 ja 10 = 10. Seuraavaksi listaus

Lisätiedot

2. Jatkoa HT 4.5:teen ja edelliseen tehtavään: Määrää X:n kertymäfunktio F (x) ja laske sen avulla todennäköisyydet

2. Jatkoa HT 4.5:teen ja edelliseen tehtavään: Määrää X:n kertymäfunktio F (x) ja laske sen avulla todennäköisyydet Tilastotieteen jatkokurssi Sosiaalitieteiden laitos Harjoitus 5 (viikko 9) Ratkaisuehdotuksia (Laura Tuohilampi). Jatkoa HT 4.5:teen. Määrää E(X) ja D (X). E(X) = 5X p i x i =0.8 0+0.39 +0.4 +0.4 3+0.04

Lisätiedot

KOE-ELÄINTEN ASIALLA

KOE-ELÄINTEN ASIALLA KOE-ELÄINTEN ASIALLA Eläinkokeet ovat arkipäivää Maailmassa käytetään vuosittain eläinkokeisiin yli sata miljoonaa eläintä, joista EU:n osuus on runsaat 10 miljoonaa koe-eläintä. Suomessa käytettyjen koe-eläinten

Lisätiedot

Kurssilla esitetään lyhyt katsaus niihin todennäköisyyden ja satunnaisprosessien peruskäsitteisiin ja -ominaisuuksiin, joita tarvitaan digitaalisten

Kurssilla esitetään lyhyt katsaus niihin todennäköisyyden ja satunnaisprosessien peruskäsitteisiin ja -ominaisuuksiin, joita tarvitaan digitaalisten Todennäköisyys Kurssilla esitetään lyhyt katsaus niihin todennäköisyyden ja satunnaisprosessien peruskäsitteisiin ja -ominaisuuksiin, joita tarvitaan digitaalisten tietoliikennejärjestelmien ymmärtämisessä

Lisätiedot

Data Envelopment Analysis (DEA) - menetelmät + CCR-DEA-menetelmä

Data Envelopment Analysis (DEA) - menetelmät + CCR-DEA-menetelmä Data Envelopment Analysis (DEA) - menetelmät + CCR-DEA-menetelmä Mat-2.4142 Optimointiopin seminaari kevät 2011 Esityksen rakenne I osa Tehokkuudesta yleisesti DEA-mallin perusajatus CCR-painotus II osa

Lisätiedot

Johdatus diskreettiin matematiikkaan Harjoitus 5, Ratkaise rekursioyhtälö

Johdatus diskreettiin matematiikkaan Harjoitus 5, Ratkaise rekursioyhtälö Johdatus diskreettiin matematiikkaan Harjoitus 5, 14.10.2015 1. Ratkaise rekursioyhtälö x n+4 2x n+2 + x n 16( 1) n, n N, alkuarvoilla x 1 2, x 2 14, x 3 18 ja x 4 42. Ratkaisu. Vastaavan homogeenisen

Lisätiedot

Harjoitus 7: NCSS - Tilastollinen analyysi

Harjoitus 7: NCSS - Tilastollinen analyysi Harjoitus 7: NCSS - Tilastollinen analyysi Mat-2.2107 Sovelletun matematiikan tietokonetyöt Syksy 2006 Mat-2.2107 Sovelletun matematiikan tietokonetyöt 1 Harjoituksen aiheita Tilastollinen testaus Testaukseen

Lisätiedot

TIEDONHAKU INTERNETISTÄ

TIEDONHAKU INTERNETISTÄ TIEDONHAKU INTERNETISTÄ Internetistä löytyy hyvin paljon tietoa. Tietoa ei ole mitenkään järjestetty, joten tiedonhaku voi olla hankalaa. Tieto myös muuttuu jatkuvasti. Tänään tehty tiedonhaku ei anna

Lisätiedot

Tiedonlouhinta rakenteisista dokumenteista (seminaarityö)

Tiedonlouhinta rakenteisista dokumenteista (seminaarityö) Tiedonlouhinta rakenteisista dokumenteista (seminaarityö) Miika Nurminen (minurmin@jyu.fi) Jyväskylän yliopisto Tietotekniikan laitos Kalvot ja seminaarityö verkossa: http://users.jyu.fi/~minurmin/gradusem/

Lisätiedot

Olkoon seuraavaksi G 2 sellainen tasan n solmua sisältävä suunnattu verkko,

Olkoon seuraavaksi G 2 sellainen tasan n solmua sisältävä suunnattu verkko, Tehtävä 1 : 1 a) Olkoon G heikosti yhtenäinen suunnattu verkko, jossa on yhteensä n solmua. Määritelmän nojalla verkko G S on yhtenäinen, jolloin verkoksi T voidaan valita jokin verkon G S virittävä alipuu.

Lisätiedot

MTTTP1 Tilastotieteen johdantokurssi Luento JOHDANTO

MTTTP1 Tilastotieteen johdantokurssi Luento JOHDANTO 8.9.2016/1 MTTTP1 Tilastotieteen johdantokurssi Luento 8.9.2016 1 JOHDANTO Tilastotiede menetelmätiede, joka käsittelee - tietojen hankinnan suunnittelua otantamenetelmät, koejärjestelyt, kyselylomakkeet

Lisätiedot

MS-C2103 Koesuunnittelu ja tilastolliset mallit (5 op)

MS-C2103 Koesuunnittelu ja tilastolliset mallit (5 op) MS-C2103 Koesuunnittelu ja tilastolliset mallit (5 op) Aalto-yliopisto 2016 Käytannön järjestelyt Luennot: Luennot ma 4.1. (sali E) ja ti 5.1 klo 10-12 (sali C) Luennot 11.1.-10.2. ke 10-12 ja ma 10-12

Lisätiedot

Matematiikan tukikurssi

Matematiikan tukikurssi Matematiikan tukikurssi Kurssikerta 8 1 Suunnattu derivaatta Aluksi tarkastelemme vektoreita, koska ymmärrys vektoreista helpottaa alla olevien asioiden omaksumista. Kun liikutaan tasossa eli avaruudessa

Lisätiedot

MS-A010{3,4} (ELEC*) Differentiaali- ja integraalilaskenta 1 Luento 10: Ensimmäisen kertaluvun differentiaaliyhtälö

MS-A010{3,4} (ELEC*) Differentiaali- ja integraalilaskenta 1 Luento 10: Ensimmäisen kertaluvun differentiaaliyhtälö MS-A010{3,4} (ELEC*) Differentiaali- ja integraalilaskenta 1 Luento 10: Ensimmäisen kertaluvun differentiaaliyhtälö Pekka Alestalo, Jarmo Malinen Aalto-yliopisto, Matematiikan ja systeemianalyysin laitos

Lisätiedot

Esimerkkejä vaativuusluokista

Esimerkkejä vaativuusluokista Esimerkkejä vaativuusluokista Seuraaville kalvoille on poimittu joitain esimerkkejä havainnollistamaan algoritmien aikavaativuusluokkia. Esimerkit on valittu melko mielivaltaisesti laitoksella tehtävään

Lisätiedot

Radiologisen fysiikan ja säteilysuojelun kurssi radiologiaan erikoistuville lääkäreille 23.8. - 26.8.2016. Ohjelma

Radiologisen fysiikan ja säteilysuojelun kurssi radiologiaan erikoistuville lääkäreille 23.8. - 26.8.2016. Ohjelma Radiologisen fysiikan ja säteilysuojelun kurssi radiologiaan erikoistuville lääkäreille 23.8. - 26.8.2016 Ohjelma Paikka: Kuopion Yliopistollinen Sairaala, Auditorio I Luennoitsija Ti 23.8.16 8.30 9.00

Lisätiedot

Satunnaisalgoritmit. Topi Paavilainen. Laskennan teorian opintopiiri HELSINGIN YLIOPISTO Tietojenkäsittelytieteen laitos

Satunnaisalgoritmit. Topi Paavilainen. Laskennan teorian opintopiiri HELSINGIN YLIOPISTO Tietojenkäsittelytieteen laitos Satunnaisalgoritmit Topi Paavilainen Laskennan teorian opintopiiri HELSINGIN YLIOPISTO Tietojenkäsittelytieteen laitos Helsinki, 23. helmikuuta 2014 1 Johdanto Satunnaisalgoritmit ovat algoritmeja, joiden

Lisätiedot

Osallistujien aktiivisuus on esitetty aikasarjana kuvassa 1 ja vuokaaviona kuvassa 2.

Osallistujien aktiivisuus on esitetty aikasarjana kuvassa 1 ja vuokaaviona kuvassa 2. 25.1.216 TP ENY-C21 Termodynamiikka ja lämmönsiirto Yhteenveto / Syksy 215 Kohdassa 1 esitellään tilastojen ja kaavioiden avulla opiskelijoiden saavuttamia tuloksia sekä opiskelijoiden osallistumisaktiivisuutta

Lisätiedot

Esimerkkejä polynomisista ja ei-polynomisista ongelmista

Esimerkkejä polynomisista ja ei-polynomisista ongelmista Esimerkkejä polynomisista ja ei-polynomisista ongelmista Ennen yleisempiä teoriatarkasteluja katsotaan joitain tyypillisiä esimerkkejä ongelmista ja niiden vaativuudesta kaikki nämä ongelmat ratkeavia

Lisätiedot

Martingaalit ja informaatioprosessit

Martingaalit ja informaatioprosessit 4A Martingaalit ja informaatioprosessit Tämän harjoituksen tavoitteena on tutustua satunnaisvektorin informaation suhteen lasketun ehdollisen odotusarvon käsitteeseen sekä oppia tunnistamaan, milloin annettu

Lisätiedot

Kahden laboratorion mittaustulosten vertailu

Kahden laboratorion mittaustulosten vertailu TUTKIMUSSELOSTUS NRO RTE9 (8) LIITE Kahden laboratorion mittaustulosten vertailu Sisältö Sisältö... Johdanto... Tulokset.... Lämpökynttilät..... Tuote A..... Tuote B..... Päätelmiä.... Ulkotulet.... Hautalyhdyt,

Lisätiedot

Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira

Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa Annikki Welling Kemian laboratoriopalvelut Evira Sisältö Elintarvikepetokset Menetelmiä elintarvikepetosten tunnistamiseksi DNA menetelmät DNA viivakoodaus

Lisätiedot

Numeeriset menetelmät TIEA381. Luento 8. Kirsi Valjus. Jyväskylän yliopisto. Luento 8 () Numeeriset menetelmät / 35

Numeeriset menetelmät TIEA381. Luento 8. Kirsi Valjus. Jyväskylän yliopisto. Luento 8 () Numeeriset menetelmät / 35 Numeeriset menetelmät TIEA381 Luento 8 Kirsi Valjus Jyväskylän yliopisto Luento 8 () Numeeriset menetelmät 11.4.2013 1 / 35 Luennon 8 sisältö Interpolointi ja approksimointi Funktion approksimointi Tasainen

Lisätiedot

Tilastollisen analyysin perusteet Luento 11: Epäparametrinen vastine ANOVAlle

Tilastollisen analyysin perusteet Luento 11: Epäparametrinen vastine ANOVAlle Tilastollisen analyysin perusteet Luento 11: Epäparametrinen vastine ANOVAlle - Sisältö - - - Varianssianalyysi Varianssianalyysissä (ANOVA) testataan oletusta normaalijakautuneiden otosten odotusarvojen

Lisätiedot

Algoritmit 1. Luento 2 Ke Timo Männikkö

Algoritmit 1. Luento 2 Ke Timo Männikkö Algoritmit 1 Luento 2 Ke 11.1.2017 Timo Männikkö Luento 2 Algoritmin esitys Algoritmien analysointi Suoritusaika Asymptoottinen kertaluokka Peruskertaluokkia NP-täydelliset ongelmat Algoritmit 1 Kevät

Lisätiedot

Symbioosi 2 VASTAUKSET. b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl

Symbioosi 2 VASTAUKSET. b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl Luku 14 Symbioosi 2 VASTAUKSET 1. Banaanikärpänen dihybridiristeytys a. Mikä on vanhempien genotyyppi? Vastaus: VvLl b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl c.

Lisätiedot

Algoritmit 1. Luento 7 Ti Timo Männikkö

Algoritmit 1. Luento 7 Ti Timo Männikkö Algoritmit 1 Luento 7 Ti 31.1.2017 Timo Männikkö Luento 7 Järjestetty binääripuu Binääripuiden termejä Binääripuiden operaatiot Solmun haku, lisäys, poisto Algoritmit 1 Kevät 2017 Luento 7 Ti 31.1.2017

Lisätiedot

Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere

Perinnöllisyys harvinaisten lihastautien aiheuttajana. Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere Perinnöllisyys harvinaisten lihastautien aiheuttajana Helena Kääriäinen Terveyden ja hyvinvoinnin laitos Tampere 17.11.2011 Mistä lihastauti aiheutuu? Suurin osa on perinnöllisiä Osassa perimä altistaa

Lisätiedot

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma Evoluutio BI Elämä ja evoluutio Leena Kangas-Järviluoma 1 Evoluutio lajinkehitystä, jossa eliölajit muuttuvat ja niistä voi kehittyä uusia lajeja on jatkunut elämän synnystä saakka, sillä ei ole päämäärää

Lisätiedot

Mat Sovellettu todennäköisyyslasku. Aiheet: Todennäköisyyslaskennan peruskäsitteet Todennäköisyyslaskennan peruslaskusäännöt Avainsanat:

Mat Sovellettu todennäköisyyslasku. Aiheet: Todennäköisyyslaskennan peruskäsitteet Todennäköisyyslaskennan peruslaskusäännöt Avainsanat: Mat-2.091 Sovellettu todennäköisyyslasku Aiheet: Todennäköisyyslaskennan peruskäsitteet Todennäköisyyslaskennan peruslaskusäännöt Avainsanat: Alkeistapahtuma, Ehdollinen todennäköisyys, Erotustapahtuma,

Lisätiedot

Algoritmit 1. Luento 9 Ti Timo Männikkö

Algoritmit 1. Luento 9 Ti Timo Männikkö Algoritmit 1 Luento 9 Ti 7.2.2017 Timo Männikkö Luento 9 Graafit ja verkot Kaaritaulukko, bittimatriisi, pituusmatriisi Verkon lyhimmät polut Floydin menetelmä Lähtevien ja tulevien kaarien listat Forward

Lisätiedot

ALGORITMIT & OPPIMINEN

ALGORITMIT & OPPIMINEN ALGORITMIT & OPPIMINEN Mitä voidaan automatisoida? Mikko Koivisto Avoimet aineistot tulevat Tekijä: Lauri Vanhala yhdistä, kuvita, selitä, ennusta! Tekijä: Logica Mitä voidaan automatisoida? Algoritmi

Lisätiedot

13.11. Tulosten arviointi. tulosten arviointi. voimmeko luottaa saamiimme tuloksiin?

13.11. Tulosten arviointi. tulosten arviointi. voimmeko luottaa saamiimme tuloksiin? 13.11. tulosten arviointi Tulosten arviointi voimmeko luottaa saamiimme tuloksiin? onko osa saaduista tuloksista sattumanvaraisia? mitkä OSAT puusta ovat luotettavimpia? 1 KONSENSUSDIAGRAMMI Useita yhtä

Lisätiedot

Aineistokoko ja voima-analyysi

Aineistokoko ja voima-analyysi TUTKIMUSOPAS Aineistokoko ja voima-analyysi Johdanto Aineisto- eli otoskoon arviointi ja tutkimuksen voima-analyysi ovat tilastollisen tutkimuksen suunnittelussa keskeisimpiä asioita. Otoskoon arvioinnilla

Lisätiedot

MAY1 Tehtävien ratkaisut Kustannusosakeyhtiö Otava päivitetty 12.4.2016 Julkaiseminen sallittu vain koulun suljetussa verkossa.

MAY1 Tehtävien ratkaisut Kustannusosakeyhtiö Otava päivitetty 12.4.2016 Julkaiseminen sallittu vain koulun suljetussa verkossa. KERTAUS Lukujono KERTAUSTEHTÄVIÄ K1. Ratkaisussa annetaan esimerkit mahdollisista säännöistä. a) Jatketaan lukujonoa: 2, 4, 6, 8, 10, 12, 14, 16, Rekursiivinen sääntö on, että lukujonon ensimmäinen jäsen

Lisätiedot

TIES592 Monitavoiteoptimointi ja teollisten prosessien hallinta. Yliassistentti Jussi Hakanen syksy 2010

TIES592 Monitavoiteoptimointi ja teollisten prosessien hallinta. Yliassistentti Jussi Hakanen syksy 2010 TIES592 Monitavoiteoptimointi ja teollisten prosessien hallinta Yliassistentti Jussi Hakanen jussi.hakanen@jyu.fi syksy 2010 Evoluutiopohjainen monitavoiteoptimointi MCDM ja EMO Monitavoiteoptimointi kuuluu

Lisätiedot

FYSA210/2 PYÖRIVÄ KOORDINAATISTO

FYSA210/2 PYÖRIVÄ KOORDINAATISTO FYSA210/2 PYÖRIVÄ KOORDINAATISTO Johdanto Inertiaalikoordinaatisto on koordinaatisto, jossa Newtonin mekaniikan lait pätevät. Tällaista koordinaatistoa ei reaalimaailmassa kuitenkaan ole. Epäinertiaalikoordinaatisto

Lisätiedot

Poimi yrityksistä i) neljän, ii) kymmenen suuruinen otos. a) yksinkertaisella satunnaisotannalla palauttaen, b) systemaattisella otannalla

Poimi yrityksistä i) neljän, ii) kymmenen suuruinen otos. a) yksinkertaisella satunnaisotannalla palauttaen, b) systemaattisella otannalla 806109P TILASTOTIETEEN PERUSMENETELMÄT I Hanna Heikkinen Harjoitus 2, viikko 38, syksy 2012 1. Tutustu liitteen 1 kuvaukseen Suuresta bränditutkimuksesta v. 2009. Mikä tämän kuvauksen perusteella on ko.

Lisätiedot

Lataa strategiset työkalut

Lataa strategiset työkalut Lataa strategiset työkalut Joiden avulla saavutat taloudellisen riippumattomuuden. Mitä sinä tekisit, jos pystyisit rakentamaan jopa 4.000,00 kuukaudessa tuottavan tulovirran? Entä miten pitkään olet valmis

Lisätiedot

T Syksy 2004 Logiikka tietotekniikassa: perusteet Laskuharjoitus 7 (opetusmoniste, kappaleet )

T Syksy 2004 Logiikka tietotekniikassa: perusteet Laskuharjoitus 7 (opetusmoniste, kappaleet ) T-79144 Syksy 2004 Logiikka tietotekniikassa: perusteet Laskuharjoitus 7 (opetusmoniste, kappaleet 11-22) 26 29102004 1 Ilmaise seuraavat lauseet predikaattilogiikalla: a) Jokin porteista on viallinen

Lisätiedot

Matematiikan tukikurssi

Matematiikan tukikurssi Matematiikan tukikurssi Kurssikerta 4 Jatkuvuus Jatkuvan funktion määritelmä Tarkastellaan funktiota f x) jossakin tietyssä pisteessä x 0. Tämä funktio on tässä pisteessä joko jatkuva tai epäjatkuva. Jatkuvuuden

Lisätiedot

H Prosessi- ja kokonaisarkkitehtuurityökalu palveluna Liite 17 Käytettävyyden arviointi

H Prosessi- ja kokonaisarkkitehtuurityökalu palveluna Liite 17 Käytettävyyden arviointi H087-12 Prosessi- ja kokonaisarkkitehtuurityökalu palveluna Liite 17 Käytettävyyden arviointi Tämän dokumentin tarkoituksena on määrittää kilpailutukseen H087-12 liittyvää käytettävyyden arviointia Tässä

Lisätiedot

Laboratorioanalyysit, vertailunäytteet ja tilastolliset menetelmät

Laboratorioanalyysit, vertailunäytteet ja tilastolliset menetelmät Jarmo Koskiniemi Maataloustieteiden laitos Helsingin yliopisto 0504151624 jarmo.koskiniemi@helsinki.fi 03.12.2015 Kolkunjoen taimenten geneettinen analyysi Näytteet Mika Oraluoma (Vesi-Visio osk) toimitti

Lisätiedot

Matematiikan tukikurssi

Matematiikan tukikurssi Matematiikan tukikurssi Kurssikerta 8 Väliarvolause Oletetaan, että funktio f on jatkuva jollain reaalilukuvälillä [a, b] ja derivoituva avoimella välillä (a, b). Funktion muutos tällä välillä on luonnollisesti

Lisätiedot

MS-A0004/A0006 Matriisilaskenta

MS-A0004/A0006 Matriisilaskenta 4. MS-A4/A6 Matriisilaskenta 4. Nuutti Hyvönen, c Riikka Kangaslampi Matematiikan ja systeemianalyysin laitos Aalto-yliopisto..25 Tarkastellaan neliömatriiseja. Kun matriisilla kerrotaan vektoria, vektorin

Lisätiedot

+ 3 2 5 } {{ } + 2 2 2 5 2. 2 kertaa jotain

+ 3 2 5 } {{ } + 2 2 2 5 2. 2 kertaa jotain Jaollisuustestejä (matematiikan mestariluokka, 7.11.2009, ohjattujen harjoitusten lopputuloslappu) Huom! Nämä eivät tietenkään ole ainoita jaollisuussääntöjä; ovatpahan vain hyödyllisiä ja ainakin osittain

Lisätiedot

Inversio-ongelmien laskennallinen peruskurssi Luento 2

Inversio-ongelmien laskennallinen peruskurssi Luento 2 Inversio-ongelmien laskennallinen peruskurssi Luento 2 Kevät 2012 1 Lineaarinen inversio-ongelma Määritelmä 1.1. Yleinen (reaaliarvoinen) lineaarinen inversio-ongelma voidaan esittää muodossa m = Ax +

Lisätiedot

E. Oja ja H. Mannila Datasta Tietoon: Luku 2

E. Oja ja H. Mannila Datasta Tietoon: Luku 2 2. DATASTA TIETOON: MITÄ DATAA; MITÄ TIETOA? 2.1. Data-analyysin ongelma Tulevien vuosien valtava haaste on digitaalisessa muodossa talletetun datan kasvava määrä Arvioita: Yhdysvaltojen kongressin kirjasto

Lisätiedot

Materiaalia, ohjeita, videoita sekä lisätietoja opettajille tarjottavasta koulutuksesta osoitteessa:

Materiaalia, ohjeita, videoita sekä lisätietoja opettajille tarjottavasta koulutuksesta osoitteessa: Kevään Lyhyen matematiikan YO-kokeen TI-Nspire CAS -ratkaisut Nämä ratkaisut tehty alusta loppuun TI-Nspire CX CAS -ohjelmistolla ja tallennettu lopuksi PDF -muotoon. Tarkoituksena on havainnollistaa,

Lisätiedot

Algebralliset tietotyypit ym. TIEA341 Funktio ohjelmointi 1 Syksy 2005

Algebralliset tietotyypit ym. TIEA341 Funktio ohjelmointi 1 Syksy 2005 Algebralliset tietotyypit ym. TIEA341 Funktio ohjelmointi 1 Syksy 2005 Tällä luennolla Algebralliset tietotyypit Hahmonsovitus (pattern matching) Primitiivirekursio Esimerkkinä binäärinen hakupuu Muistattehan...

Lisätiedot

Geenikartoitusmenetelmät. Kytkentäanalyysin teoriaa. Suurimman uskottavuuden menetelmä ML (maximum likelihood) Uskottavuusfunktio: koko aineisto

Geenikartoitusmenetelmät. Kytkentäanalyysin teoriaa. Suurimman uskottavuuden menetelmä ML (maximum likelihood) Uskottavuusfunktio: koko aineisto Kytkentäanalyysin teoriaa Pyritään selvittämään tiettyyn ominaisuuteen vaikuttavien eenien paikka enomissa Perustavoite: löytää markkerilokus jonka alleelit ja tutkittava ominaisuus (esim. sairaus) periytyvät

Lisätiedot

Mitä on konvoluutio? Tutustu kuvankäsittelyyn

Mitä on konvoluutio? Tutustu kuvankäsittelyyn Mitä on konvoluutio? Tutustu kuvankäsittelyyn Tieteenpäivät 2015, Työohje Sami Varjo Johdanto Digitaalinen signaalienkäsittely on tullut osaksi arkipäiväämme niin, ettemme yleensä edes huomaa sen olemassa

Lisätiedot

13. Ratkaisu. Kirjoitetaan tehtävän DY hieman eri muodossa: = 1 + y x + ( y ) 2 (y )

13. Ratkaisu. Kirjoitetaan tehtävän DY hieman eri muodossa: = 1 + y x + ( y ) 2 (y ) MATEMATIIKAN JA TILASTOTIETEEN LAITOS Differentiaaliyhtälöt, kesä 00 Tehtävät 3-8 / Ratkaisuehdotuksia (RT).6.00 3. Ratkaisu. Kirjoitetaan tehtävän DY hieman eri muodossa: y = + y + y = + y + ( y ) (y

Lisätiedot

Harjoitus Tarkastellaan luentojen Esimerkin mukaista työttömyysmallinnusta. Merkitään. p(t) = hintaindeksi, π(t) = odotettu inflaatio,

Harjoitus Tarkastellaan luentojen Esimerkin mukaista työttömyysmallinnusta. Merkitään. p(t) = hintaindeksi, π(t) = odotettu inflaatio, Differentiaaliyhtälöt, Kesä 06 Harjoitus 3 Kaikissa tehtävissä, joissa pitää tarkastella kriittisten pisteiden stabiliteettia, jos kyseessä on satulapiste, ilmoita myös satulauraratkaisun (tai kriittisessä

Lisätiedot

1. Otetaan perusjoukoksi X := {0, 1, 2, 3, 4, 5, 6, 7}. Piirrä seuraaville kolmelle joukolle Venn-diagrammi ja asettele alkiot siihen.

1. Otetaan perusjoukoksi X := {0, 1, 2, 3, 4, 5, 6, 7}. Piirrä seuraaville kolmelle joukolle Venn-diagrammi ja asettele alkiot siihen. Joukko-oppia Matematiikan mestariluokka, syksy 2010 Harjoitus 1, vastaukset 20.2.2010 1. Otetaan perusjoukoksi X := {0, 1, 2, 3, 4, 5, 6, 7}. Piirrä seuraaville kolmelle joukolle Venn-diagrammi asettele

Lisätiedot

Agility Games Gamblers

Agility Games Gamblers Agility Games Gamblers Games-lajeista ehkä hieman helpommin sisäistettävä on Gamblers, jota on helppo mennä kokeilemaan melkein ilman sääntöjä lukematta. Rata koostuu kahdesta osuudesta: 1. Alkuosa, jossa

Lisätiedot

Oliosuunnitteluesimerkki: Yrityksen palkanlaskentajärjestelmä

Oliosuunnitteluesimerkki: Yrityksen palkanlaskentajärjestelmä Oliosuunnitteluesimerkki: Yrityksen palkanlaskentajärjestelmä Matti Luukkainen 10.12.2009 Tässä esitetty esimerkki on mukaelma ja lyhennelmä Robert Martinin kirjasta Agile and Iterative Development löytyvästä

Lisätiedot

Matematiikka vuosiluokat 7 9

Matematiikka vuosiluokat 7 9 Matematiikka vuosiluokat 7 9 Matematiikan opetuksen ydintehtävänä on tarjota oppilaille mahdollisuus hankkia sellaiset matemaattiset taidot, jotka antavat valmiuksia selviytyä jokapäiväisissä toiminnoissa

Lisätiedot

Suomen huonosti tunnetut ja uhanalaiset sienet

Suomen huonosti tunnetut ja uhanalaiset sienet Suomen huonosti tunnetut ja uhanalaiset sienet Sienet Sienten lajimäärä on paljon aiemmin ajateltua suurempi Lajit tunnettava, jotta sienten todellisen monimuotoisuuden, uhanalaisuuden ja suojelutarpeiden

Lisätiedot

Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016

Lisätiedot

Harjoitus 6 ( )

Harjoitus 6 ( ) Harjoitus 6 (30.4.2014) Tehtävä 1 Määritelmän (ks. luentomoniste s. 109) mukaan yleisen, muotoa min f(x) s.t. g(x) 0 h(x) = 0 x X (1) olevan optimointitehtävän Lagrangen duaali on max θ(u,v) s.t. u 0,

Lisätiedot

031075P MATEMATIIKAN PERUSKURSSI II 5,0 op

031075P MATEMATIIKAN PERUSKURSSI II 5,0 op 031075P MATEMATIIKAN PERUSKURSSI II 5,0 op Kurssin jokaiseen kolmeen välikokeeseen on ilmoittauduttava erikseen WebOodissa (https://weboodi.oulu.fi/oodi/). Huom! Välikoeilmoittautuminen on PAKOLLINEN.

Lisätiedot

Skenaario 1: Paavo kokouksessa

Skenaario 1: Paavo kokouksessa Vaatimusmäärittely liite A: Skenaariot 1-6 Skenaario 1: kokouksessa Osapuolet Tero Eeva Siirrettävä data Paikkatieto Kalenterimerkinnät Käyttäjän tunnistus Oikeuksien luovutus Käyttäjäprofiilit Tilanne

Lisätiedot

TIIVISTELMÄ. Työstä eläkkeelle tulokehitys ja korvaussuhteet. Eläketurvakeskuksen raportteja 2010:3. Juha Rantala ja Ilpo Suoniemi

TIIVISTELMÄ. Työstä eläkkeelle tulokehitys ja korvaussuhteet. Eläketurvakeskuksen raportteja 2010:3. Juha Rantala ja Ilpo Suoniemi R RAPORTTEJA Eläketurvakeskuksen raportteja 2010:3 TIIVISTELMÄ Juha Rantala ja Ilpo Suoniemi Työstä eläkkeelle tulokehitys ja korvaussuhteet Tutkimuksessa arvioitiin, mitä muutoksia henkilön tuloissa ja

Lisätiedot

Matriisit ovat matlabin perustietotyyppejä. Yksinkertaisimmillaan voimme esitellä ja tallentaa 1x1 vektorin seuraavasti: >> a = 9.81 a = 9.

Matriisit ovat matlabin perustietotyyppejä. Yksinkertaisimmillaan voimme esitellä ja tallentaa 1x1 vektorin seuraavasti: >> a = 9.81 a = 9. Python linkit: Python tutoriaali: http://docs.python.org/2/tutorial/ Numpy&Scipy ohjeet: http://docs.scipy.org/doc/ Matlabin alkeet (Pääasiassa Deni Seitzin tekstiä) Matriisit ovat matlabin perustietotyyppejä.

Lisätiedot

Aukkoja sekvensseissä. Tuomo Hartonen Teoreettisen fysiikan syventävien opintojen seminaari

Aukkoja sekvensseissä. Tuomo Hartonen Teoreettisen fysiikan syventävien opintojen seminaari Aukkoja sekvensseissä Tuomo Hartonen Teoreettisen fysiikan syventävien opintojen seminaari 25.04.13 Terminologiaa Aminohappo = proteiinien rakennuspalikka, proteiinit rakentuvat 22:sta erilaisesta, 20

Lisätiedot