52739 Bioinformatiikan perusteet Kevät 2013

Koko: px
Aloita esitys sivulta:

Download "52739 Bioinformatiikan perusteet Kevät 2013"


1 52739 Bioinformatiikan perusteet Kevät 2013 Petri Törönen Materiaalia kommentoineet: Pekka Kohonen, Petri Auvinen, Liisa Holm Kiitokset

2 Päivi Onkamo äitiyslomalla Petri Törönen tuuraamassa petri DOT toronen AT helsinki DOT fi Biokeskus 2, D-porras, 7. krs Huone 7002

3 Bioinformatiikan perusteet, 3 op (52739) Luennot , ti, to klo , BIOK2 AUD1041. Kurssin kotisivut: Flammassa työn alla, alla, alla. WWW: Kuulustelu: klo , Infotalo, auditorio 2. Uusinnat: Ensimmäinen uusinta??? Kotitehtävät: tehtävänannot tulevat perjantaisin kurssin kotisivuille. Tarkastetaan yhteisesti seuraavan keskiviikon luennoilla. Omia vastauksia ei siis palauteta luennoijalle. Luennoitsijat: FT Petri Törönen, Dos. Rainer Lehtonen

4 Oheislukemistoa: CSC:n Sekvenssianalyysiopas (lataa pdf osoitteesta tai tilaa painettuna CSC:ltä hintaan 15 kpl) Bioinformatiikan perusteet (kirj. Tuimala J), ladattavissa pdf:nä tai tilattavissa (kuten edellä) Xiong: Essential Bioinformatics, 2006 (osin, tämä teos on myös yksi perimän cum laude -tenttikirjoista) Zvelebil & Baum: Understanding Bioinformatics, 2008 Pevsner: Bioinformatics and Functional Genomics, 2009.

5 WWW Google: bioinformatics tutorial OR guide. otutorials.aspx NIH:n kokoelma WWW-kursseista nal.pcbi Kokoelma WWW-kurseista. Kurssien plussat ja miinukset kuvattu! GOBLET-organisaation kokoelma WWW-oppaita EBI:in ohjelmien opetusta

6 Tiedoksi JOO-opiskelijoille Yliopiston verkkotunnuksista: JOO-opiskelijoille kuuluu HY:n mikroverkkotunnus. Sen saa Impact factorysta opintopalvelupisteestä. Ota mukaan JOO-hyväksymisilmoitus ja jos sieltä ei saa, tiedustele Heikki Tuuralalta: Heikki Tuurala suunnittelija Helsingin yliopisto Bio- ja ympäristötieteiden laitos Puh

7 Luentokurssin sisältö Johdanto bioinformatiikan tärkeimpiin menetelmiin Kurssilla käsitellään sekvenssianalyysiin liittyviä menetelmiä: kahden ja useamman sekvenssin rinnastuksen teoriaa (esim.dot-plot, progressiivinen rinnastus, ClustalX, Muscle), tietokantahakualgoritmeja (BLAST). Yleisimmin käytettyjä tietokantoja (NCBI, EMBL, Uniprot), fylogeneettistä analyysiä, geenikartoitusta, mikrosiru- ja promoottorianalyysejä, sekä hiukan farmakogenomiikkaa Kurssin suorittaminen: Hyväksytty tentti (vähintään 50% pisteistä ansaittu).

8 Tentti Aineistotenttinä: luentomateriaalin saa ottaa mukaan tenttiin. Tenttikysymykset laaditaan luennoilla läpikäytyjen asioiden pohjalta, ja ne ovat luonteeltaan soveltavia Tentti arvostellaan normaalisti asteikolla 1-5 (siis arvosanan 1/5 saavuttamiseksi vähintään 50% max-pisteistä täytyy olla ansaittuna).

9 Luentojen aiheet, aikataulu Johdanto, pisteytysmatriisit Kahden sekvenssin rinnastus BLAST Biotietokannat I Biotietokannat II Usean sekvenssin rinnastus 4.2. Molekyylisystematiikka I 6.2. Molekyylisystematiikka II Geeniekspressio: Mikrosirut Genomiikka Geenikartoitus I. Tutkimusprojektin esittely Geenikartoitus II. Farmakogenetiikka TENTTI

10 Mitä bioinformatiikka on?

11 Mitä bioinformatiikka on? Informaatiotieteen ja biologian välimaastoa Tieteenala, joka kehittää informaatio- ja tietoteknisiä välineitä biologisten ongelmien ratkaisemiseksi Informaatioteknologian ala, jota käytetään biologisen informaation tallentamiseen, ylläpitämiseen ja analysoimiseen Bioinformatiikka on osa laskennallista biologiaa Perustuu J.Tuimalan originaaleihin

12 Mitä bioinformatiikka on? Tieteellisiä kysymyksiä pyritään ratkaisemaan käymällä laajoja biologisia aineistoja läpi Aineisto voi olla tutkimusryhmän omaa tai se voi olla peräisin julkisista tietokannoista Aineistojen suuruuden takia tarvitaan tietojenkäsittelyn tarjoamia menetelmiä Analyysitehtävät voivat olla myös manuaalisesti vaikeita/mahdottomia ratkaista

13 Bioinformatiikan osuus kasvussa Tietokantojen koko on kasvanut räjähdysmäisesti High Throughput-menetelmät Käytettävissä oleva laskentateho (tietokoneiden tehokkuus) on kasvanut Uusien menetelmien kehittyminen bioinformatiikan, tilastotieteen ja tietojenkäsittelyn (koneoppimisen) saralla

14 Tietokantojen sisällön kasvu Tilastoja, European Nucleotide Archive (ENA) eli geenipankki : Eri lajien osuudet tietokannassa olevista nukleotideista 2010: Total nucleotides 2010: 301,119,983,275, of which Homo sapiens Mus musculus Rattus norvegicus Bos taurus marine metagenome Pan troglodytes Danio rerio Zea mays Canis lupus familiaris Sus scrofa Other

15 Tietokantojen sisällön kasvu Tietokannat kasvavat eksponentiaalisesti Moreover, the volume of data is increasing exponentially with a doubling time of approximately 10 months

16 Kokonaan sekvensoituja genomeja * Prokaryootteja Arkkeja Eukaryootteja joista sieniä 16, kasveja 7, eläimiä 6, ja alkueliöitä (protists) 10. Valmiina mm: hiiva, sukkulamadot (2 lajia), banaanikärpänen (2 lajia), ihminen, simpanssi, sika, hiiri, pallokala, riisi, lituruohovehnä, maissi, hamppu. Nearly-there : Eläimistä: jättiläispanda, koira, marsu, siili, kissa, opossumi, elefantti, 9-vyövyötiäinen, nauta, hevonen, vesipuhveli, mehiläinen, kimalainen, kana, seeprakala, malariahyttynen, jne. Kasveista: koivu, omena, ohra, soija, jättipoppeli, tomaatti, vehnä, papaija, durra, kookospalmu, mung-papu, papaija, aitoviini jne. seeprakala opossumi *http://www.ncbi.nlm.nih.gov/genomes/static/gpstat.html

17 Kokonaan sekvensoituja genomeja PAH!!! EDELLINEN KALVO VANHA Tämäkin lukumäärä kasvaa eksponentiaalisesti 2013: Arhaea: 181, Bacteria: 3762, Eukaryotes: 183 (*) 2014: Arhaea: 277, Bacteria: 11777, Eukaryotes: 312 (**) * **

18 Laboratoriomenetelmien mullistus Laboratorioanalyysi siirtynyt kokonaisten eliöiden kaikkien geenien samanaikaiseen tutkimiseen Mikrosiru-menetelmät High Throughput-menetelmät Uuden sukupolven sekvensointi Proteomics & metabolomics

19 Mikrosirumenetelmät Kehitetty tutkimaan ~ geenin aktiivisuutta biologisessa näytteessä Menetelmä kuvataan luennoilla myöhemmin Mahdollistaa kaikkien tunnettujen geenien samanaikaisen tutkimisen näytteestä Mikrosirut on suunniteltu eliökohtaisesti Eivät (tavallisesti) sovellu populaatioihin

20 Mikrosirumenetelmät Sovelluksia: Geenien aktiivisuus laboratoriotestin aikana Geenien aktiivisuuksien vertailu erilaisten genotyyppien välillä Geenien aktiivisuuksien vertailu terveen ja tautikudoksen välillä

21 High Throughput menetelmät Laboratoriotutkimusta rinnakkaistettuna Käytetään robotiikkaa ja testataan erilaisia olosuhteita / reagensseja Usein testataan esim. kaikkia tutkittavan eliön geenejä Koneellinen kuva-analyysi voi tallentaa esim. solujen morfologisia muutoksia käsittelyn jälkeen

22 High Throughput menetelmät Sovelluksia: Gene knockout / RNA-silencing studies High throughput drug screening Proteiinien sitoutuminen toisiinsa eliötasolla

23 Next Generation Sequencing Laitteita jotka sekvensoivat vahvasti rinnakkaisesti ( sekvenssijaksoa/analyysi) Jokainen jakso nukleotidia pitkä Tulos saadaan kun jaksot yhdistetään Sovelluksia: Genomin de novo-sekvensointi Genomin re-sekvensointi RNA-sekvensointi

24 Next Generation Sequencing Genomin de-novo-sekvensointi Luodaan tutkittavan eliön genomisekvenssi pelkästään sekvensointituloksien avulla Ei aikaisempaa genomisekvenssiä Genomin re-sekvensointi Tutkitaan esim. potilaita tai syöpäkudoksia Sekvensoidaan genomi ja haetaan (yhteisiä) eroja muuhun populaatioon

25 Next Generation Sequencing RNA-sekvensointi Mikrosirutekniikat selvittävät karkeasti RNA:n määrän Analyysistä uupuu Splice Variants, SNP, alleelispesifinen ekspressio RNA sekvensoinnissa sekvensoidaan lähes kaikki löydetyt RNA-sekvenssit Metagenomiikka Tutkitaan esim. mikrobipopulaatioita sekvensoimalla kaikki genominen DNA näytteestä

26 Suurien aineistojen yhdistely In-house gene expression data vs. gene expression data in web Gene expression data vs. protein-protein interaction data Large scale data comparisons across different species

27 Bioinformatiikan sovelluksia Taudinaiheuttajien tunnistus, mikrobidiagnostiikka Geneettinen neuvonta + Personalized Medicine Lääkeaineiden pää- ja sivuvaikutuksien vertailu Lääkeaineiden valinta (screening)..

28 Mitä tällä informaatiolla voi tehdä? Mihin bioinformatiikkaa tarvitsee? ESIM: Meksikossa puhkeaa vaarallinen virusepidemia Eristetään virus potilasnäytteistä ja sekvensoidaan sen perimä näyttää influenssavirukselta Etsitään viruksen sukulaisia - sekvenssirinnastus, fylogenia -> H1N1 Antaa tietoa siitä, mitä epidemialta voidaan odottaa, mitä muita taudinaiheuttajia ja tauteja se voisi muistuttaa? Miten virus on syntynyt? Epidemian seuranta Selvitetään viruksen tuottamat proteiinit - sekvenssirinnastus Miten virus pääsee soluun? Voitaisiinko sitä estää? Proteiinien rakenne Homologiamallinnus - miten tämä virus eroaa muista ja miksi se voi olla tappava? Lääkeainesuunnittelu? Mahdollisten rokotteeksi sopivien rakenteiden tunnistaminen Perustuu J.Tuimalan originaaleihin

29 Molekulaarinen fylogenetiikka Tutkija on hankkinut DNA-näytteitä joukosta hyljelajeja, ja sekvensoinut joitakin geenejä. Miten sekvenssijoukko on kehittynyt? Miten lajijoukko on kehittynyt? Millaisia yhteisiä piirteitä tiettyjen lajien genomeilla on? Perustuu J.Tuimalan originaaleihin

30 Hiivasoluille on annettu lämpöshokki käsittely. Mitkä geenit ekspressoituvat normaalitasoa voimakkaammin tai heikommin heti shokin jälkeen? Entä tunti, 2 tuntia sen jälkeen? Miten näiden geenien toiminta saattaisi liittyä toisiinsa (julkisissa tietokannoissa olevan tiedon perusteella - huomaa, että tämä on aivan liian laajaa käsin tutkittavaksi!) Geeniekspressioaineiston ryhmittelyanalyysi:

31 Lisää sovellusalueita Mitä samanlaisten geenisäätelytekijöiden sitoutumissekvenssejä keskenään samanaikaisesti ilmeneviltä geeneiltä löytyy? (Vaikkapa heat shockin jälkeen?)

32 Lisää sovellusalueita tai miten löytää DNA-sekvensseistä upouusia säätelytekijöitä, joista ei vielä edes tiedetä minkälaista sekvenssinpätkää ollaan etsimässä? Olet sekvensoinut DNA:ta tai jonkin proteiinin; sekvenssin tehtävä ei selviä itse sekvenssistä, se ei siis muistuta mitään ennestään tunnettua niin selvästi että erehtymisen vaaraa ei olisi. Mihin toisiin geeneihin/proteiineihin ja eliölajeihin sekvenssillä olisi vastaavuutta? Mitä nämä geenit/proteiinit tekevät? (Liikaa manuaalisesti tutkittavaksi!) Geenikartoituksen menetelmin on genomista löydetty tautigeenin todennäköisin sijaintialue, mutta tällä alueella on edelleen ainakin 30 eri geeniä, joista periaatteessa mikä tahansa voisi olla tautigeeni. Mitä nämä tunnetut geenit tekevät? Mikä tai mitkä niistä olisivat potentiaalisimpia tautiriskiin vaikuttavia geenejä?

33 Jokamiehen bioinformatiikkaa Sekvenssien rinnastus Sekvenssien haku tietokannasta sekvenssillä Sekvenssien haku avainsanojen avulla

34 Sekvenssien rinnastus Kahden sekvenssin rinnastus Kuinka samankaltaisia kaksi sekvenssiä ovat keskimäärin? Löytyykö sekvensseistä lyhyempiä samankaltaisia alueita, vaikka ne keskimäärin olisivat varsin erilaisia? Usean sekvenssin rinnastus Rinnastetaan monta sekvenssiä joilla sama funktio Löytyykö sekvensseistä yhteisiä, samankaltaisia alueita? Mahdollinen aktiivinen keskus Molekyylisystematiikka fylogenia

35 Sekvenssihaut Tietokantahaut Löytyykö sekvenssi tietokannasta asiasanahaulla? Esim. hemoglobin and human? Sekvenssihaut Mitä sekvenssejä tietokannasta löytyy, kun tiedossamme on ehkä vain pätkä sekvenssiä? ACGTACGTACGTCCCCAGTCTAGAG Perustuu J.Tuimalan originaaleihin

36 Muistakaa tämä Monet bioinformatiikan menetelmät tuottavat aina jotain tuloksia Tulokset täytyy varmistaa riippumattomalla menetelmällä Parhaassa tutkimuksessa laboratorio- ja bioinformatiikkamenetelmät tukevat toisiaan

37 Sekvenssirinnastus ja pisteytysmatriisit

38 Rinnastus (Alignment) Bioinformatiikan keskeisimpiä tehtäviä Keino selvittää kuinka samanlaisia kaksi sekvenssiä on Sekvenssit voivat olla proteiineja, DNA-alueita Rinnastus usein piilossa muiden tehtävien sisällä Eniten samanlaisten sekvenssien haku tietokannoista Monen sekvenssin rinnastus Onnistunut rinnastus on usein vaatimus muiden monimutkikkaampien tehtävien onnistumiselle Rinnastuksella siirretään usein tietoa sekvenssistä toiseen

39 Mitä on rinnastus? I Tarkoittaa sitä, että eri sekvensseissä samoilla kohdin olevat samanlaiset aminohapot tai nukleotidit asetetaan kohdakkain. Esimerkiksi ACGTACGT ACGTACGT ACGTACGT ACTACT AC-TACT AC-TAC-T Rinnastukseen voidaan lisätä aukkoja (gap, merkitään yleensä -, toisinaan myös.) siten, että samanlaiset aminohapot tai nukleotidit osuvat kohdakkain. Perustuu J.Tuimalan originaaleihin

40 Mitä on rinnastus II Rinnastuksella pyritään siis asettamaan sekvenssien samankaltaiset alueet kohdakkain. Tällä tavalla pyritään löytämään eri sekvensseissä olevia homologisia alueita. Samankaltaisuus (yleisesti) Mistä tahansa syystä johtuva kahden sekvenssin samanlainen tai samantapainen rakenne Homologia Sekvenssien evolutiivisista suhteista johtuva samankaltaisuus. Samankaltaisuus johtuu siis siitä, että eri sekvenssit periytyvät yhteisestä kantamuodosta. Perustuu J.Tuimalan originaaleihin

41 Rinnastaminen Mikä seuraavista on paras rinnastus? ACGTACGT ACGTACGT ACGTACGT ACTACT AC-TAC-T A-CTAC-T Kuinka samankaltaisia eri nukleotidit ovat? Miten luoduista aukoista rankaistaan? Tarvitaan jokin pisteytystapa Pisteytysmatriisi! (Engl. scoring matrix tai substitution matrix) Perustuu J.Tuimalan originaaleihin

42 Pisteytysmatriisi = Substituutiomatriisi Taulukko, jossa kerrotaan aminohappojen tai nukleotidien muutosfrekvenssit (tai muutostodennäköisyydet) Kuvastaa aminohapoilla myös sitä kuinka samanlainen kyseinen pari on ominaisuuksiltaan. Lisäksi tarvitaan joku pisteytys rinnastuksen aukoille (aukkosakkoparametrit)

43 Esim: DNA-pisteytysmatriisit Identity matrix A T C G A T C G Suom. yksikkö- eli identiteettimatriisi BLAST matrix A T C G A T C G

44 DNA-pisteytysmatriisit Transition transversion matrix A T C G A T C G Aukkosakkoparametrit: -16 aukon avaamiselle ja -4 jatkamiselle.

45 Miten lasketaan rinnastuksen pistemäärä? ACGTACGT ACGTACGT ACGTACGT ACTACT AC-TAC-T A-CTAC-T Rinnastus 2: ACGTACGT AC-TAC-T Transitio-transversio-matriisi: A +1 C +1 Huomaa: Aukosta T +1 sakotetaan A pistettä C T +1 Yht =-26

46 Rinnastusten 1 ja 3 pistemäärät? Mikä rinnastus on paras (tällä pisteytysmatriisilla ja aukkosakoilla)?

47 Pisteytysmatriisit Kaikki pisteytysmatriisit ovat yrityksiä kvantifioida evolutiivisten muutoksien tapahtumistodennäköisyyksiä DNA:lle ja aminohapoille on OMAT pisteytysmatriisinsa Joidenkin aminohappojen säilyminen samana on proteiinin rakenteen (ja niinmuodoin funktion) säilymisen kannalta tärkeämpää kuin toisten siksi isompi sakko muuttumiselle! Aminohappojen pisteytysmatriisit yrittävät kertoa siitä, josko tietty mutaatio säilyttää tai muuttaa (tuhoaa) proteiinin funktion Mutaatio voi vaikuttaa myös proteiinin rakenteeseen Useimmiten symmetrisiä, toisinaan epäsymmetrisiä. symmetrisyys: muutoksen todennäköisyys on kumpaankin suuntaan sama P(Ala -> Cys) = P(Cys -> Ala) Perustuu J.Tuimalan originaaleihin

48 Matriisien käyttötarkoitukset? Kahden sekvenssin rinnastamisessa, mutta myös... Tietokantahauissa (BLAST) Molekyylisystematiikassa Sekvenssien välisten etäisyyksien laskeminen (proteiinit) Pisteytysmatriiseja aminohapoille: PAM, Blosum, JTT DNA:lle: IUB (osuma 1.9, huti 0) Rinnastukset tehdään nykyisin tietokoneella Aminohappojen pisteytysmatriisit perustuvat niiden muodostamiin ryhmiin Perustuu J.Tuimalan originaaleihin

49 Aminohapporyhmät (huomaa virhe!) Aminohappojen samankaltaisuus perustuu niiden muodostamiin ryhmiin Saman ryhmän jäsenet korvaavat usein toisiaan proteiinisekvenssissä

50 Otetaas uusiksi:

51 Aminohappomatriisit Aminohappomatriisit pyrkivät esittämään aminohappojen edellä näytettyjä samankaltaisuuksia Kaksi käytetyintä matriisi-ryhmää: PAM-matriisit BLOSUM-matriisit

52 Blosum62-matriisi Aukon avaamissakko 12 ja jatkamissakko 4 toimivat suhteellisen hyvin.

53 PAM250-matriisi

54 Aminohappomatriisit PAM-matriisien numeroarvo ilmoittaa matriisin point accepted mutation-arvon (seuraavalla kalvolla tästä lisää), joka ei vastaa tismalleen sekvenssien erilaisuutta prosentteina, mutta on sinne päin. BLOSUM-matriisien numeroarvo ilmoittaa sen sekvenssijoukon samankaltaisuuden, jonka pohjalta matriisi on muodostettu. Perustuu J.Tuimalan originaaleihin

55 Näkyvien sekvenssieroavaisuuksien suhde PAM-lukuun Perustuu J.Tuimalan originaaleihin

56 PAM-matriisit PAM matriisit perustuvat sekvenssien linjauksista tehtyihin puihin. Puussa sekvenssejä vertaillaan puun rakenteessa ja seurataan kuinka aminohapot muuttuvat (linkki 1) Tämä matriisien muodostus keskittyy erityisesti muutoksiin lähinaapureiden välillä Perustuu J.Tuimalan originaaleihin

57 BLOSUM-matriisit BLOSUM-matriisit perustuvat aukottomiin sekvenssien linjauksiin Aminohappojen muutoksia ei rajata lähinaapureiden välille. Jokainen sekvenssi voi muuttua miksi tahansa toiseksi sekvenssiksi Tämä matriisien muodostus painottaa enemmän kaukaisten sukulaisten välisiin samankaltaisuuksiin Perustuu J.Tuimalan originaaleihin

58 Aminohappomatriisit Kun rinnastetaan sekvenssejä tai muodostetaan fylogeneettisiä puita, tulee valita tilanteeseen sopiva matriisi. Esimerkiksi PAM50-matriisia tulisi käyttää 40% samankaltaisten sekvenssien rinnastamiseen. (kts. aikaisempi kuvaaja) Vastaavasti BLOSUM40-matriisia tulisi käyttää 40% samankaltaisten sekvenssien rinnastamiseen. Perustuu J.Tuimalan originaaleihin

59 Aminohappomatriisit Miten voi tietää sekvenssien samankaltaisuuden jo ennen niiden rinnastamista? Rinnastus ei ole objektiivista (aloitetaan akateemisella arvauksella :) Menetelmä vaatii useinkin kokeilemista erilaisilla asetuksilla tai matriiseilla. Haittaako, jos sekvenssijoukossa on kovin erilaisia sekvenssejä? Luultavasti, mutta sellaisten rinnastamiseen on tiettyjä menetelmiä, jolla ongelma voidaan kiertää. Perustuu J.Tuimalan originaaleihin


61 Yhteenveto rinnastuksesta Rinnastuksen tulos riippuu käytetystä pisteytysmatriisista. Valitse matriisi joka sopii hyvin tutkituille sekvensseille Sekvenssien samankaltaisuus keskeinen tekijä Perustuu J.Tuimalan originaaleihin

62 Yhteenveto rinnastuksesta Rinnastus pyrkii sijoittamaan sekvenssien toisiaan vastaavat alueet päällekkäin Rinnastuksen tulos riippuu siitä mitkä aminohapot arvioidaan keskenään samanlaisiksi Rinnastusalgoritmit käyttävät pisteytysmatriiseja, jotka arvioivat aminohappojen samankaltaisuutta. Perustuu J.Tuimalan originaaleihin

63 Ylimääräiset kalvot Luentokokonaisuuksien lopussa on kalvoja jotka olen jättänyt pois Usein näissä on silti hyödyllistä tietoa. Näitä ei käydä luennoilla Perustuu J.Tuimalan originaaleihin

64 Mistä pisteytysmatriisit tulevat? Empiiriset pisteytysmatriisit: Tietyn verran toisistaan eroavia proteiinisekvenssijoukkoja käyttäen on määritetty aminohappojen todennäköisyydet muuttua toisikseen log odds matriisi Perustuu J.Tuimalan originaaleihin

65 Matriisin muodostaminen II Empiiristen matriisien lähtömateriaalit PAM (1978) Evolutiivinen malli (puu) taustalla, 71 proteiiniryhmää BLOSUM (1992) BLOCKS-tietokanta GONNET (1992) Koko sekvenssitietokannan rinnastus JTT (1992) Evolutiivinen malli (puu) taustalla, mutta muodostamiseen käytetty suurempaa aineistoa kuin PAM-matriisien muodostamiseen Perustuu J.Tuimalan originaaleihin

66 Esim. PAM-matriisien muodostaminen PAM = percent accepted mutation Proteiinit etääntyvät (muuttuvat) alkuperäissekvenssistä siten, että niihin kerääntyy mutaatioita. Mutaatiot ovat sellaisia, että luonnonvalinta ei ole niitä karsinut, ja niitä voi siis löytyä populaatiosta. Tällaiset mutaatiot ovat niin sanotusti hyväksyttyjä (accepted). Mutaatioita tarkastellaan irrallaan niiden ympäristöstä ja historiasta. Perustuu J.Tuimalan originaaleihin

67 Esim. PAM-matriisien muodostaminen PAM on yksi kahden sekvenssin välillä tapahtunut hyväksytty pistemutaatio sataa aminohappoa kohden. Tietyt aminohappokohdat ovat voineet muuttua enemmän kuin kerran, mutta kahta sekvenssiä tarkasteltaessa voidaan kuitenkin aina havaita vain yksi muutos. Tällöin kahden sekvenssin välinen etäisyys on oikeasti suurempi kuin havaittujen muutosten määrä. Tämä täytyy ottaa ja otetaankin huomioon! Perustuu J.Tuimalan originaaleihin

68 Esim. PAM-matriisien muodostaminen PAM-matriisin muodostaminen alkaa fylogeneettisen puun piirtämisellä. Dayhoff et. al valitsivat proteiineja, joiden samankaltaisuus oli 85% tai enemmän, jotta useilta muutoksilta samassa kohdassa vältyttäisiin. Koska sekvenssit ovat suhteellisen samankaltaisia, on fylogeneettisen puunkin piirtäminen jokseenkin helppoa. Puun perusteella voidaan identifioida ja laskea hyväksytyt muutokset. Perustuu J.Tuimalan originaaleihin

69 Esim. PAM-matriisien muodostaminen Kun tiedetään Muutosten suunta (puu) Muutosten määrä Sekvenssien pituudet voidaan laskea matriisi, joka kuvaa muutostodennäköisyyksiä tai oikeammin niiden suhteita: kuinka tod.näk. tietty muutos on verrattuna kaikkiin ko. aminohapolle tapahtuneisiin muutoksiin Perustuu J.Tuimalan originaaleihin

70 Log odds-matriisi: Muutostodennäköisyyksien suhteista otetaan vielä logaritmi: p (0.02) <=> log 2 (0.02) <=> -5.6 ~ -6 P (2) <=> log 2 (2) <=> 1 ~ 1 Jos käytetään 2-kantaista logaritmia -> bittejä Usein käytetään myös ln(2)/3 = log10(2)/3 Engl. Scale Log odds-matriisi on siis sama asia kuin pisteytysmatriisi, esimerkiksi PAM250! Perustuu J.Tuimalan originaaleihin

71 Blosum Blosum-matriisien taustalla ei ole oletusta (puuta) sekvenssien evoluutiosta Muodostettu Blocks-tietokannassa olevien proteiinien konservoituneiden alueiden avulla Muutostodennäköisyydet laskettu olettaen, että muutos voi tapahtua mistä sekvenssistä miksi sekvenssiksi tahansa. Perustuu J.Tuimalan originaaleihin

72 Mikä on algoritmi? Perustuu J.Tuimalan originaaleihin

73 Algoritmi I Algoritmi on se joukko toimenpiteitä, joilla jokin haluttu (tai annettu) tehtävä saadaan suoritettua. Miten neuvoisit kaveriasi tulemaan Rautatieasemalta Biokeskukseen? Tule osoitteeseen Viikinkaari 9 A. Olettaa, että kaverisi osaa lukea karttaa. Ota taksi, ja aja osoitteeseen Viikinkaari 9 A. Kallis opintotuella elävälle kaverillesi. Perustuu J.Tuimalan originaaleihin

74 Algoritmi II Tarkennettu ohje voisi olla seuraavanlainen: Valitse seuraavista: Jos kellonaika on välillä 7-20: - kävele Rautatientorille - nouse bussiin 68 Jos sinulla on rahaa tai saat kimpan: - ota taksi. Mikäli ei rahaa tai haluat ulkoilla - kävele. Perustuu J.Tuimalan originaaleihin

75 Algoritmi III Käytännössä algoritmi on sijoitettu tietokoneohjelman osaksi. Yhdessä tietokoneohjelmassa voi olla useita algoritmeja. Algoritmien yhteistoiminta ratkaisee varsinaisen ongelman. Tämän jälkeen algoritmien ympärille kyhätty ohjelma (käyttöliittymä ja muut osaset) ilmoittaa tuloksen käyttäjälle sopivassa muodossa. Perustuu J.Tuimalan originaaleihin

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan?

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? 2012-2013 Lasse Lensu 2 Ihmisen, eläinten ja kasvien hyvinvoinnin kannalta nykyaikaiset mittaus-,


Sekvenssien rinnastus. Rinnastus: helppoa tai vaikeaa

Sekvenssien rinnastus. Rinnastus: helppoa tai vaikeaa Sekvenssien rinnastus Rinnastus: helppoa tai vaikeaa Kaksi tai useampia (DNA tai proteiini) sekvenssejä: miten samankaltaisia sekvenssit ovat missä sekvenssikohdissa samankaltaisuutta esiintyy Kattava


Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi

Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi Algoritmit lyhyiden sekvenssien rinnastamiseen referenssigenomia vasten. Krista Longi 19.05.2014 DNA:n sekvensointi DNA:n pilkotaan lyhyiksi mallipalasiksi, templaateiksi, joiden emäsjärjestys selvitetään.


2. luento Kahden sekvenssin rinnastus

2. luento Kahden sekvenssin rinnastus 2. luento Kahden sekvenssin rinnastus Miksi rinnastusta opetetaan Keskeisintä bioinformatiikkaa Voidaan päätellä: konservoituneita alueita pistemutaatioita lajien tai geenien evolutiivisia suhteita Osa


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


S Laskennallinen systeemibiologia

S Laskennallinen systeemibiologia S-114.2510 Laskennallinen systeemibiologia 3. Harjoitus 1. Koska tilanne on Hardy-Weinbergin tasapainossa luonnonvalintaa lukuunottamatta, saadaan alleeleista muodostuvien eri tsygoottien genotyyppifrekvenssit


Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin


Molekyylisystematiikka 1.osa

Molekyylisystematiikka 1.osa Molekyylisystematiikka 1.osa Johdanto Käsitteet Sukulaisuuksien esittäminen eri formaateissa Puut: eri tavat muodostaa puu, algoritmeja, ohjelmistoja, esimerkki Petri Törönen Vanha materiaali: Päivi Onkamo,


Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä

Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä Evoluutio ja luominen Mian tekemä esitys Jannen esittämänä Väite: tiedemiehet ovat todistaneet evoluutioteorian todeksi Evoluutioteorialla tässä tarkoitan teoriaa, jonka mukaan kaikki elollinen on kehittynyt


DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa


MAB3 - Harjoitustehtävien ratkaisut:

MAB3 - Harjoitustehtävien ratkaisut: MAB3 - Harjoitustehtävien ratkaisut: 1 Funktio 1.1 Piirretään koordinaatistoakselit ja sijoitetaan pisteet: 1 1. a) Funktioiden nollakohdat löydetään etsimällä kuvaajien ja - akselin leikkauspisteitä.


Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine


Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122

Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122 Bioinformatiikan maisteriohjelman infotilaisuus 15.11.2007 Exactum D122 Bio- ja lääketieteiden opiskelu MBImaisteriohjelmassa Outi Monni, Dos, FT Biolääketieteen laitos 15.11.2007 Bioinformatiikan maisteriohjelma


Evoluutiopuu. Aluksi. Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot. Luokkataso: 6.-9. luokka, lukio

Evoluutiopuu. Aluksi. Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot. Luokkataso: 6.-9. luokka, lukio Evoluutiopuu Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot Luokkataso: 6.-9. luokka, lukio Välineet: loogiset palat, paperia, kyniä Kuvaus: Tehtävässä tutkitaan bakteerien evoluutiota.


Yhtäläisyydet selkärankaisten aivoissa, osa II. Niko Lankinen

Yhtäläisyydet selkärankaisten aivoissa, osa II. Niko Lankinen Yhtäläisyydet selkärankaisten aivoissa, osa II Niko Lankinen Sisältö Neuroneille tyypilliset molekyylit Suoraa jatkoa Niinan esitykseen Alkion aivojen vertailua Neuromeerinen malli Neuromeerisen mallin


Bi7-kurssilla lisäksi: Tutustutaan lääketieteelliseen tutkimukseen (jos jää aikaa) Avataan råtta ihmisen rakenteen yhteenvetona

Bi7-kurssilla lisäksi: Tutustutaan lääketieteelliseen tutkimukseen (jos jää aikaa) Avataan råtta ihmisen rakenteen yhteenvetona Oppikirjana Kokkonen ym.: Lukion biologia. Ihmisen biologia, Bi4, Otava 2010 (tai uudempi). Bi4-kurssilla edetään kirjaa sivulle 55. Tästä jatketaan kirjan loppuun Bi7-kurssilla. Bi7-kurssilla lisäksi:


a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien


KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli


Biotieteiden perusteet farmasiassa, syksy 2017

Biotieteiden perusteet farmasiassa, syksy 2017 Biotieteiden perusteet farmasiassa, syksy 2017 Maarit Kortesoja Farmaseuttisten biotieteiden osasto 23.8.2017 1 Opintojakson tavoitteet Opintojakson suoritettuaan opiskelija Osaa kuvata entsyymien rakenteen


Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus

Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus Katri Kärkkäinen Matti Haapanen Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus Katri Kärkkäinen ja Matti Haapanen Metsäntutkimuslaitos Vantaan tutkimuskeskus


Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa


58131 Tietorakenteet (kevät 2009) Harjoitus 6, ratkaisuja (Antti Laaksonen)

58131 Tietorakenteet (kevät 2009) Harjoitus 6, ratkaisuja (Antti Laaksonen) 58131 Tietorakenteet (kevät 2009) Harjoitus 6, ratkaisuja (Antti Laaksonen) 1. Avaimet 1, 2, 3 ja 4 mahtuvat samaan lehtisolmuun. Tässä tapauksessa puussa on vain yksi solmu, joka on samaan aikaan juurisolmu


Akateemisen ajattelun alkeiskurssi

Akateemisen ajattelun alkeiskurssi CHEM-A1600: Aalto-kurssi, 3 op Akateemisen ajattelun alkeiskurssi sami.franssila@aalto.fi 11.9-4.12.2015: 12 kertaa Mitä ajattelu on? Ajattelua on se hukka-aika, joka kuluu jonkun näkemisestä siihen kun


VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja


Matemaatikot ja tilastotieteilijät

Matemaatikot ja tilastotieteilijät Matemaatikot ja tilastotieteilijät Matematiikka/tilastotiede ammattina Tilastotiede on matematiikan osa-alue, lähinnä todennäköisyyslaskentaa, mutta se on myös itsenäinen tieteenala. Tilastotieteen tutkijat


FM-opiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo)

FM-opiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo) FMopiskelijan opintopolku, perinnöllisyystiede, geneettisen bioinformatiikan erikoistumislinja (vastuuopettaja Päivi Onkamo) 1. PERINNÖLLISYYSTIETEEN SYVENTÄVÄT OPINNOT (527050), 94 op 1.1. Pakolliset


Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja


Evoluutiovoimat. Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa?

Evoluutiovoimat. Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa? Evoluutiovoimat Mikä on mutaation, valinnan ja sattuman merkitys evoluutiossa? -sattuman sysäily: populaatiokoon vaikutus -valinta: positiivinen, tasapainottava ja negatiivinen -mutaatiot: neutraalien,


Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet


MAB3 - Harjoitustehtävien ratkaisut:

MAB3 - Harjoitustehtävien ratkaisut: MAB - Harjoitustehtävien ratkaisut: Funktio. Piirretään koordinaatistoakselit ja sijoitetaan pisteet:. a) Funktioiden nollakohdat löydetään etsimällä kuvaajien ja - akselin leikkauspisteitä. Funktiolla


DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen

DNA-testit. sukututkimuksessa Keravan kirjasto Paula Päivinen DNA-testit sukututkimuksessa 28.11.2017 Keravan kirjasto Paula Päivinen Solu tuma kromosomit 23 paria DNA Tumassa olevat kromosomit periytyvät jälkeläisille puoliksi isältä ja äidiltä Y-kromosomi periytyy


Proteiinien kontaktiresidyjen ennustaminen. Tuomo Hartonen Teoreettisen fysiikan syventävien opintojen seminaari

Proteiinien kontaktiresidyjen ennustaminen. Tuomo Hartonen Teoreettisen fysiikan syventävien opintojen seminaari Proteiinien kontaktiresidyjen ennustaminen Tuomo Hartonen Teoreettisen fysiikan syventävien opintojen seminaari 13.12.12 Terminologiaa Aminohappo = proteiinien rakennuspalikka, luonto käyttää 20 erilaista


T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...


Kombinatorinen optimointi

Kombinatorinen optimointi Kombinatorinen optimointi Sallittujen pisteiden lukumäärä on äärellinen Periaatteessa ratkaisu löydetään käymällä läpi kaikki pisteet Käytännössä lukumäärä on niin suuri, että tämä on mahdotonta Usein



T DATASTA TIETOON TKK / Informaatiotekniikan laboratorio Syyslukukausi, periodi II, 2007 Erkki Oja, professori, ja Heikki Mannila, akatemiaprofessori: T-61.2010 DATASTA TIETOON TKK, Informaatiotekniikan laboratorio 1 JOHDANTO:


Johdatus tekoälyyn. Luento 6.10.2011: Koneoppiminen. Patrik Hoyer. [ Kysykää ja kommentoikaa luennon aikana! ]

Johdatus tekoälyyn. Luento 6.10.2011: Koneoppiminen. Patrik Hoyer. [ Kysykää ja kommentoikaa luennon aikana! ] Johdatus tekoälyyn Luento 6.10.2011: Koneoppiminen Patrik Hoyer [ Kysykää ja kommentoikaa luennon aikana! ] Koneoppiminen? Määritelmä: kone = tietokone, tietokoneohjelma oppiminen = ongelmanratkaisukyvyn


BIOS 1 ja OPS 2016 OPS Biologian opetussuunnitelma Opetuksen tavoitteet

BIOS 1 ja OPS 2016 OPS Biologian opetussuunnitelma Opetuksen tavoitteet BIOS 1 ja OPS 2016 Biologian opetussuunnitelma 2016 Biologian opetuksen tehtävänä on tukea opiskelijan luonnontieteellisen ajattelun kehittymistä. Opetus lisää ymmärrystä biologian merkityksestä osana


17/20: Keittokirja IV

17/20: Keittokirja IV Ohjelmointi 1 / syksy 2007 17/20: Keittokirja IV Paavo Nieminen nieminen@jyu.fi Tietotekniikan laitos Informaatioteknologian tiedekunta Jyväskylän yliopisto Ohjelmointi 1 / syksy 2007 p.1/10 Tavoitteita


VASTAUS 1: Yhdistä oikein

VASTAUS 1: Yhdistä oikein KPL3 VASTAUS 1: Yhdistä oikein a) haploidi - V) ihmisen sukusolu b) diploidi - IV) ihmisen somaattinen solu c) polyploidi - VI) 5n d) iturata - III) sukusolujen muodostama solulinja sukupolvesta toiseen


Laskennallinen menetelmä puun biomassan ja oksien kokojakauman määrittämiseen laserkeilausdatasta

Laskennallinen menetelmä puun biomassan ja oksien kokojakauman määrittämiseen laserkeilausdatasta Laskennallinen menetelmä puun biomassan ja oksien kokojakauman määrittämiseen laserkeilausdatasta Pasi Raumonen, Mikko Kaasalainen ja Markku Åkerblom Tampereen teknillinen ylipisto, Matematiikan laitos


1 Kannat ja kannanvaihto

1 Kannat ja kannanvaihto 1 Kannat ja kannanvaihto 1.1 Koordinaattivektori Oletetaan, että V on K-vektoriavaruus, jolla on kanta S = (v 1, v 2,..., v n ). Avaruuden V vektori v voidaan kirjoittaa kannan vektorien lineaarikombinaationa:


Trichoderma reesein geenisäätelyverkoston ennustaminen Oskari Vinko

Trichoderma reesein geenisäätelyverkoston ennustaminen Oskari Vinko Trichoderma reesein geenisäätelyverkoston ennustaminen Oskari Vinko 04.11.2013 Ohjaaja: Merja Oja Valvoja: Harri Ehtamo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Uusia mahdollisuuksia FoundationOne

Uusia mahdollisuuksia FoundationOne Uusia mahdollisuuksia FoundationOne FI/FMI/1703/0019 Maaliskuu 2017 FoundationOne -palvelu FoundationOne on kattava genomianalysointipalvelu, jossa tutkitaan 315 geenistä koko koodaava alue sekä 28 geenistä


DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio

DNA RNA proteiinit transkriptio prosessointi translaatio regulaatio replikaatio repair mitoosi meioosi fertilisaatio rekombinaatio repair mendelistinen genetiikka DNA-huusholli Geenien toiminta molekyyligenetiikka DNA RNA proteiinit transkriptio prosessointi translaatio


Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma

Genomin ilmentyminen Liisa Kauppi, Genomibiologian tutkimusohjelma Genomin ilmentyminen 17.1.2013 Liisa Kauppi, Genomibiologian tutkimusohjelma liisa.kauppi@helsinki.fi Genomin ilmentyminen transkription aloitus RNA:n synteesi ja muokkaus DNA:n ja RNA:n välisiä eroja


Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira

Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset Annikki Welling Kemian ja toksikologian tutkimusyksikkö Evira Elintarvikepetokset EU:ssa ei ole yleisesti hyväksyttyä elintarvikepetosten määritelmää. Yleinen ohjeistus löytyy elintarvikelainsäädäntöä


CSC:n käyttäjätunnukset - myös opiskelijoille

CSC:n käyttäjätunnukset - myös opiskelijoille CSC:n käyttäjätunnukset - myös opiskelijoille http://www.csc.fi/asiakkaaksi/korkeakoulut/kayttol upahakemukset/index_html Ohjaajan nimeksi Petri Törönen Perusteluiksi opiskelu ja luentokurssin nimi (Geneettisen



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen


Königsbergin sillat. Königsberg 1700-luvulla. Leonhard Euler ( )

Königsbergin sillat. Königsberg 1700-luvulla. Leonhard Euler ( ) Königsbergin sillat 1700-luvun Königsbergin (nykyisen Kaliningradin) läpi virtasi joki, jonka ylitti seitsemän siltaa. Sanotaan, että kaupungin asukkaat yrittivät löytää reittiä, joka lähtisi heidän kotoaan,



LUOMINEN JA EVOLUUTIO LUOMINEN JA EVOLUUTIO Maailman syntyminen on uskon asia Evoluutioteoria Luominen Teoria, ei totuus Lähtökohta: selittää miten elollinen maailma olisi voinut syntyä, jos mitään yliluonnollista ei ole Ei


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla





Algoritmit 1. Luento 1 Ti Timo Männikkö

Algoritmit 1. Luento 1 Ti Timo Männikkö Algoritmit 1 Luento 1 Ti 10.1.2017 Timo Männikkö Luento 1 Algoritmi Algoritmin toteutus Ongelman ratkaiseminen Algoritmin tehokkuus Algoritmin suoritusaika Algoritmin analysointi Algoritmit 1 Kevät 2017


Tiedonhallinnan perusteet. Viikko 1 Jukka Lähetkangas

Tiedonhallinnan perusteet. Viikko 1 Jukka Lähetkangas Tiedonhallinnan perusteet Viikko 1 Jukka Lähetkangas Kurssilla käytävät asiat Tietokantojen toimintafilosofian ja -tekniikan perusteet Tiedonsäilönnän vaihtoehdot Tietokantojen suunnitteleminen internetiä


Matematiikka ja teknologia, kevät 2011

Matematiikka ja teknologia, kevät 2011 Matematiikka ja teknologia, kevät 2011 Peter Hästö 3. helmikuuta 2011 Matemaattisten tieteiden laitos Sisältö Kurssi koostuu kuudesta (seitsemästä) toisistaan riippumattomasta luennosta. Aihepiirit ovat:


Eliömaailma. BI1 Elämä ja evoluutio Leena Kangas-Järviluoma

Eliömaailma. BI1 Elämä ja evoluutio Leena Kangas-Järviluoma Eliömaailma BI1 Elämä ja evoluutio Leena Kangas-Järviluoma Aitotumalliset l. eukaryootit Esitumalliset l. prokaryootit kasvit arkit alkueliöt sienet bakteerit eläimet Eliökunnan sukupuu Tumattomat eliöt


MS-C2111 Stokastiset prosessit

MS-C2111 Stokastiset prosessit Aalto-yliopisto, Matematiikan ja systeemianalyysin laitos toimisto: Y241, vastaanotto: pe 13:30-14:30 2017, periodi I KURSSIN JÄRJESTELYT Kurssin järjestelyt Luennot ja harjoitusryhmät Luennot tiistaisin


SUBSTANTIIVIT 1/6. juttu. joukkue. vaali. kaupunki. syy. alku. kokous. asukas. tapaus. kysymys. lapsi. kauppa. pankki. miljoona. keskiviikko.

SUBSTANTIIVIT 1/6. juttu. joukkue. vaali. kaupunki. syy. alku. kokous. asukas. tapaus. kysymys. lapsi. kauppa. pankki. miljoona. keskiviikko. SUBSTANTIIVIT 1/6 juttu joukkue vaali kaupunki syy alku kokous asukas tapaus kysymys lapsi kauppa pankki miljoona keskiviikko käsi loppu pelaaja voitto pääministeri päivä tutkimus äiti kirja SUBSTANTIIVIT


Tehtäväsarja I Seuraavat tehtävät liittyvät kurssimateriaalin lukuun 7 eli vapauden käsitteeseen ja homogeenisiin

Tehtäväsarja I Seuraavat tehtävät liittyvät kurssimateriaalin lukuun 7 eli vapauden käsitteeseen ja homogeenisiin HY / Avoin yliopisto Lineaarialgebra ja matriisilaskenta I, kesä 2015 Harjoitus 4 Ratkaisut palautettava viimeistään maanantaina 862015 klo 1615 Tehtäväsarja I Seuraavat tehtävät liittyvät kurssimateriaalin


Darwin: Tutkimusprojektin esittely

Darwin: Tutkimusprojektin esittely 1 Darwin: Tutkimusprojektin esittely Tutkimusongelma: voidaanko ohjelmistoarkkitehtuuri generoida automaattisesti? Suomen Akatemian rahoittama tutkimusprojekti 2009-2011 TTY & TaY yhteistyö Ks. http://practise.cs.tut.fi/project.php?project=darwin


Fysiikan opinnot Avoimen yliopiston opiskelijoille

Fysiikan opinnot Avoimen yliopiston opiskelijoille Fysiikan opinnot Avoimen yliopiston opiskelijoille Fysiikan laitos / Pia Saarinen www.helsinki.fi/yliopisto 4.9.2013 1 Fysiikan perusopinnot, 25 op - kokonaisuutena tai yksittäisinä kursseina 530281 Vuorovaikutukset


Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira

Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa. Annikki Welling Kemian laboratoriopalvelut Evira Lajinmäärityksestä elintarvikkeiden aitoustutkimuksessa Annikki Welling Kemian laboratoriopalvelut Evira Sisältö Elintarvikepetokset Menetelmiä elintarvikepetosten tunnistamiseksi DNA menetelmät DNA viivakoodaus


Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti


Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia


v 8 v 9 v 5 C v 3 v 4

v 8 v 9 v 5 C v 3 v 4 Verkot Verkko on (äärellinen) matemaattinen malli, joka koostuu pisteistä ja pisteitä toisiinsa yhdistävistä viivoista. Jokainen viiva yhdistää kaksi pistettä, jotka ovat viivan päätepisteitä. Esimerkiksi


Inversio-ongelmien laskennallinen peruskurssi Luento 4

Inversio-ongelmien laskennallinen peruskurssi Luento 4 Inversio-ongelmien laskennallinen peruskurssi Luento 4 Kevät 20 Regularisointi Eräs keino yrittää ratkaista (likimääräisesti) huonosti asetettuja ongelmia on regularisaatio. Regularisoinnissa ongelmaa


Luku 21. Evoluution perusteet

Luku 21. Evoluution perusteet 1. Evoluutio käsitteenä a. Mitä käsite evoluutio tarkoittaa? b. Miten evoluutiota tapahtuu? c. Mitkä ovat evoluution päämääriä? 2. Evoluution todisteita Mitä seuraavat evoluution todisteet osoittavat evoluutiosta?


verkkojen G ja H välinen isomorfismi. Nyt kuvaus f on bijektio, joka säilyttää kyseisissä verkoissa esiintyvät särmät, joten pari

verkkojen G ja H välinen isomorfismi. Nyt kuvaus f on bijektio, joka säilyttää kyseisissä verkoissa esiintyvät särmät, joten pari Tehtävä 9 : 1 Merkitään kirjaimella G tehtäväpaperin kuvan vasemmanpuoleista verkkoa sekä kirjaimella H tehtäväpaperin kuvan oikeanpuoleista verkkoa. Kuvan perusteella voidaan havaita, että verkko G on


Arkkitehtuurien tutkimus Outi Räihä. OHJ-3200 Ohjelmistoarkkitehtuurit. Darwin-projekti. Johdanto

Arkkitehtuurien tutkimus Outi Räihä. OHJ-3200 Ohjelmistoarkkitehtuurit. Darwin-projekti. Johdanto OHJ-3200 Ohjelmistoarkkitehtuurit 1 Arkkitehtuurien tutkimus Outi Räihä 2 Darwin-projekti Darwin-projekti: Akatemian rahoitus 2009-2011 Arkkitehtuurisuunnittelu etsintäongelmana Geneettiset algoritmit


Opetusmateriaali. Fermat'n periaatteen esittely

Opetusmateriaali. Fermat'n periaatteen esittely Opetusmateriaali Fermat'n periaatteen esittely Hengenpelastajan tehtävässä kuvataan miten hengenpelastaja yrittää hakea nopeinta reittiä vedessä apua tarvitsevan ihmisen luo - olettaen, että hengenpelastaja


Bayesilainen päätöksenteko / Bayesian decision theory

Bayesilainen päätöksenteko / Bayesian decision theory Bayesilainen päätöksenteko / Bayesian decision theory Todennäköisyysteoria voidaan perustella ilman päätösteoriaa, mutta vasta päätösteorian avulla siitä on oikeasti hyötyä Todennäköisyyteoriassa tavoitteena


T Luonnollisten kielten tilastollinen käsittely Vastaukset 11, ke , 12:15 14:00 Puheentunnistus ja kielimallien evaluointi Versio 1.

T Luonnollisten kielten tilastollinen käsittely Vastaukset 11, ke , 12:15 14:00 Puheentunnistus ja kielimallien evaluointi Versio 1. T-61.020 Luonnollisten kielten tilastollinen käsittely Vastaukset 11, ke 18.4.2007, 12:1 14:00 Puheentunnistus ja kielimallien evaluointi Versio 1.0 1. Käytämme siis jälleen viterbi-algoritmia todennäköisimmän


Tietorakenteet, laskuharjoitus 7, ratkaisuja

Tietorakenteet, laskuharjoitus 7, ratkaisuja Tietorakenteet, laskuharjoitus, ratkaisuja. Seuraava kuvasarja näyttää B + -puun muutokset lisäysten jälkeen. Avaimet ja 5 mahtuvat lehtisolmuihin, joten niiden lisäys ei muuta puun rakennetta. Avain 9


Biologian tehtävien vastaukset ja selitykset

Biologian tehtävien vastaukset ja selitykset Biologian tehtävien vastaukset ja selitykset Ilmainen lääkiksen harjoituspääsykoe, kevät 2017 Tehtävä 2. (20 p) A. 1. EPÄTOSI. Ks. s. 4. Menetelmää käytetään geenitekniikassa geenien muokkaamisessa. 2.


Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt.

Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt. Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt.fi Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari


Kynä-paperi -harjoitukset. Taina Lehtinen Taina I Lehtinen Helsingin yliopisto

Kynä-paperi -harjoitukset. Taina Lehtinen Taina I Lehtinen Helsingin yliopisto Kynä-paperi -harjoitukset Taina Lehtinen 43 Loput ratkaisut harjoitustehtäviin 44 Stressitestin = 40 s = 8 Kalle = 34 pistettä Ville = 5 pistettä Z Kalle 34 8 40 0.75 Z Ville 5 8 40 1.5 Kalle sijoittuu


Tiedonlouhinta rakenteisista dokumenteista (seminaarityö)

Tiedonlouhinta rakenteisista dokumenteista (seminaarityö) Tiedonlouhinta rakenteisista dokumenteista (seminaarityö) Miika Nurminen (minurmin@jyu.fi) Jyväskylän yliopisto Tietotekniikan laitos Kalvot ja seminaarityö verkossa: http://users.jyu.fi/~minurmin/gradusem/


Paikannuksen matematiikka MAT

Paikannuksen matematiikka MAT TA M P E R E U N I V E R S I T Y O F T E C H N O L O G Y M a t h e m a t i c s Paikannuksen matematiikka MAT-45800 4..008. p.1/4 Käytännön järjestelyt Kotisivu: http://math.tut.fi/courses/mat-45800/ Luennot:


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does


4.1 Kaksi pistettä määrää suoran

4.1 Kaksi pistettä määrää suoran 4.1 Kaksi pistettä määrää suoran Kerrataan aluksi kurssin MAA1 tietoja. Geometrisesti on selvää, että tason suora on täysin määrätty, kun tunnetaan sen kaksi pistettä. Joskus voi tulla vastaan tilanne,


Tilastotieteen jatkokurssi syksy 2003 Välikoe 2 11.12.2003

Tilastotieteen jatkokurssi syksy 2003 Välikoe 2 11.12.2003 Nimi Opiskelijanumero Tilastotieteen jatkokurssi syksy 2003 Välikoe 2 11.12.2003 Normaalisti jakautuneiden yhdistyksessä on useita tuhansia jäseniä. Yhdistyksen sääntöjen mukaan sääntöihin tehtävää muutosta


Tarkastelen suomalaisen taloustieteen tutkimuksen tilaa erilaisten julkaisutietokantojen avulla. Käytän myös kerättyjä tietoja yliopistojen

Tarkastelen suomalaisen taloustieteen tutkimuksen tilaa erilaisten julkaisutietokantojen avulla. Käytän myös kerättyjä tietoja yliopistojen 1 2 3 Tarkastelen suomalaisen taloustieteen tutkimuksen tilaa erilaisten julkaisutietokantojen avulla. Käytän myös kerättyjä tietoja yliopistojen opettajien tutkimusalueista. 4 Kuviossa 1 esitetään kansantaloustieteen


MS-A0502 Todennäköisyyslaskennan ja tilastotieteen peruskurssi

MS-A0502 Todennäköisyyslaskennan ja tilastotieteen peruskurssi MS-A0502 Todennäköisyyslaskennan ja tilastotieteen peruskurssi 4A Parametrien estimointi Lasse Leskelä Matematiikan ja systeemianalyysin laitos Perustieteiden korkeakoulu Aalto-yliopisto Syksy 2016, periodi


Koiran periytyvä persoonallisuus

Koiran periytyvä persoonallisuus Koiran periytyvä persoonallisuus Katriina Tiira, FT, Koirangeenit tutkimusryhmä, HY & Folkhälsan, Eläinten hyvinvoinnin tutkimuskeskus Periytyykö käyttäytyminen? Kaikki yksilön kokemukset kohtuajasta eteenpäin=


Luku 8. Aluekyselyt. 8.1 Summataulukko

Luku 8. Aluekyselyt. 8.1 Summataulukko Luku 8 Aluekyselyt Aluekysely on tiettyä taulukon väliä koskeva kysely. Tyypillisiä aluekyselyitä ovat, mikä on taulukon välin lukujen summa tai pienin luku välillä. Esimerkiksi seuraavassa taulukossa


Algoritmit 2. Luento 1 Ti Timo Männikkö

Algoritmit 2. Luento 1 Ti Timo Männikkö Algoritmit 2 Luento 1 Ti 14.3.2017 Timo Männikkö Luento 1 Algoritmi Algoritmin valinta Algoritmin analysointi Algoritmin suoritusaika Peruskertaluokkia Kertaluokkamerkinnät Kertaluokkien ominaisuuksia



Alkuraportti. LAPPEENRANNAN TEKNILLINEN YLIOPISTO TIETOJENKÄSITTELYN LAITOS CT10A4000 - Kandidaatintyö ja seminaari LAPPEENRANNAN TEKNILLINEN YLIOPISTO TIETOJENKÄSITTELYN LAITOS CT10A4000 - Kandidaatintyö ja seminaari Alkuraportti Avoimen lähdekoodin käyttö WWW-sovelluspalvelujen toteutuksessa Lappeenranta, 30.3.2008,


Tietorakenteet ja algoritmit - syksy 2015 1

Tietorakenteet ja algoritmit - syksy 2015 1 Tietorakenteet ja algoritmit - syksy 2015 1 Tietorakenteet ja algoritmit - syksy 2015 2 Tietorakenteet ja algoritmit Johdanto Ari Korhonen Tietorakenteet ja algoritmit - syksy 2015 1. JOHDANTO 1.1 Määritelmiä


Kokogenomisekvensointi (WGS)

Kokogenomisekvensointi (WGS) Kokogenomisekvensointi (WGS) - Esimerkkinä tuberkuloosi FT, Dos., johtava asiantuntija Hanna Soini Terveysturvallisuusosasto 14.11.2017 WGS - Hanna Soini 1 Sidonnaisuudet Hanna Soini Johtava asiantuntija,


Neuroverkkojen soveltaminen vakuutusdatojen luokitteluun

Neuroverkkojen soveltaminen vakuutusdatojen luokitteluun Neuroverkkojen soveltaminen vakuutusdatojen luokitteluun Sami Hokuni 12 Syyskuuta, 2012 1/ 54 Sami Hokuni Neuroverkkojen soveltaminen vakuutusdatojen luokitteluun Turun Yliopisto. Gradu tehty 2012 kevään



1. OHJAAMATON OPPIMINEN JA KLUSTEROINTI 1. OHJAAMATON OPPIMINEN JA KLUSTEROINTI 1 1.1 Funktion optimointiin perustuvat klusterointialgoritmit Klusteroinnin onnistumista mittaavan funktion J optimointiin perustuvissa klusterointialgoritmeissä


Tähtitieteen käytännön menetelmiä Kevät 2009

Tähtitieteen käytännön menetelmiä Kevät 2009 Tähtitieteen käytännön menetelmiä Kevät 2009 2009-01-12 Yleistä Luennot Luennoija hannu.p.parviainen@helsinki.fi Aikataulu Observatoriolla Maanantaisin 10.00-12.00 Ohjattua harjoittelua maanantaisin 9.00-10.00


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


GeoGebra tutkivan oppimisen välineenä: havainto-hypoteesi-testaus

GeoGebra tutkivan oppimisen välineenä: havainto-hypoteesi-testaus GeoGebra tutkivan oppimisen välineenä: havainto-hypoteesi-testaus Mitä jäi mieleen viime viikosta? Mitä mieltä olet tehtävistä, joissa GeoGebralla työskentely yhdistetään paperilla jaettaviin ohjeisiin
