52739 Bioinformatiikan perusteet Kevät 2013

Koko: px
Aloita esitys sivulta:

Download "52739 Bioinformatiikan perusteet Kevät 2013"

Transkriptio

1 52739 Bioinformatiikan perusteet Kevät 2013 Petri Törönen Materiaalia kommentoineet: Pekka Kohonen, Petri Auvinen, Liisa Holm Kiitokset

2 Päivi Onkamo äitiyslomalla Petri Törönen tuuraamassa petri DOT toronen AT helsinki DOT fi Biokeskus 2, D-porras, 7. krs Huone 7002

3 Bioinformatiikan perusteet, 3 op (52739) Luennot , ti, to klo , BIOK2 AUD1041. Kurssin kotisivut: Flammassa työn alla, alla, alla. WWW: Kuulustelu: klo , Infotalo, auditorio 2. Uusinnat: Ensimmäinen uusinta??? Kotitehtävät: tehtävänannot tulevat perjantaisin kurssin kotisivuille. Tarkastetaan yhteisesti seuraavan keskiviikon luennoilla. Omia vastauksia ei siis palauteta luennoijalle. Luennoitsijat: FT Petri Törönen, Dos. Rainer Lehtonen

4 Oheislukemistoa: CSC:n Sekvenssianalyysiopas (lataa pdf osoitteesta tai tilaa painettuna CSC:ltä hintaan 15 kpl) Bioinformatiikan perusteet (kirj. Tuimala J), ladattavissa pdf:nä tai tilattavissa (kuten edellä) Xiong: Essential Bioinformatics, 2006 (osin, tämä teos on myös yksi perimän cum laude -tenttikirjoista) Zvelebil & Baum: Understanding Bioinformatics, 2008 Pevsner: Bioinformatics and Functional Genomics, 2009.

5 WWW Google: bioinformatics tutorial OR guide. otutorials.aspx NIH:n kokoelma WWW-kursseista nal.pcbi Kokoelma WWW-kurseista. Kurssien plussat ja miinukset kuvattu! GOBLET-organisaation kokoelma WWW-oppaita EBI:in ohjelmien opetusta

6 Tiedoksi JOO-opiskelijoille Yliopiston verkkotunnuksista: JOO-opiskelijoille kuuluu HY:n mikroverkkotunnus. Sen saa Impact factorysta opintopalvelupisteestä. Ota mukaan JOO-hyväksymisilmoitus ja jos sieltä ei saa, tiedustele Heikki Tuuralalta: Heikki Tuurala suunnittelija Helsingin yliopisto Bio- ja ympäristötieteiden laitos Puh

7 Luentokurssin sisältö Johdanto bioinformatiikan tärkeimpiin menetelmiin Kurssilla käsitellään sekvenssianalyysiin liittyviä menetelmiä: kahden ja useamman sekvenssin rinnastuksen teoriaa (esim.dot-plot, progressiivinen rinnastus, ClustalX, Muscle), tietokantahakualgoritmeja (BLAST). Yleisimmin käytettyjä tietokantoja (NCBI, EMBL, Uniprot), fylogeneettistä analyysiä, geenikartoitusta, mikrosiru- ja promoottorianalyysejä, sekä hiukan farmakogenomiikkaa Kurssin suorittaminen: Hyväksytty tentti (vähintään 50% pisteistä ansaittu).

8 Tentti Aineistotenttinä: luentomateriaalin saa ottaa mukaan tenttiin. Tenttikysymykset laaditaan luennoilla läpikäytyjen asioiden pohjalta, ja ne ovat luonteeltaan soveltavia Tentti arvostellaan normaalisti asteikolla 1-5 (siis arvosanan 1/5 saavuttamiseksi vähintään 50% max-pisteistä täytyy olla ansaittuna).

9 Luentojen aiheet, aikataulu Johdanto, pisteytysmatriisit Kahden sekvenssin rinnastus BLAST Biotietokannat I Biotietokannat II Usean sekvenssin rinnastus 4.2. Molekyylisystematiikka I 6.2. Molekyylisystematiikka II Geeniekspressio: Mikrosirut Genomiikka Geenikartoitus I. Tutkimusprojektin esittely Geenikartoitus II. Farmakogenetiikka TENTTI

10 Mitä bioinformatiikka on?

11 Mitä bioinformatiikka on? Informaatiotieteen ja biologian välimaastoa Tieteenala, joka kehittää informaatio- ja tietoteknisiä välineitä biologisten ongelmien ratkaisemiseksi Informaatioteknologian ala, jota käytetään biologisen informaation tallentamiseen, ylläpitämiseen ja analysoimiseen Bioinformatiikka on osa laskennallista biologiaa Perustuu J.Tuimalan originaaleihin

12 Mitä bioinformatiikka on? Tieteellisiä kysymyksiä pyritään ratkaisemaan käymällä laajoja biologisia aineistoja läpi Aineisto voi olla tutkimusryhmän omaa tai se voi olla peräisin julkisista tietokannoista Aineistojen suuruuden takia tarvitaan tietojenkäsittelyn tarjoamia menetelmiä Analyysitehtävät voivat olla myös manuaalisesti vaikeita/mahdottomia ratkaista

13 Bioinformatiikan osuus kasvussa Tietokantojen koko on kasvanut räjähdysmäisesti High Throughput-menetelmät Käytettävissä oleva laskentateho (tietokoneiden tehokkuus) on kasvanut Uusien menetelmien kehittyminen bioinformatiikan, tilastotieteen ja tietojenkäsittelyn (koneoppimisen) saralla

14 Tietokantojen sisällön kasvu Tilastoja, European Nucleotide Archive (ENA) eli geenipankki : Eri lajien osuudet tietokannassa olevista nukleotideista 2010: Total nucleotides 2010: 301,119,983,275, of which Homo sapiens Mus musculus Rattus norvegicus Bos taurus marine metagenome Pan troglodytes Danio rerio Zea mays Canis lupus familiaris Sus scrofa Other

15 Tietokantojen sisällön kasvu Tietokannat kasvavat eksponentiaalisesti Moreover, the volume of data is increasing exponentially with a doubling time of approximately 10 months

16 Kokonaan sekvensoituja genomeja * Prokaryootteja Arkkeja Eukaryootteja joista sieniä 16, kasveja 7, eläimiä 6, ja alkueliöitä (protists) 10. Valmiina mm: hiiva, sukkulamadot (2 lajia), banaanikärpänen (2 lajia), ihminen, simpanssi, sika, hiiri, pallokala, riisi, lituruohovehnä, maissi, hamppu. Nearly-there : Eläimistä: jättiläispanda, koira, marsu, siili, kissa, opossumi, elefantti, 9-vyövyötiäinen, nauta, hevonen, vesipuhveli, mehiläinen, kimalainen, kana, seeprakala, malariahyttynen, jne. Kasveista: koivu, omena, ohra, soija, jättipoppeli, tomaatti, vehnä, papaija, durra, kookospalmu, mung-papu, papaija, aitoviini jne. seeprakala opossumi *http://www.ncbi.nlm.nih.gov/genomes/static/gpstat.html

17 Kokonaan sekvensoituja genomeja PAH!!! EDELLINEN KALVO VANHA Tämäkin lukumäärä kasvaa eksponentiaalisesti 2013: Arhaea: 181, Bacteria: 3762, Eukaryotes: 183 (*) 2014: Arhaea: 277, Bacteria: 11777, Eukaryotes: 312 (**) * **

18 Laboratoriomenetelmien mullistus Laboratorioanalyysi siirtynyt kokonaisten eliöiden kaikkien geenien samanaikaiseen tutkimiseen Mikrosiru-menetelmät High Throughput-menetelmät Uuden sukupolven sekvensointi Proteomics & metabolomics

19 Mikrosirumenetelmät Kehitetty tutkimaan ~ geenin aktiivisuutta biologisessa näytteessä Menetelmä kuvataan luennoilla myöhemmin Mahdollistaa kaikkien tunnettujen geenien samanaikaisen tutkimisen näytteestä Mikrosirut on suunniteltu eliökohtaisesti Eivät (tavallisesti) sovellu populaatioihin

20 Mikrosirumenetelmät Sovelluksia: Geenien aktiivisuus laboratoriotestin aikana Geenien aktiivisuuksien vertailu erilaisten genotyyppien välillä Geenien aktiivisuuksien vertailu terveen ja tautikudoksen välillä

21 High Throughput menetelmät Laboratoriotutkimusta rinnakkaistettuna Käytetään robotiikkaa ja testataan erilaisia olosuhteita / reagensseja Usein testataan esim. kaikkia tutkittavan eliön geenejä Koneellinen kuva-analyysi voi tallentaa esim. solujen morfologisia muutoksia käsittelyn jälkeen

22 High Throughput menetelmät Sovelluksia: Gene knockout / RNA-silencing studies High throughput drug screening Proteiinien sitoutuminen toisiinsa eliötasolla

23 Next Generation Sequencing Laitteita jotka sekvensoivat vahvasti rinnakkaisesti ( sekvenssijaksoa/analyysi) Jokainen jakso nukleotidia pitkä Tulos saadaan kun jaksot yhdistetään Sovelluksia: Genomin de novo-sekvensointi Genomin re-sekvensointi RNA-sekvensointi

24 Next Generation Sequencing Genomin de-novo-sekvensointi Luodaan tutkittavan eliön genomisekvenssi pelkästään sekvensointituloksien avulla Ei aikaisempaa genomisekvenssiä Genomin re-sekvensointi Tutkitaan esim. potilaita tai syöpäkudoksia Sekvensoidaan genomi ja haetaan (yhteisiä) eroja muuhun populaatioon

25 Next Generation Sequencing RNA-sekvensointi Mikrosirutekniikat selvittävät karkeasti RNA:n määrän Analyysistä uupuu Splice Variants, SNP, alleelispesifinen ekspressio RNA sekvensoinnissa sekvensoidaan lähes kaikki löydetyt RNA-sekvenssit Metagenomiikka Tutkitaan esim. mikrobipopulaatioita sekvensoimalla kaikki genominen DNA näytteestä

26 Suurien aineistojen yhdistely In-house gene expression data vs. gene expression data in web Gene expression data vs. protein-protein interaction data Large scale data comparisons across different species

27 Bioinformatiikan sovelluksia Taudinaiheuttajien tunnistus, mikrobidiagnostiikka Geneettinen neuvonta + Personalized Medicine Lääkeaineiden pää- ja sivuvaikutuksien vertailu Lääkeaineiden valinta (screening)..

28 Mitä tällä informaatiolla voi tehdä? Mihin bioinformatiikkaa tarvitsee? ESIM: Meksikossa puhkeaa vaarallinen virusepidemia Eristetään virus potilasnäytteistä ja sekvensoidaan sen perimä näyttää influenssavirukselta Etsitään viruksen sukulaisia - sekvenssirinnastus, fylogenia -> H1N1 Antaa tietoa siitä, mitä epidemialta voidaan odottaa, mitä muita taudinaiheuttajia ja tauteja se voisi muistuttaa? Miten virus on syntynyt? Epidemian seuranta Selvitetään viruksen tuottamat proteiinit - sekvenssirinnastus Miten virus pääsee soluun? Voitaisiinko sitä estää? Proteiinien rakenne Homologiamallinnus - miten tämä virus eroaa muista ja miksi se voi olla tappava? Lääkeainesuunnittelu? Mahdollisten rokotteeksi sopivien rakenteiden tunnistaminen Perustuu J.Tuimalan originaaleihin

29 Molekulaarinen fylogenetiikka Tutkija on hankkinut DNA-näytteitä joukosta hyljelajeja, ja sekvensoinut joitakin geenejä. Miten sekvenssijoukko on kehittynyt? Miten lajijoukko on kehittynyt? Millaisia yhteisiä piirteitä tiettyjen lajien genomeilla on? Perustuu J.Tuimalan originaaleihin

30 Hiivasoluille on annettu lämpöshokki käsittely. Mitkä geenit ekspressoituvat normaalitasoa voimakkaammin tai heikommin heti shokin jälkeen? Entä tunti, 2 tuntia sen jälkeen? Miten näiden geenien toiminta saattaisi liittyä toisiinsa (julkisissa tietokannoissa olevan tiedon perusteella - huomaa, että tämä on aivan liian laajaa käsin tutkittavaksi!) Geeniekspressioaineiston ryhmittelyanalyysi:

31 Lisää sovellusalueita Mitä samanlaisten geenisäätelytekijöiden sitoutumissekvenssejä keskenään samanaikaisesti ilmeneviltä geeneiltä löytyy? (Vaikkapa heat shockin jälkeen?)

32 Lisää sovellusalueita tai miten löytää DNA-sekvensseistä upouusia säätelytekijöitä, joista ei vielä edes tiedetä minkälaista sekvenssinpätkää ollaan etsimässä? Olet sekvensoinut DNA:ta tai jonkin proteiinin; sekvenssin tehtävä ei selviä itse sekvenssistä, se ei siis muistuta mitään ennestään tunnettua niin selvästi että erehtymisen vaaraa ei olisi. Mihin toisiin geeneihin/proteiineihin ja eliölajeihin sekvenssillä olisi vastaavuutta? Mitä nämä geenit/proteiinit tekevät? (Liikaa manuaalisesti tutkittavaksi!) Geenikartoituksen menetelmin on genomista löydetty tautigeenin todennäköisin sijaintialue, mutta tällä alueella on edelleen ainakin 30 eri geeniä, joista periaatteessa mikä tahansa voisi olla tautigeeni. Mitä nämä tunnetut geenit tekevät? Mikä tai mitkä niistä olisivat potentiaalisimpia tautiriskiin vaikuttavia geenejä?

33 Jokamiehen bioinformatiikkaa Sekvenssien rinnastus Sekvenssien haku tietokannasta sekvenssillä Sekvenssien haku avainsanojen avulla

34 Sekvenssien rinnastus Kahden sekvenssin rinnastus Kuinka samankaltaisia kaksi sekvenssiä ovat keskimäärin? Löytyykö sekvensseistä lyhyempiä samankaltaisia alueita, vaikka ne keskimäärin olisivat varsin erilaisia? Usean sekvenssin rinnastus Rinnastetaan monta sekvenssiä joilla sama funktio Löytyykö sekvensseistä yhteisiä, samankaltaisia alueita? Mahdollinen aktiivinen keskus Molekyylisystematiikka fylogenia

35 Sekvenssihaut Tietokantahaut Löytyykö sekvenssi tietokannasta asiasanahaulla? Esim. hemoglobin and human? Sekvenssihaut Mitä sekvenssejä tietokannasta löytyy, kun tiedossamme on ehkä vain pätkä sekvenssiä? ACGTACGTACGTCCCCAGTCTAGAG Perustuu J.Tuimalan originaaleihin

36 Muistakaa tämä Monet bioinformatiikan menetelmät tuottavat aina jotain tuloksia Tulokset täytyy varmistaa riippumattomalla menetelmällä Parhaassa tutkimuksessa laboratorio- ja bioinformatiikkamenetelmät tukevat toisiaan

37 Sekvenssirinnastus ja pisteytysmatriisit

38 Rinnastus (Alignment) Bioinformatiikan keskeisimpiä tehtäviä Keino selvittää kuinka samanlaisia kaksi sekvenssiä on Sekvenssit voivat olla proteiineja, DNA-alueita Rinnastus usein piilossa muiden tehtävien sisällä Eniten samanlaisten sekvenssien haku tietokannoista Monen sekvenssin rinnastus Onnistunut rinnastus on usein vaatimus muiden monimutkikkaampien tehtävien onnistumiselle Rinnastuksella siirretään usein tietoa sekvenssistä toiseen

39 Mitä on rinnastus? I Tarkoittaa sitä, että eri sekvensseissä samoilla kohdin olevat samanlaiset aminohapot tai nukleotidit asetetaan kohdakkain. Esimerkiksi ACGTACGT ACGTACGT ACGTACGT ACTACT AC-TACT AC-TAC-T Rinnastukseen voidaan lisätä aukkoja (gap, merkitään yleensä -, toisinaan myös.) siten, että samanlaiset aminohapot tai nukleotidit osuvat kohdakkain. Perustuu J.Tuimalan originaaleihin

40 Mitä on rinnastus II Rinnastuksella pyritään siis asettamaan sekvenssien samankaltaiset alueet kohdakkain. Tällä tavalla pyritään löytämään eri sekvensseissä olevia homologisia alueita. Samankaltaisuus (yleisesti) Mistä tahansa syystä johtuva kahden sekvenssin samanlainen tai samantapainen rakenne Homologia Sekvenssien evolutiivisista suhteista johtuva samankaltaisuus. Samankaltaisuus johtuu siis siitä, että eri sekvenssit periytyvät yhteisestä kantamuodosta. Perustuu J.Tuimalan originaaleihin

41 Rinnastaminen Mikä seuraavista on paras rinnastus? ACGTACGT ACGTACGT ACGTACGT ACTACT AC-TAC-T A-CTAC-T Kuinka samankaltaisia eri nukleotidit ovat? Miten luoduista aukoista rankaistaan? Tarvitaan jokin pisteytystapa Pisteytysmatriisi! (Engl. scoring matrix tai substitution matrix) Perustuu J.Tuimalan originaaleihin

42 Pisteytysmatriisi = Substituutiomatriisi Taulukko, jossa kerrotaan aminohappojen tai nukleotidien muutosfrekvenssit (tai muutostodennäköisyydet) Kuvastaa aminohapoilla myös sitä kuinka samanlainen kyseinen pari on ominaisuuksiltaan. Lisäksi tarvitaan joku pisteytys rinnastuksen aukoille (aukkosakkoparametrit)

43 Esim: DNA-pisteytysmatriisit Identity matrix A T C G A T C G Suom. yksikkö- eli identiteettimatriisi BLAST matrix A T C G A T C G

44 DNA-pisteytysmatriisit Transition transversion matrix A T C G A T C G Aukkosakkoparametrit: -16 aukon avaamiselle ja -4 jatkamiselle.

45 Miten lasketaan rinnastuksen pistemäärä? ACGTACGT ACGTACGT ACGTACGT ACTACT AC-TAC-T A-CTAC-T Rinnastus 2: ACGTACGT AC-TAC-T Transitio-transversio-matriisi: A +1 C +1 Huomaa: Aukosta T +1 sakotetaan A pistettä C T +1 Yht =-26

46 Rinnastusten 1 ja 3 pistemäärät? Mikä rinnastus on paras (tällä pisteytysmatriisilla ja aukkosakoilla)?

47 Pisteytysmatriisit Kaikki pisteytysmatriisit ovat yrityksiä kvantifioida evolutiivisten muutoksien tapahtumistodennäköisyyksiä DNA:lle ja aminohapoille on OMAT pisteytysmatriisinsa Joidenkin aminohappojen säilyminen samana on proteiinin rakenteen (ja niinmuodoin funktion) säilymisen kannalta tärkeämpää kuin toisten siksi isompi sakko muuttumiselle! Aminohappojen pisteytysmatriisit yrittävät kertoa siitä, josko tietty mutaatio säilyttää tai muuttaa (tuhoaa) proteiinin funktion Mutaatio voi vaikuttaa myös proteiinin rakenteeseen Useimmiten symmetrisiä, toisinaan epäsymmetrisiä. symmetrisyys: muutoksen todennäköisyys on kumpaankin suuntaan sama P(Ala -> Cys) = P(Cys -> Ala) Perustuu J.Tuimalan originaaleihin

48 Matriisien käyttötarkoitukset? Kahden sekvenssin rinnastamisessa, mutta myös... Tietokantahauissa (BLAST) Molekyylisystematiikassa Sekvenssien välisten etäisyyksien laskeminen (proteiinit) Pisteytysmatriiseja aminohapoille: PAM, Blosum, JTT DNA:lle: IUB (osuma 1.9, huti 0) Rinnastukset tehdään nykyisin tietokoneella Aminohappojen pisteytysmatriisit perustuvat niiden muodostamiin ryhmiin Perustuu J.Tuimalan originaaleihin

49 Aminohapporyhmät (huomaa virhe!) Aminohappojen samankaltaisuus perustuu niiden muodostamiin ryhmiin Saman ryhmän jäsenet korvaavat usein toisiaan proteiinisekvenssissä

50 Otetaas uusiksi:

51 Aminohappomatriisit Aminohappomatriisit pyrkivät esittämään aminohappojen edellä näytettyjä samankaltaisuuksia Kaksi käytetyintä matriisi-ryhmää: PAM-matriisit BLOSUM-matriisit

52 Blosum62-matriisi Aukon avaamissakko 12 ja jatkamissakko 4 toimivat suhteellisen hyvin.

53 PAM250-matriisi

54 Aminohappomatriisit PAM-matriisien numeroarvo ilmoittaa matriisin point accepted mutation-arvon (seuraavalla kalvolla tästä lisää), joka ei vastaa tismalleen sekvenssien erilaisuutta prosentteina, mutta on sinne päin. BLOSUM-matriisien numeroarvo ilmoittaa sen sekvenssijoukon samankaltaisuuden, jonka pohjalta matriisi on muodostettu. Perustuu J.Tuimalan originaaleihin

55 Näkyvien sekvenssieroavaisuuksien suhde PAM-lukuun Perustuu J.Tuimalan originaaleihin

56 PAM-matriisit PAM matriisit perustuvat sekvenssien linjauksista tehtyihin puihin. Puussa sekvenssejä vertaillaan puun rakenteessa ja seurataan kuinka aminohapot muuttuvat (linkki 1) Tämä matriisien muodostus keskittyy erityisesti muutoksiin lähinaapureiden välillä Perustuu J.Tuimalan originaaleihin

57 BLOSUM-matriisit BLOSUM-matriisit perustuvat aukottomiin sekvenssien linjauksiin Aminohappojen muutoksia ei rajata lähinaapureiden välille. Jokainen sekvenssi voi muuttua miksi tahansa toiseksi sekvenssiksi Tämä matriisien muodostus painottaa enemmän kaukaisten sukulaisten välisiin samankaltaisuuksiin Perustuu J.Tuimalan originaaleihin

58 Aminohappomatriisit Kun rinnastetaan sekvenssejä tai muodostetaan fylogeneettisiä puita, tulee valita tilanteeseen sopiva matriisi. Esimerkiksi PAM50-matriisia tulisi käyttää 40% samankaltaisten sekvenssien rinnastamiseen. (kts. aikaisempi kuvaaja) Vastaavasti BLOSUM40-matriisia tulisi käyttää 40% samankaltaisten sekvenssien rinnastamiseen. Perustuu J.Tuimalan originaaleihin

59 Aminohappomatriisit Miten voi tietää sekvenssien samankaltaisuuden jo ennen niiden rinnastamista? Rinnastus ei ole objektiivista (aloitetaan akateemisella arvauksella :) Menetelmä vaatii useinkin kokeilemista erilaisilla asetuksilla tai matriiseilla. Haittaako, jos sekvenssijoukossa on kovin erilaisia sekvenssejä? Luultavasti, mutta sellaisten rinnastamiseen on tiettyjä menetelmiä, jolla ongelma voidaan kiertää. Perustuu J.Tuimalan originaaleihin

60

61 Yhteenveto rinnastuksesta Rinnastuksen tulos riippuu käytetystä pisteytysmatriisista. Valitse matriisi joka sopii hyvin tutkituille sekvensseille Sekvenssien samankaltaisuus keskeinen tekijä Perustuu J.Tuimalan originaaleihin

62 Yhteenveto rinnastuksesta Rinnastus pyrkii sijoittamaan sekvenssien toisiaan vastaavat alueet päällekkäin Rinnastuksen tulos riippuu siitä mitkä aminohapot arvioidaan keskenään samanlaisiksi Rinnastusalgoritmit käyttävät pisteytysmatriiseja, jotka arvioivat aminohappojen samankaltaisuutta. Perustuu J.Tuimalan originaaleihin

63 Ylimääräiset kalvot Luentokokonaisuuksien lopussa on kalvoja jotka olen jättänyt pois Usein näissä on silti hyödyllistä tietoa. Näitä ei käydä luennoilla Perustuu J.Tuimalan originaaleihin

64 Mistä pisteytysmatriisit tulevat? Empiiriset pisteytysmatriisit: Tietyn verran toisistaan eroavia proteiinisekvenssijoukkoja käyttäen on määritetty aminohappojen todennäköisyydet muuttua toisikseen log odds matriisi Perustuu J.Tuimalan originaaleihin

65 Matriisin muodostaminen II Empiiristen matriisien lähtömateriaalit PAM (1978) Evolutiivinen malli (puu) taustalla, 71 proteiiniryhmää BLOSUM (1992) BLOCKS-tietokanta GONNET (1992) Koko sekvenssitietokannan rinnastus JTT (1992) Evolutiivinen malli (puu) taustalla, mutta muodostamiseen käytetty suurempaa aineistoa kuin PAM-matriisien muodostamiseen Perustuu J.Tuimalan originaaleihin

66 Esim. PAM-matriisien muodostaminen PAM = percent accepted mutation Proteiinit etääntyvät (muuttuvat) alkuperäissekvenssistä siten, että niihin kerääntyy mutaatioita. Mutaatiot ovat sellaisia, että luonnonvalinta ei ole niitä karsinut, ja niitä voi siis löytyä populaatiosta. Tällaiset mutaatiot ovat niin sanotusti hyväksyttyjä (accepted). Mutaatioita tarkastellaan irrallaan niiden ympäristöstä ja historiasta. Perustuu J.Tuimalan originaaleihin

67 Esim. PAM-matriisien muodostaminen PAM on yksi kahden sekvenssin välillä tapahtunut hyväksytty pistemutaatio sataa aminohappoa kohden. Tietyt aminohappokohdat ovat voineet muuttua enemmän kuin kerran, mutta kahta sekvenssiä tarkasteltaessa voidaan kuitenkin aina havaita vain yksi muutos. Tällöin kahden sekvenssin välinen etäisyys on oikeasti suurempi kuin havaittujen muutosten määrä. Tämä täytyy ottaa ja otetaankin huomioon! Perustuu J.Tuimalan originaaleihin

68 Esim. PAM-matriisien muodostaminen PAM-matriisin muodostaminen alkaa fylogeneettisen puun piirtämisellä. Dayhoff et. al valitsivat proteiineja, joiden samankaltaisuus oli 85% tai enemmän, jotta useilta muutoksilta samassa kohdassa vältyttäisiin. Koska sekvenssit ovat suhteellisen samankaltaisia, on fylogeneettisen puunkin piirtäminen jokseenkin helppoa. Puun perusteella voidaan identifioida ja laskea hyväksytyt muutokset. Perustuu J.Tuimalan originaaleihin

69 Esim. PAM-matriisien muodostaminen Kun tiedetään Muutosten suunta (puu) Muutosten määrä Sekvenssien pituudet voidaan laskea matriisi, joka kuvaa muutostodennäköisyyksiä tai oikeammin niiden suhteita: kuinka tod.näk. tietty muutos on verrattuna kaikkiin ko. aminohapolle tapahtuneisiin muutoksiin Perustuu J.Tuimalan originaaleihin

70 Log odds-matriisi: Muutostodennäköisyyksien suhteista otetaan vielä logaritmi: p (0.02) <=> log 2 (0.02) <=> -5.6 ~ -6 P (2) <=> log 2 (2) <=> 1 ~ 1 Jos käytetään 2-kantaista logaritmia -> bittejä Usein käytetään myös ln(2)/3 = log10(2)/3 Engl. Scale Log odds-matriisi on siis sama asia kuin pisteytysmatriisi, esimerkiksi PAM250! Perustuu J.Tuimalan originaaleihin

71 Blosum Blosum-matriisien taustalla ei ole oletusta (puuta) sekvenssien evoluutiosta Muodostettu Blocks-tietokannassa olevien proteiinien konservoituneiden alueiden avulla Muutostodennäköisyydet laskettu olettaen, että muutos voi tapahtua mistä sekvenssistä miksi sekvenssiksi tahansa. Perustuu J.Tuimalan originaaleihin

72 Mikä on algoritmi? Perustuu J.Tuimalan originaaleihin

73 Algoritmi I Algoritmi on se joukko toimenpiteitä, joilla jokin haluttu (tai annettu) tehtävä saadaan suoritettua. Miten neuvoisit kaveriasi tulemaan Rautatieasemalta Biokeskukseen? Tule osoitteeseen Viikinkaari 9 A. Olettaa, että kaverisi osaa lukea karttaa. Ota taksi, ja aja osoitteeseen Viikinkaari 9 A. Kallis opintotuella elävälle kaverillesi. Perustuu J.Tuimalan originaaleihin

74 Algoritmi II Tarkennettu ohje voisi olla seuraavanlainen: Valitse seuraavista: Jos kellonaika on välillä 7-20: - kävele Rautatientorille - nouse bussiin 68 Jos sinulla on rahaa tai saat kimpan: - ota taksi. Mikäli ei rahaa tai haluat ulkoilla - kävele. Perustuu J.Tuimalan originaaleihin

75 Algoritmi III Käytännössä algoritmi on sijoitettu tietokoneohjelman osaksi. Yhdessä tietokoneohjelmassa voi olla useita algoritmeja. Algoritmien yhteistoiminta ratkaisee varsinaisen ongelman. Tämän jälkeen algoritmien ympärille kyhätty ohjelma (käyttöliittymä ja muut osaset) ilmoittaa tuloksen käyttäjälle sopivassa muodossa. Perustuu J.Tuimalan originaaleihin

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan?

Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? Ongelma(t): Miten merkkijonoja voidaan hakea tehokkaasti? Millaisia hakuongelmia liittyy bioinformatiikkaan? 2012-2013 Lasse Lensu 2 Ihmisen, eläinten ja kasvien hyvinvoinnin kannalta nykyaikaiset mittaus-,

Lisätiedot

Sekvenssien rinnastus. Rinnastus: helppoa tai vaikeaa

Sekvenssien rinnastus. Rinnastus: helppoa tai vaikeaa Sekvenssien rinnastus Rinnastus: helppoa tai vaikeaa Kaksi tai useampia (DNA tai proteiini) sekvenssejä: miten samankaltaisia sekvenssit ovat missä sekvenssikohdissa samankaltaisuutta esiintyy Kattava

Lisätiedot

Bioinformatiikan perusteet

Bioinformatiikan perusteet Bioinformatiikan perusteet Bioinformatiikan perusteet Jarno Tuimala Tieteen tietotekniikan keskus CSC Tämän teoksen tekijänoikeudet kuuluvat Jarno Tuimalalle ja Tieteellinen Laskenta Oy:lle. Teoksen tai

Lisätiedot

2. luento Kahden sekvenssin rinnastus

2. luento Kahden sekvenssin rinnastus 2. luento Kahden sekvenssin rinnastus Miksi rinnastusta opetetaan Keskeisintä bioinformatiikkaa Voidaan päätellä: konservoituneita alueita pistemutaatioita lajien tai geenien evolutiivisia suhteita Osa

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä

Evoluutio ja luominen. Mian tekemä esitys Jannen esittämänä Evoluutio ja luominen Mian tekemä esitys Jannen esittämänä Väite: tiedemiehet ovat todistaneet evoluutioteorian todeksi Evoluutioteorialla tässä tarkoitan teoriaa, jonka mukaan kaikki elollinen on kehittynyt

Lisätiedot

Matemaatikot ja tilastotieteilijät

Matemaatikot ja tilastotieteilijät Matemaatikot ja tilastotieteilijät Matematiikka/tilastotiede ammattina Tilastotiede on matematiikan osa-alue, lähinnä todennäköisyyslaskentaa, mutta se on myös itsenäinen tieteenala. Tilastotieteen tutkijat

Lisätiedot

Evoluutiopuu. Aluksi. Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot. Luokkataso: 6.-9. luokka, lukio

Evoluutiopuu. Aluksi. Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot. Luokkataso: 6.-9. luokka, lukio Evoluutiopuu Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot Luokkataso: 6.-9. luokka, lukio Välineet: loogiset palat, paperia, kyniä Kuvaus: Tehtävässä tutkitaan bakteerien evoluutiota.

Lisätiedot

Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa

Lisätiedot

Johdatus tekoälyyn. Luento 6.10.2011: Koneoppiminen. Patrik Hoyer. [ Kysykää ja kommentoikaa luennon aikana! ]

Johdatus tekoälyyn. Luento 6.10.2011: Koneoppiminen. Patrik Hoyer. [ Kysykää ja kommentoikaa luennon aikana! ] Johdatus tekoälyyn Luento 6.10.2011: Koneoppiminen Patrik Hoyer [ Kysykää ja kommentoikaa luennon aikana! ] Koneoppiminen? Määritelmä: kone = tietokone, tietokoneohjelma oppiminen = ongelmanratkaisukyvyn

Lisätiedot

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien

Lisätiedot

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...

Lisätiedot

VIIKKI BIOCENTER University of Helsinki

VIIKKI BIOCENTER University of Helsinki VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja

Lisätiedot

Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

Kombinatorinen optimointi

Kombinatorinen optimointi Kombinatorinen optimointi Sallittujen pisteiden lukumäärä on äärellinen Periaatteessa ratkaisu löydetään käymällä läpi kaikki pisteet Käytännössä lukumäärä on niin suuri, että tämä on mahdotonta Usein

Lisätiedot

Laskennallinen menetelmä puun biomassan ja oksien kokojakauman määrittämiseen laserkeilausdatasta

Laskennallinen menetelmä puun biomassan ja oksien kokojakauman määrittämiseen laserkeilausdatasta Laskennallinen menetelmä puun biomassan ja oksien kokojakauman määrittämiseen laserkeilausdatasta Pasi Raumonen, Mikko Kaasalainen ja Markku Åkerblom Tampereen teknillinen ylipisto, Matematiikan laitos

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä

Lisätiedot

Bioinformatiikan perusteet

Bioinformatiikan perusteet Bioinformatiikan perusteet Bioinformatiikan perusteet Jarno Tuimala Tieteen tietotekniikan keskus CSC Tämän teoksen tekijänoikeudet kuuluvat Jarno Tuimalalle ja Tieteellinen Laskenta OY:lle. Teoksen tai

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Tuotantoeläinten jalostus ja geenitekniikka

Tuotantoeläinten jalostus ja geenitekniikka Tuotantoeläinten jalostus ja geenitekniikka Esa Mäntysaari Professori, Biometrinen Genetiikka Biotekniikka- ja elintarviketutkimus Maa- ja elintarviketalouden tutkimus MTT Tänään: Eläinjalostus eristyisesti

Lisätiedot

1 Kannat ja kannanvaihto

1 Kannat ja kannanvaihto 1 Kannat ja kannanvaihto 1.1 Koordinaattivektori Oletetaan, että V on K-vektoriavaruus, jolla on kanta S = (v 1, v 2,..., v n ). Avaruuden V vektori v voidaan kirjoittaa kannan vektorien lineaarikombinaationa:

Lisätiedot

Fysiikan opinnot Avoimen yliopiston opiskelijoille

Fysiikan opinnot Avoimen yliopiston opiskelijoille Fysiikan opinnot Avoimen yliopiston opiskelijoille Fysiikan laitos / Pia Saarinen www.helsinki.fi/yliopisto 4.9.2013 1 Fysiikan perusopinnot, 25 op - kokonaisuutena tai yksittäisinä kursseina 530281 Vuorovaikutukset

Lisätiedot

CSC:n käyttäjätunnukset - myös opiskelijoille

CSC:n käyttäjätunnukset - myös opiskelijoille CSC:n käyttäjätunnukset - myös opiskelijoille http://www.csc.fi/asiakkaaksi/korkeakoulut/kayttol upahakemukset/index_html Ohjaajan nimeksi Petri Törönen Perusteluiksi opiskelu ja luentokurssin nimi (Geneettisen

Lisätiedot

17/20: Keittokirja IV

17/20: Keittokirja IV Ohjelmointi 1 / syksy 2007 17/20: Keittokirja IV Paavo Nieminen nieminen@jyu.fi Tietotekniikan laitos Informaatioteknologian tiedekunta Jyväskylän yliopisto Ohjelmointi 1 / syksy 2007 p.1/10 Tavoitteita

Lisätiedot

Darwin: Tutkimusprojektin esittely

Darwin: Tutkimusprojektin esittely 1 Darwin: Tutkimusprojektin esittely Tutkimusongelma: voidaanko ohjelmistoarkkitehtuuri generoida automaattisesti? Suomen Akatemian rahoittama tutkimusprojekti 2009-2011 TTY & TaY yhteistyö Ks. http://practise.cs.tut.fi/project.php?project=darwin

Lisätiedot

Tarkastelen suomalaisen taloustieteen tutkimuksen tilaa erilaisten julkaisutietokantojen avulla. Käytän myös kerättyjä tietoja yliopistojen

Tarkastelen suomalaisen taloustieteen tutkimuksen tilaa erilaisten julkaisutietokantojen avulla. Käytän myös kerättyjä tietoja yliopistojen 1 2 3 Tarkastelen suomalaisen taloustieteen tutkimuksen tilaa erilaisten julkaisutietokantojen avulla. Käytän myös kerättyjä tietoja yliopistojen opettajien tutkimusalueista. 4 Kuviossa 1 esitetään kansantaloustieteen

Lisätiedot

v 8 v 9 v 5 C v 3 v 4

v 8 v 9 v 5 C v 3 v 4 Verkot Verkko on (äärellinen) matemaattinen malli, joka koostuu pisteistä ja pisteitä toisiinsa yhdistävistä viivoista. Jokainen viiva yhdistää kaksi pistettä, jotka ovat viivan päätepisteitä. Esimerkiksi

Lisätiedot

Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen

Lisätiedot

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow

Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta. Hannu Sariola, Irma Thesleff ja Marja Makarow Genomi Hiiriä, hiivoja ja kärpäsiä mitä malliorganismien geenit kertovat elämästä ja sen evoluutiosta Hannu Sariola, Irma Thesleff ja Marja Makarow Malliorganismeiksi kutsutaan lajeja, joita tutkijat käyttävät

Lisätiedot

Koiran periytyvä persoonallisuus

Koiran periytyvä persoonallisuus Koiran periytyvä persoonallisuus Katriina Tiira, FT, Koirangeenit tutkimusryhmä, HY & Folkhälsan, Eläinten hyvinvoinnin tutkimuskeskus Periytyykö käyttäytyminen? Kaikki yksilön kokemukset kohtuajasta eteenpäin=

Lisätiedot

Matematiikka ja teknologia, kevät 2011

Matematiikka ja teknologia, kevät 2011 Matematiikka ja teknologia, kevät 2011 Peter Hästö 3. helmikuuta 2011 Matemaattisten tieteiden laitos Sisältö Kurssi koostuu kuudesta (seitsemästä) toisistaan riippumattomasta luennosta. Aihepiirit ovat:

Lisätiedot

Helsingin, Itä-Suomen, Jyväskylän, Oulun, Tampereen ja Turun yliopisto Matematiikan valintakoe 11.6.2012 klo 10 13 Ratkaisut ja pisteytysohjeet

Helsingin, Itä-Suomen, Jyväskylän, Oulun, Tampereen ja Turun yliopisto Matematiikan valintakoe 11.6.2012 klo 10 13 Ratkaisut ja pisteytysohjeet Helsingin, Itä-Suomen, Jyväskylän, Oulun, Tampereen ja Turun yliopisto Matematiikan valintakoe 11.6.01 klo 10 13 t ja pisteytysohjeet 1. Ratkaise seuraavat yhtälöt ja epäyhtälöt. (a) 3 x 3 3 x 1 4, (b)

Lisätiedot

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin?

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? 26.3.2015 Kalaterveyspäivät, Tampere Krister Sundell Akvaattisen patobiologian laboratorio Åbo Akademi Flavobacterium psychrophilum Aiheuttaa

Lisätiedot

Tietorakenteet ja algoritmit - syksy 2015 1

Tietorakenteet ja algoritmit - syksy 2015 1 Tietorakenteet ja algoritmit - syksy 2015 1 Tietorakenteet ja algoritmit - syksy 2015 2 Tietorakenteet ja algoritmit Johdanto Ari Korhonen Tietorakenteet ja algoritmit - syksy 2015 1. JOHDANTO 1.1 Määritelmiä

Lisätiedot

E. Oja ja H. Mannila Datasta Tietoon: Luku 2

E. Oja ja H. Mannila Datasta Tietoon: Luku 2 2. DATASTA TIETOON: MITÄ DATAA; MITÄ TIETOA? 2.1. Data-analyysin ongelma Tulevien vuosien valtava haaste on digitaalisessa muodossa talletetun datan kasvava määrä Arvioita: Yhdysvaltojen kongressin kirjasto

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Tietorakenteet ja algoritmit Johdanto Lauri Malmi / Ari Korhonen

Tietorakenteet ja algoritmit Johdanto Lauri Malmi / Ari Korhonen Tietorakenteet ja algoritmit Johdanto Lauri Malmi / Ari 1 1. JOHDANTO 1.1 Määritelmiä 1.2 Tietorakenteen ja algoritmin valinta 1.3 Algoritmit ja tiedon määrä 1.4 Tietorakenteet ja toiminnot 1.5 Esimerkki:

Lisätiedot

Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt.

Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt. Kotieläinten geenien säilytys Suomessa: miten eteenpäin? Professori Juha Kantanen MTT Biotekniikka- ja elintarviketutkimus juha.kantanen@mtt.fi Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari

Lisätiedot

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä Matti Pirinen Suomen molekyylilääketieteen instituutti (FIMM) Helsingin Yliopisto 17.2.2015 Tilastollisen päättelyn kurssi Kumpula Sisältö

Lisätiedot

Luku 21. Evoluution perusteet

Luku 21. Evoluution perusteet 1. Evoluutio käsitteenä a. Mitä käsite evoluutio tarkoittaa? b. Miten evoluutiota tapahtuu? c. Mitkä ovat evoluution päämääriä? 2. Evoluution todisteita Mitä seuraavat evoluution todisteet osoittavat evoluutiosta?

Lisätiedot

Alkuraportti. LAPPEENRANNAN TEKNILLINEN YLIOPISTO TIETOJENKÄSITTELYN LAITOS CT10A4000 - Kandidaatintyö ja seminaari

Alkuraportti. LAPPEENRANNAN TEKNILLINEN YLIOPISTO TIETOJENKÄSITTELYN LAITOS CT10A4000 - Kandidaatintyö ja seminaari LAPPEENRANNAN TEKNILLINEN YLIOPISTO TIETOJENKÄSITTELYN LAITOS CT10A4000 - Kandidaatintyö ja seminaari Alkuraportti Avoimen lähdekoodin käyttö WWW-sovelluspalvelujen toteutuksessa Lappeenranta, 30.3.2008,

Lisätiedot

Radiologisen fysiikan ja säteilysuojelun kurssi radiologiaan erikoistuville lääkäreille 23.8. - 26.8.2016. Ohjelma

Radiologisen fysiikan ja säteilysuojelun kurssi radiologiaan erikoistuville lääkäreille 23.8. - 26.8.2016. Ohjelma Radiologisen fysiikan ja säteilysuojelun kurssi radiologiaan erikoistuville lääkäreille 23.8. - 26.8.2016 Ohjelma Paikka: Kuopion Yliopistollinen Sairaala, Auditorio I Luennoitsija Ti 23.8.16 8.30 9.00

Lisätiedot

Tiedonhallinnan perusteet. Viikko 1 Jukka Lähetkangas

Tiedonhallinnan perusteet. Viikko 1 Jukka Lähetkangas Tiedonhallinnan perusteet Viikko 1 Jukka Lähetkangas Kurssilla käytävät asiat Tietokantojen toimintafilosofian ja -tekniikan perusteet Tiedonsäilönnän vaihtoehdot Tietokantojen suunnitteleminen internetiä

Lisätiedot

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten

Lisätiedot

Helsingin, Itä-Suomen, Jyväskylän, Oulun, Tampereen ja Turun yliopisto Matematiikan valintakoe 10.6.2013 klo 10-13 Ratkaisut ja pisteytysohjeet

Helsingin, Itä-Suomen, Jyväskylän, Oulun, Tampereen ja Turun yliopisto Matematiikan valintakoe 10.6.2013 klo 10-13 Ratkaisut ja pisteytysohjeet Helsingin, Itä-Suomen, Jyväskylän, Oulun, Tampereen ja Turun yliopisto Matematiikan valintakoe.6. klo - Ratkaisut ja pisteytysohjeet. Ratkaise seuraavat epäyhtälöt ja yhtälö: a) x+ x +9, b) log (x) 7,

Lisätiedot

Tervetuloa opiskelemaan DIGITAALI- TEKNIIKKAA! Digitaalitekniikan matematiikka Luku 0 Sivu 1 (9)

Tervetuloa opiskelemaan DIGITAALI- TEKNIIKKAA! Digitaalitekniikan matematiikka Luku 0 Sivu 1 (9) Tervetuloa opiskelemaan DIGITAALI- TEKNIIKKAA! Digitaalitekniikan matematiikka Luku 0 Sivu 1 (9) Digitaalitekniikan matematiikka Luku 0 Sivu 2 (9) Yleistä opintojaksosta Laajuus 3 op = 80 h, kokonaan lukukauden

Lisätiedot

Radiologisten tutkimusten ja toimenpiteiden lukumäärien keskitetty kerääminen nykymalli ja toiveet tulevasta

Radiologisten tutkimusten ja toimenpiteiden lukumäärien keskitetty kerääminen nykymalli ja toiveet tulevasta Radiologisten tutkimusten ja toimenpiteiden lukumäärien keskitetty kerääminen nykymalli ja toiveet tulevasta Terveydenhuollon röntgentoiminnan asiantuntijoiden neuvottelupäivät 13.-14.4.2015, Siikaranta,

Lisätiedot

Suomalaisen maatiaiskanan säilytysohjelman koulutuspäivä, Riihimäki, 25.10.2014 Pasi Hellstén

Suomalaisen maatiaiskanan säilytysohjelman koulutuspäivä, Riihimäki, 25.10.2014 Pasi Hellstén Suomalaisen maatiaiskanan säilytysohjelman koulutuspäivä, Riihimäki, 25.10.2014 Pasi Hellstén Sisäsiittoisuudella tarkoitetaan perinnöllisyystieteessä lisääntymistä, jossa pariutuvat yksilöt ovat enemmän

Lisätiedot

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä

Lisätiedot

TIEDONHAKU INTERNETISTÄ

TIEDONHAKU INTERNETISTÄ TIEDONHAKU INTERNETISTÄ Internetistä löytyy hyvin paljon tietoa. Tietoa ei ole mitenkään järjestetty, joten tiedonhaku voi olla hankalaa. Tieto myös muuttuu jatkuvasti. Tänään tehty tiedonhaku ei anna

Lisätiedot

Rutto ja muut zoonoosit ihmiskunnan historiassa

Rutto ja muut zoonoosit ihmiskunnan historiassa Rutto ja muut zoonoosit ihmiskunnan historiassa Heikki S. Vuorinen LKT, lääketieteen historian dosentti Tampereen yliopisto ja Helsingin yliopisto heikki.vuorinen@helsinki.fi RUTON LEVINNEISYYS KÄSITYS

Lisätiedot

110. 111. 112. 113. 114. 4. Matriisit ja vektorit. 4.1. Matriisin käsite. 4.2. Matriisialgebra. Olkoon A = , B = Laske A + B, 5 14 9, 1 3 3

110. 111. 112. 113. 114. 4. Matriisit ja vektorit. 4.1. Matriisin käsite. 4.2. Matriisialgebra. Olkoon A = , B = Laske A + B, 5 14 9, 1 3 3 4 Matriisit ja vektorit 4 Matriisin käsite 42 Matriisialgebra 0 2 2 0, B = 2 2 4 6 2 Laske A + B, 2 A + B, AB ja BA A + B = 2 4 6 5, 2 A + B = 5 9 6 5 4 9, 4 7 6 AB = 0 0 0 6 0 0 0, B 22 2 2 0 0 0 6 5

Lisätiedot

Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016

Lisätiedot

Opetusmateriaali. Fermat'n periaatteen esittely

Opetusmateriaali. Fermat'n periaatteen esittely Opetusmateriaali Fermat'n periaatteen esittely Hengenpelastajan tehtävässä kuvataan miten hengenpelastaja yrittää hakea nopeinta reittiä vedessä apua tarvitsevan ihmisen luo - olettaen, että hengenpelastaja

Lisätiedot

Tilastotieteen jatkokurssi syksy 2003 Välikoe 2 11.12.2003

Tilastotieteen jatkokurssi syksy 2003 Välikoe 2 11.12.2003 Nimi Opiskelijanumero Tilastotieteen jatkokurssi syksy 2003 Välikoe 2 11.12.2003 Normaalisti jakautuneiden yhdistyksessä on useita tuhansia jäseniä. Yhdistyksen sääntöjen mukaan sääntöihin tehtävää muutosta

Lisätiedot

Luku 2. Datasta tietoon: mitä dataa? mitä tietoa?

Luku 2. Datasta tietoon: mitä dataa? mitä tietoa? 1 / 14 Luku 2. Datasta tietoon: mitä dataa? mitä tietoa? T-61.2010 Datasta tietoon, syksy 2011 professori Erkki Oja Tietojenkäsittelytieteen laitos, Aalto-yliopisto 31.10.2011 2 / 14 Tämän luennon sisältö

Lisätiedot

KEESHONDIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,

Lisätiedot

Ei välttämättä, se voi olla esimerkiksi Reuleaux n kolmio:

Ei välttämättä, se voi olla esimerkiksi Reuleaux n kolmio: Inversio-ongelmista Craig, Brown: Inverse problems in astronomy, Adam Hilger 1986. Havaitaan oppositiossa olevaa asteroidia. Pyörimisestä huolimatta sen kirkkaus ei muutu. Projisoitu pinta-ala pysyy ilmeisesti

Lisätiedot

r = 0.221 n = 121 Tilastollista testausta varten määritetään aluksi hypoteesit.

r = 0.221 n = 121 Tilastollista testausta varten määritetään aluksi hypoteesit. A. r = 0. n = Tilastollista testausta varten määritetään aluksi hypoteesit. H 0 : Korrelaatiokerroin on nolla. H : Korrelaatiokerroin on nollasta poikkeava. Tarkastetaan oletukset: - Kirjoittavat väittävät

Lisätiedot

Kurssilla esitetään lyhyt katsaus niihin todennäköisyyden ja satunnaisprosessien peruskäsitteisiin ja -ominaisuuksiin, joita tarvitaan digitaalisten

Kurssilla esitetään lyhyt katsaus niihin todennäköisyyden ja satunnaisprosessien peruskäsitteisiin ja -ominaisuuksiin, joita tarvitaan digitaalisten Todennäköisyys Kurssilla esitetään lyhyt katsaus niihin todennäköisyyden ja satunnaisprosessien peruskäsitteisiin ja -ominaisuuksiin, joita tarvitaan digitaalisten tietoliikennejärjestelmien ymmärtämisessä

Lisätiedot

GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus

GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus GENOMINEN VALINTA HEVOSJALOSTUKSESSA Markku Saastamoinen MTT Hevostutkimus Genominen valinta genomisessa valinnassa eläimen jalostusarvo selvitetään DNA:n sisältämän perintöaineksen tiedon avulla Genomi

Lisätiedot

SUBSTANTIIVIT 1/6. juttu. joukkue. vaali. kaupunki. syy. alku. kokous. asukas. tapaus. kysymys. lapsi. kauppa. pankki. miljoona. keskiviikko.

SUBSTANTIIVIT 1/6. juttu. joukkue. vaali. kaupunki. syy. alku. kokous. asukas. tapaus. kysymys. lapsi. kauppa. pankki. miljoona. keskiviikko. SUBSTANTIIVIT 1/6 juttu joukkue vaali kaupunki syy alku kokous asukas tapaus kysymys lapsi kauppa pankki miljoona keskiviikko käsi loppu pelaaja voitto pääministeri päivä tutkimus äiti kirja SUBSTANTIIVIT

Lisätiedot

Tähtitieteen käytännön menetelmiä Kevät 2009

Tähtitieteen käytännön menetelmiä Kevät 2009 Tähtitieteen käytännön menetelmiä Kevät 2009 2009-01-12 Yleistä Luennot Luennoija hannu.p.parviainen@helsinki.fi Aikataulu Observatoriolla Maanantaisin 10.00-12.00 Ohjattua harjoittelua maanantaisin 9.00-10.00

Lisätiedot

LUOMINEN JA EVOLUUTIO

LUOMINEN JA EVOLUUTIO LUOMINEN JA EVOLUUTIO Maailman syntyminen on uskon asia Evoluutioteoria Luominen Teoria, ei totuus Lähtökohta: selittää miten elollinen maailma olisi voinut syntyä, jos mitään yliluonnollista ei ole Ei

Lisätiedot

Tietokoneohjelmien käyttö laadullisen aineiston analyysin apuna

Tietokoneohjelmien käyttö laadullisen aineiston analyysin apuna Tietokoneohjelmien käyttö laadullisen aineiston analyysin apuna Laadullinen, verbaalinen, tulkinnallinen aineisto kootaan esimerkiksi haastattelemalla, videoimalla, ääneenpuhumalla nauhalle, yms. keinoin.

Lisätiedot

Ihmisten erilaisuuden geneettinen perusta

Ihmisten erilaisuuden geneettinen perusta hmisten erilaisuuden geneettinen perusta etter ortin hmisen genomin tutkimus on astunut uuteen vaiheeseen kun on alettu tutkia ihmisen geneettisen monimuotoisuuden määrää ja laatua. seita tätä tutkimushanketta

Lisätiedot

SAS-ohjelmiston perusteet 2010

SAS-ohjelmiston perusteet 2010 SAS-ohjelmiston perusteet 2010 Luentorunko/päiväkirja Ari Virtanen 11.1.10 päivitetään luentojen edetessä Ilmoitusasioita Opintojakso suoritustapana on aktiivinen osallistuminen harjoituksiin ja harjoitustehtävien

Lisätiedot

Grid-hankkeita ja tulevaisuuden näkymiä

Grid-hankkeita ja tulevaisuuden näkymiä Grid-hankkeita ja tulevaisuuden näkymiä Arto Teräs arto.teras@csc.fi Tietotekniikan professoritapaaminen CSC:llä 20.12.2004 Sisällys Grid pähkinänkuoressa CSC:n grid-hankkeita Haka-luottamusverkosto Materiaalitutkimuksen

Lisätiedot

13.11. Tulosten arviointi. tulosten arviointi. voimmeko luottaa saamiimme tuloksiin?

13.11. Tulosten arviointi. tulosten arviointi. voimmeko luottaa saamiimme tuloksiin? 13.11. tulosten arviointi Tulosten arviointi voimmeko luottaa saamiimme tuloksiin? onko osa saaduista tuloksista sattumanvaraisia? mitkä OSAT puusta ovat luotettavimpia? 1 KONSENSUSDIAGRAMMI Useita yhtä

Lisätiedot

Miksi auditoidaan? Pirkko Puranen FT, Ylitarkastaja

Miksi auditoidaan? Pirkko Puranen FT, Ylitarkastaja Miksi auditoidaan? Pirkko Puranen FT, Ylitarkastaja Vaatimus kudoslaitoksille: Fimean määräys 3/2014 Liite V 6. Laatukatselmus 6.1 Toiminnoille, joille lupaa haetaan, on oltava käytössä auditointijärjestelmä.

Lisätiedot

Suomen huonosti tunnetut ja uhanalaiset sienet

Suomen huonosti tunnetut ja uhanalaiset sienet Suomen huonosti tunnetut ja uhanalaiset sienet Sienet Sienten lajimäärä on paljon aiemmin ajateltua suurempi Lajit tunnettava, jotta sienten todellisen monimuotoisuuden, uhanalaisuuden ja suojelutarpeiden

Lisätiedot

Kuinka tutkijat hakevat tietoa Aaltoyliopiston

Kuinka tutkijat hakevat tietoa Aaltoyliopiston Kuinka tutkijat hakevat tietoa Aaltoyliopiston kauppakorkeakoulussa Taloustieteellisten aineistojen sisällönkuvailupäivä Toukokuu 2012 Juha Holopainen email: juha.holopainen@aalto.fi FinELib toteutti syys-lokakuussa

Lisätiedot

Matematiikan tukikurssi

Matematiikan tukikurssi Matematiikan tukikurssi Kurssikerta 8 1 Suunnattu derivaatta Aluksi tarkastelemme vektoreita, koska ymmärrys vektoreista helpottaa alla olevien asioiden omaksumista. Kun liikutaan tasossa eli avaruudessa

Lisätiedot

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet?

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Harvinaiset-seminaari TYKS 29.9.2011 Jaakko Ignatius TYKS, Perinnöllisyyspoliklinikka Miksi Harvinaiset-seminaarissa puhutaan

Lisätiedot

Ajankäyttötutkimuksen satoa eli miten saan ystäviä, menestystä ja hyvän arvosanan tietojenkäsittelyteorian perusteista

Ajankäyttötutkimuksen satoa eli miten saan ystäviä, menestystä ja hyvän arvosanan tietojenkäsittelyteorian perusteista Ajankäyttötutkimuksen satoa eli miten saan ystäviä, menestystä ja hyvän arvosanan tietojenkäsittelyteorian perusteista Harri Haanpää 18. kesäkuuta 2004 Tietojenkäsittelyteorian perusteiden kevään 2004

Lisätiedot

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia

Lisätiedot

Esimerkkejä polynomisista ja ei-polynomisista ongelmista

Esimerkkejä polynomisista ja ei-polynomisista ongelmista Esimerkkejä polynomisista ja ei-polynomisista ongelmista Ennen yleisempiä teoriatarkasteluja katsotaan joitain tyypillisiä esimerkkejä ongelmista ja niiden vaativuudesta kaikki nämä ongelmat ratkeavia

Lisätiedot

Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen

Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Opintori 10.5.2012 Minna Männikkö Biolääketieteen laitos Lääketieteellisen biokemian ja molekyylibiologian kurssi 15 op, 170 opiskelijaa Kemia:

Lisätiedot

Mat-2.3114 Investointiteoria Laskuharjoitus 3/2008, Ratkaisut 05.02.2008

Mat-2.3114 Investointiteoria Laskuharjoitus 3/2008, Ratkaisut 05.02.2008 Korko riippuu usein laina-ajan pituudesta ja pitkille talletuksille maksetaan korkeampaa korkoa. Spot-korko s t on se korko, joka kertyy lainatulle pääomalle hetkeen t (=kokonaisluku) mennessä. Spot-korot

Lisätiedot

TUTKIMUSAINEISTON ANALYYSI. LTKY012 Timo Törmäkangas

TUTKIMUSAINEISTON ANALYYSI. LTKY012 Timo Törmäkangas TUTKIMUSAINEISTON ANALYYSI LTKY012 Timo Törmäkangas LUENNOT Luento Paikka Vko Päivä Pvm Klo 1 L 304 8 Pe 21.2. 08:15-10:00 2 L 304 9 To 27.2. 12:15-14:00 3 L 304 9 Pe 28.2. 08:15-10:00 4 L 304 10 Ke 5.3.

Lisätiedot

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä

Lisätiedot

Syvien biosfäärien geomikrobiologia - Molekyylibiologiset monitorointimenetelmät, GEOMOL

Syvien biosfäärien geomikrobiologia - Molekyylibiologiset monitorointimenetelmät, GEOMOL Syvien biosfäärien geomikrobiologia - Molekyylibiologiset monitorointimenetelmät, GEOMOL KYT seminaari 26.9.2008 Merja Itävaara Projektin tausta Miksi geomikrobiologiaa tutkitaan? Loppusijoitusalueen hydrogeokemiallinen

Lisätiedot

Laboratorioanalyysit, vertailunäytteet ja tilastolliset menetelmät

Laboratorioanalyysit, vertailunäytteet ja tilastolliset menetelmät Jarmo Koskiniemi Maataloustieteiden laitos Helsingin yliopisto 0504151624 jarmo.koskiniemi@helsinki.fi 03.12.2015 Kolkunjoen taimenten geneettinen analyysi Näytteet Mika Oraluoma (Vesi-Visio osk) toimitti

Lisätiedot

Käyttöopas RoofCon Viewer

Käyttöopas RoofCon Viewer Käyttöopas RoofCon Viewer Sisällysluettelo Käyttöopas RoofCon Viewer... 1 Sisällysluettelo... 2 Asennus... 3 Merkitse objekti... 3 Zoomaa... 3 Mittaa etäisyys... 3 Työkaluvalikko ja Piirustusvaihtoehdot...

Lisätiedot

4.1 Kaksi pistettä määrää suoran

4.1 Kaksi pistettä määrää suoran 4.1 Kaksi pistettä määrää suoran Kerrataan aluksi kurssin MAA1 tietoja. Geometrisesti on selvää, että tason suora on täysin määrätty, kun tunnetaan sen kaksi pistettä. Joskus voi tulla vastaan tilanne,

Lisätiedot

Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori

Lisätiedot

Ohjelmointi II. Erkki Pesonen Luennot ja harjoitukset. Itä-Suomen yliopisto Tietojenkäsittelytieteen laitos 2015

Ohjelmointi II. Erkki Pesonen Luennot ja harjoitukset. Itä-Suomen yliopisto Tietojenkäsittelytieteen laitos 2015 Ohjelmointi II Erkki Pesonen Luennot ja harjoitukset Itä-Suomen yliopisto Tietojenkäsittelytieteen laitos 2015 1 Johdantoa kurssilla opiskeluun: oppimistavoitteet. 1. Tiedän mitä asioita kurssilla opiskellaan

Lisätiedot

Radiologisen fysiikan ja säteilysuojelun kurssi radiologiaan erikoistuville lääkäreille 26.8. - 29.8.2014. Ohjelma KAHVITAUKO

Radiologisen fysiikan ja säteilysuojelun kurssi radiologiaan erikoistuville lääkäreille 26.8. - 29.8.2014. Ohjelma KAHVITAUKO Radiologisen fysiikan ja säteilysuojelun kurssi radiologiaan erikoistuville lääkäreille 26.8. - 29.8.2014 Ohjelma Paikka: Kuopion Yliopistollinen Sairaala, Auditorio I Luennoitsija Ti 26.8.14 8.30 9.00

Lisätiedot

Symbioosi 2 VASTAUKSET. b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl

Symbioosi 2 VASTAUKSET. b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl Luku 14 Symbioosi 2 VASTAUKSET 1. Banaanikärpänen dihybridiristeytys a. Mikä on vanhempien genotyyppi? Vastaus: VvLl b. Millaisia sukusoluja vanhemmat tuottavat (4 erilaista)? Vastaus: VL, vl, Vl, vl c.

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

Geenikartoitusmenetelmät. Kytkentäanalyysin teoriaa. Suurimman uskottavuuden menetelmä ML (maximum likelihood) Uskottavuusfunktio: koko aineisto

Geenikartoitusmenetelmät. Kytkentäanalyysin teoriaa. Suurimman uskottavuuden menetelmä ML (maximum likelihood) Uskottavuusfunktio: koko aineisto Kytkentäanalyysin teoriaa Pyritään selvittämään tiettyyn ominaisuuteen vaikuttavien eenien paikka enomissa Perustavoite: löytää markkerilokus jonka alleelit ja tutkittava ominaisuus (esim. sairaus) periytyvät

Lisätiedot

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS:n haasteet diagnostiikassa 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly

Lisätiedot

Ratkaisu: a) Koroton takaisinmaksuaika on 9000 = 7,5 vuotta. 1200 b) Kun vuosituotot pysyvät vakiona, korollinen takaisinmaksuaika määräytyy

Ratkaisu: a) Koroton takaisinmaksuaika on 9000 = 7,5 vuotta. 1200 b) Kun vuosituotot pysyvät vakiona, korollinen takaisinmaksuaika määräytyy Kotitehtävät 7. Aihepiirinä Investointi Ratkaisuehdotuksia 1. Investoinnin hankintameno on 9000 euroa ja siitä saadaan seuraavina vuosina vuosittain 1200 euron tulot. Määritä a) koroton takaisinmaksuaika

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun

Lisätiedot