CSC:n käyttäjätunnukset - myös opiskelijoille
|
|
- Sanna-Kaisa Lehtinen
- 9 vuotta sitten
- Katselukertoja:
Transkriptio
1 CSC:n käyttäjätunnukset - myös opiskelijoille upahakemukset/index_html Ohjaajan nimeksi Petri Törönen Perusteluiksi opiskelu ja luentokurssin nimi (Geneettisen Bioinformatiikan luennot) Pyytäkää käyttöoikeus myös Chipsteriin (rastittava) jos olette tulossa Bioinfon työt - kurssille!
2 Sekvenssihaut ja vertailut: BLAST 2014
3 Sequence databases Many different types of databases: Nucleotide data banks EMBL, GenBank, DDBJ EST databases (dbest: ) genome builds with browsers ENSEMBL ( UCSC ( Protein databases (Uniprot, ) etc
4 Searching databases Different types of queries: Find DNA sequences that are homologous to your sequence (the same evolutionary origin) Find gene families across the species Align an mrna sequence to a genome assembly (what gene is my mrna coding?) Does my RNA sequence remind any protein? Design primers for PCR Search a database for a specific motif
5 Database search The most common application in bioinformatics Used for searching a sequence database for a match for the query sequence. Proteins are frequently composed of functional domains repeated in many different proteins These parts are most likely to be conserved -> look for shared patterns Two computer program families FastA (older, used seldom anymore, BUT may offer advantages which do not exist with BLAST) BLAST
6 Database search tools BLAST vs. other tools SPEED versus SENSITIVITY FAST TOOLS BLAT MEGABLAST Standard BLAST SENSITIVE TOOLS SSEARCH PSI-BLAST
7 What is BLAST? BLAST Basic Local Alignment Search Tool finds regions of local similarity between sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches. A set of several computer programs (blastn, blastx ) Optimized for finding local alignments between two sequences Requires user to choose some parameters
8 BLAST Since DNA databases can be very large, searching for the optimal alignment to all sequences would take too long. Thus, BLAST is a heuristic algorithm. Heuristic algorithms find a match reasonably close to the optimal one in a much shorter time than the full dynamic programming. The alignment found can then be separately verified / refined using slower but more accurate dynamic programming Understanding BLAST function is relevant for understanding when it fails to find hits!
9 How BLAST works? All BLAST programs work more or less similarly, and computationally a BLAST search consists of three phases: Seeding Extension Evaluation
10 How BLAST works The query sequence is divided into subsequences of a given length. word size 3 for proteins, 11 for nucleotides. These are used to look for exact or nearly exact matches in the sequence database. Fast to do = computationally inexpensive. When a match is found, it is extended further.
11 Seeding Word size (W=3) KRISTIAN KRISTIAN KRISTIAN KRISTIAN KRISTIAN KRISTIAN Q u e r y Search space Database Word hits Remember dot plot! Alignment Gapped alignment
12 Threshold in seeding Word hit Hit is two matching, identical words, one in database, another in the query sequence (used in blastn) Hit is a neighborhood (used in protein-related searches) The neighborhood of a word contains the word itself and all other words whose score is at least as big as T (threshold) when compared via the scoring matrix. For example, if T=13, word=pqg, matrix=blosum62, only words getting a score over 13 will be scored as hits: PQG-PEG (15) is accepted, but PQG-PQA (12) is not. Setting T higher will remove more word hits, making BLAST run faster, but increases the chance of missing an interesting alignment. Setting W (wordsize) higher will decrease sensitivity (chance of finding the alignment), but increase speed of the search.
13
14 Extension Word hits found during seeding are extented from their ends. Extension is stopped when the alignment score drops, or in newer implementations, when the alignment score has dropped enough (drop-off score) compared to its previous maximum. Alignment Word hit Extension
15 Extension, example KRISTIAN gap=0, X=2 -RISTISANA BLOSUM <- BLOSUM62 values <- Score <- Drop off score drop off score Extension terminates when drop off score falls below X.
16 Evaluation When the extension stage has produced the alignments, they will be evaluated to determine whether they are statistically significant. Statistical significance is determined using Karlin-Altschul statistics (the E-score) Some simplifying assumptions are made (such as sequences inifinitely long, no gaps), but in practice, K-A statistics is nicely generalizable.
17 E-score The lower the E-score, the more significant the alignment The E-score is dependent on both the database size and the scoring system (substitution matrix, gap penalties). If these are changed, the E-score for a specific alignment will also change.
18 Karlin-Altschul statistics E value. E = Kmne S E = number of alignments reaching score S just by chance K = minor constant m = the length of query sequence n = the size of the database (DB) e (neperin luku) 2,71 S = normalized alignment score (S is the score, lambda is a normalization factor) E-value estimates number of equally good (or better) hits from DB by random
19 Karlin-Altschul, example What is the chance that when two equally long (250) amino acid sequences are aligned using PAM250 matrix, the alignment score is 75? E = Kmne S = 0,1*250*250*2,71 -(0,229*75) = 0,
20 Filtering out repeats The human genome (like most others) contains large amounts of repetitive DNA (LINE, SINE, Alu, etc.) If the query sequence contains repeats, many of the homologies identified will be to other sequences containing the same repeats. Repeats should in most instances be masked out Usually represented as AATAGNNNNCGC Same represented for aminoacids with X
21 Disadvantages of BLAST When expected sequence similarity drops below 80%, nucleotide-nucleotide blast no longer performs that well. Many significant homologies are missed due to the initial word size requirement. If initial words are allowed to be discontinuous, matching is improved.
22 Discontinuous initial words For instance, require 11 positions out of 21 consecutive nucleotides to be homologous. Description of BLAST Services
23 Different varieties of BLAST BLASTN: DNA query against a database of DNA sequences (blastn). BLASTP: Protein query against protein sequences (blastp). BLASTX: DNA query translated in six reading frames against a protein database (blastx). TBLASTX: Search DNA query against the via the translation to proteins
24 Blastn and Megablast Typically used for identifying your sequence. Megablast is a fast alternative for finding nearly exact matches. Blastn is better at finding somewhat diverged sequences (e.g. from a related species). Blastn is more sensitive but slower than megablast
25 Blastx and tblastx Blastx translates the query sequence in all reading frames and compares it to a protein database. Aggregate statistics are provided for all reading frames. Tblastx queries a translated DNA sequence against a database of translated DNA sequences. Also produces aggregate statistics for all reading frames.
26 BLAST programs Query Database Program Typical uses DNA DNA blastn Annotation, mapping oligonucleotides to genome protein protein blastp Identifying common regions in proteins translated DNA protein blastx Finding protein-coding genes in genomic DNA protein translated DNA tblastn Identifying transcripts, possibly from multiple organisms translated DNA translated DNA tblastx Cross-species gene prediction, searching for genes not yet in megablast protein databases Large and closely related sequences
27 Extensions to BLAST Make specific primers with Primer-BLAST (Finding primers specific to your PCR template PSI-BLAST: Protein sequence search method where: Best matches are aligned with query sequence Alignment creates a profile that emphasises conserved regions Search is repeated with created profile Whole thing is repeated CS-BLAST: BLAST version that uses information about the neighboring aminoacids to estimate substitutions
28 BLAST from command line Why command line usage? Runs with query sequences Runs against specific database (say all sequences from human, chimp and gorilla) Applications: BLAST all human genes vs. all mouse genes Running BLAST between all sequences in an analyzed set.
29 ...miten valita omaan tarkoitukseen sopivin blast-versio?! Apua ohjelman valintaan:
30 Pisteytysmatriisien valinta PAM-matriisit eivät välttämättä toimi kovin hyvin tietokantahauissa. Blosum-sarjaa kannattaa siis suosia mahdollisuuksien rajoissa. Blosum62 Blast-ohjelmille Aukkosakot: -8/-2 DNA:lle käytetään useimmiten matriisia, jossa osumat=5 ja hudit =-4. Perustuen J. Tuimalan originaaleihin
31 Päätäntäkaavio homologisten sekvenssien löytämiseksi Koodaako sekvenssi proteiinia tai voidaanko se kääntää proteiiniksi? Kyllä Tee haku prot.tietokannoista tai käännetystä DNA-sekvenssitietokannasta Onko saatu hakutulos mielekäs ja tilastollisesti merkitsevä? Kyllä Toista tietokantahaku käyttäen löydettyjä sekvenssejä hakusekvensseinä Ei Ei Tee haku DNAsekvenssitietokannoista Säädä ensin BLAST-parametreja Etsi seuraavaksi motiiveja ja blokkeja Tee saaduille sekvensseille usean sekvenssin rinnastus ja muodosta mahdollinen fylogeneettinen puu Kaavio J.Tuimalan Bioinformatiikan perusteet mukaan
32 Low-complexity filtering Low-complexity regions can be removed from the sequences before running the search. Low complexity regions consist of, e.g., several copies of the nucleotide or amino acid in sequence. Low-complexity regions are spotted using a sliding window method (complexity is calculated repeatedly inside every frame). In BLAST, window size is 12 nucleotides or amino acids. Human repeats, like SINE and LINE regions can also be masked. In the BLAST report, the masked (filtered) areas are marked with Ns (DNA) or Xs (amino acid).
33 Kokeillaan tttcggctca ctactaggag catgcctaat tacccagatc ctaacagggt tatttctagc catacattat acacctgaca caataactgc cattttcatc tatatcccat atctgccgag atgtcaacta cggttgaatt attcgacaac tacactcaaa cggagcatct attttcttcc
34
35
36
37
38
39
40 Käytännön vinkkejä hakuihin Tee samalla huolellisuudella kuin laboratoriokokeetkin! Aloita aina hakuparametrien (aukkosakot, pisteytysmatriisit) oletusasetuksilla, ja jos tulokset eivät tyydytä, muuta sopivampaan suuntaan sanakokoa, pisteytysmatriisia ja/tai mahd. E-arvorajaa Yleiskäyttöisiä pisteytysmatriiseja aminohapoille: BLOSUM62 (aukkosakoilla -8 ja -2) ja BLOSUM50 (-12/-2 tai -14/-2) Rajoita haku vain kiinnostavaan tietokantaan (ja/tai sen osastoon), tämä voi nopeuttaa hakuasi oleellisesti! Esim, jos et halua monia kertoja saman sekvenssin eri muotoja vastauksina, ja tiedät minkä organismin sekvenssivastaavuuksista on kyse, tee hakusi Genomic BLASTilla! (Suoraan geenipankista=nukleotiditietokannasta hakeva BLAST antaa vastaukseksi KAIKKI vastaavat sekvenssit, vaikka olisivat vain saman genomisen sekvenssin eri versioita)
41 Käytännön vinkkejä: Hakukoneet ovat eniten kuormitettuja keskellä työpäivää, paikallista aikaa klo Mikäli sekvenssisi on proteiinia koodaava, käytä ah-sekvenssiä, ei DNAta vertailuihin. Eliöiden välillä on eroa mm. kodonien käytössä, mikä voi aiheuttaa ongelmia tietokantahauissa! Poista low-complexity (yksinkertaiset ja toistojakso-) alueet suodattamalla ( filtering, löytyy optiona BLASTissa) -> vähentää biologisesti ei-relevanttien samankaltaisuuksien löytymistä. Hyvin lyhyet sekvenssit, noin 20 bp: perus-blastin hakuparametrien oletusarvot eivät toimi näille hyvin! Siispä: Pienennä sanakokoa, kasvata E-arvoa PCR-alukkeiden genomispesifisyyttä tutkittaessa käytä uutta Primer- BLASTia! Lyhyet ah-sekvenssit: pisteytysmatriisiksi lähisukuisille sekvensseille sopivat, esim. PAM30, BLOSUM80, BLOSUM90 Kaukaisille sukulaisille: PAM250, BLOSUM62
42 Tulosten tulkintaan Osumat ESTeihin ja hypoteettisiin proteiineihin (varsinkin hyvin lyhyisiin) suhtaudu näihin varauksella! Huonot osumat on helppo tunnistaa linjauksessa olevan suuren aukkomäärän perusteella (tällöin nosta aukkosakkoparametriesi arvoja!)
43 Esimerkkisekvenssi 2: Blastaa! gactgtgagc aaagctttag taccaggcaa cattttcaaa tcaagtggac ttacagatgg tattgcttat gagttccggg tgattgcaga aaacatggca ggcaaaagta agccaagcaa gccatcagaa cctatgttgg ctctggatcc cattgaccca cctggaaaac cagtacctct aaatattaca agacacacag taacacttaa atgggctaag cctgaatata ctgggggctt
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
Eukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition)
Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition) Click here if your download doesn"t start automatically
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
Statistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
Valuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
1. Liikkuvat määreet
1. Liikkuvat määreet Väitelauseen perussanajärjestys: SPOTPA (subj. + pred. + obj. + tapa + paikka + aika) Suora sanajärjestys = subjekti on ennen predikaattia tekijä tekeminen Alasääntö 1: Liikkuvat määreet
Salasanan vaihto uuteen / How to change password
Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Basic Flute Technique
Herbert Lindholm Basic Flute Technique Peruskuviot huilulle op. 26 Helin & Sons, Helsinki Basic Flute Technique Foreword This book has the same goal as a teacher should have; to make himself unnecessary.
T Statistical Natural Language Processing Answers 6 Collocations Version 1.0
T-61.5020 Statistical Natural Language Processing Answers 6 Collocations Version 1.0 1. Let s start by calculating the results for pair valkoinen, talo manually: Frequency: Bigrams valkoinen, talo occurred
Chapter 7. Motif finding (week 11) Chapter 8. Sequence binning (week 11)
Course organization Introduction ( Week 1) Part I: Algorithms for Sequence Analysis (Week 1-11) Chapter 1-3, Models and theories» Probability theory and Statistics (Week 2)» Algorithm complexity analysis
EUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
State of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
MRI-sovellukset. Ryhmän 6 LH:t (8.22 & 9.25)
MRI-sovellukset Ryhmän 6 LH:t (8.22 & 9.25) Ex. 8.22 Ex. 8.22 a) What kind of image artifact is present in image (b) Answer: The artifact in the image is aliasing artifact (phase aliasing) b) How did Joe
Tietorakenteet ja algoritmit
Tietorakenteet ja algoritmit Taulukon edut Taulukon haitat Taulukon haittojen välttäminen Dynaamisesti linkattu lista Linkatun listan solmun määrittelytavat Lineaarisen listan toteutus dynaamisesti linkattuna
Genome 373: Genomic Informatics. Professors Elhanan Borenstein and Jay Shendure
Genome 373: Genomic Informatics Professors Elhanan Borenstein and Jay Shendure Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Uusi Ajatus Löytyy
Käyttöliittymät II. Käyttöliittymät I Kertaus peruskurssilta. Keskeisin kälikurssilla opittu asia?
Käyttöliittymät II Sari A. Laakso Käyttöliittymät I Kertaus peruskurssilta Keskeisin kälikurssilla opittu asia? 1 Käyttöliittymät II Kurssin sisältö Käli I Käyttötilanteita Käli II Käyttötilanteet selvitetään
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
AYYE 9/ HOUSING POLICY
AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we
Guidebook for Multicultural TUT Users
1 Guidebook for Multicultural TUT Users WORKPLACE PIRKANMAA-hankkeen KESKUSTELUTILAISUUS 16.12.2010 Hyvää käytäntöä kehittämässä - vuorovaikutusopas kansainvälisille opiskelijoille TTY Teknis-taloudellinen
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
Oma sininen meresi (Finnish Edition)
Oma sininen meresi (Finnish Edition) Hannu Pirilä Click here if your download doesn"t start automatically Oma sininen meresi (Finnish Edition) Hannu Pirilä Oma sininen meresi (Finnish Edition) Hannu Pirilä
812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
1.3Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 81122P (4 ov.) 30.5.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
Rotarypiiri 1420 Piiriapurahoista myönnettävät stipendit
Rotarypiiri 1420 Piiriapurahoista myönnettävät stipendit Ø Rotarypiiri myöntää stipendejä sille osoitettujen hakemusten perusteella ensisijaisesti rotaryaatteen mukaisiin tarkoituksiin. Ø Stipendejä myönnetään
Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO
Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO Tomi Kauppinen, Eero Hyvönen, Jari Väätäinen Semantic Computing Research Group (SeCo) http://www.seco.tkk.fi/
1.3 Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 811122P (5 op.) 12.12.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
Co-Design Yhteissuunnittelu
Co-Design Yhteissuunnittelu Tuuli Mattelmäki DA, associate professor Aalto University School of Arts, Design and Architecture School of Arts, Design and Architecture design with and for people Codesign
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
Skene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene
Skene Muokkaa perustyyl. Games Refueled napsautt. @Games for Health, Kuopio Muokkaa alaotsikon perustyyliä napsautt. 2013 kari.korhonen@tekes.fi www.tekes.fi/skene 10.9.201 3 Muokkaa Skene boosts perustyyl.
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
Miksi Suomi on Suomi (Finnish Edition)
Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Click here if your download doesn"t start automatically Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Miksi Suomi on Suomi (Finnish Edition)
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
MEETING PEOPLE COMMUNICATIVE QUESTIONS
Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.
7. Product-line architectures
7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015
1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti
Exercise 1. (session: )
EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You
Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa?
Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa? Kerro meille datastasi työpaja 10.4.2013 Antti Auer Tietohallintopäällikkö Jyväskylän yliopisto Strateginen kehittäminen Johtamista, tutkimushallintoa
4x4cup Rastikuvien tulkinta
4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,
S Sähkön jakelu ja markkinat S Electricity Distribution and Markets
S-18.3153 Sähkön jakelu ja markkinat S-18.3154 Electricity Distribution and Markets Voltage Sag 1) Kolmivaiheinen vastukseton oikosulku tapahtuu 20 kv lähdöllä etäisyydellä 1 km, 3 km, 5 km, 8 km, 10 km
CS284A Representations & Algorithms for Molecular Biology. Xiaohui S. Xie University of California, Irvine
CS284A Representations & Algorithms for Molecular Biology Xiaohui S. Xie University of California, Irvine Today s Goals Course information Challenges in computational biology Introduction to molecular
Searching (Sub-)Strings. Ulf Leser
Searching (Sub-)Strings Ulf Leser This Lecture Exact substring search Naïve Boyer-Moore Searching with profiles Sequence profiles Ungapped approximate search Statistical evaluation of search results Ulf
KMTK lentoestetyöpaja - Osa 2
KMTK lentoestetyöpaja - Osa 2 Veijo Pätynen 18.10.2016 Pasila YHTEISTYÖSSÄ: Ilmailun paikkatiedon hallintamalli Ilmailun paikkatiedon hallintamalli (v0.9 4.3.2016) 4.4 Maanmittauslaitoksen rooli ja vastuut...
Functional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä. public-procurement
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä https://ec.europa.eu/futurium/en/ public-procurement Julkiset hankinnat liittyvät moneen Konsortio Lähtökohdat ja tavoitteet Every
FinFamily Installation and importing data (11.1.2016) FinFamily Asennus / Installation
FinFamily Asennus / Installation 1 Sisällys / Contents FinFamily Asennus / Installation... 1 1. Asennus ja tietojen tuonti / Installation and importing data... 4 1.1. Asenna Java / Install Java... 4 1.2.
Curriculum. Gym card
A new school year Curriculum Fast Track Final Grading Gym card TET A new school year Work Ethic Detention Own work Organisation and independence Wilma TMU Support Services Well-Being CURRICULUM FAST TRACK
TIEKE Verkottaja Service Tools for electronic data interchange utilizers. Heikki Laaksamo
TIEKE Verkottaja Service Tools for electronic data interchange utilizers Heikki Laaksamo TIEKE Finnish Information Society Development Centre (TIEKE Tietoyhteiskunnan kehittämiskeskus ry) TIEKE is a neutral,
Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen
Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen Who we are FIN-CLARIN University of Helsinki The Language Bank of Finland CSC - The Center for
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
The role of 3dr sector in rural -community based- tourism - potentials, challenges
The role of 3dr sector in rural -community based- tourism - potentials, challenges Lappeenranta, 5th September 2014 Contents of the presentation 1. SEPRA what is it and why does it exist? 2. Experiences
toukokuu 2011: Lukion kokeiden kehittämistyöryhmien suunnittelukokous
Tuula Sutela toukokuu 2011: Lukion kokeiden kehittämistyöryhmien suunnittelukokous äidinkieli ja kirjallisuus, modersmål och litteratur, kemia, maantiede, matematiikka, englanti käsikirjoitukset vuoden
Travel Getting Around
- Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?
Tutkimusdata ja julkaiseminen Suomen Akatemian ja EU:n H2020 projekteissa
Tutkimusdata ja julkaiseminen Suomen Akatemian ja EU:n H2020 projekteissa Tutkimusasiamies Kaisa Männikkö Tutkimus- ja innovaatiopalvelut Suomen Akatemian projektit Suomen Akatemia kehottaa avoimeen tieteelliseen
Suomen Talonpoikaiss Dyn Keskustelup Yt Kirjat, Issue 1... (Finnish Edition) Click here if your download doesn"t start automatically
Suomen Talonpoikaiss Dyn Keskustelup Yt Kirjat, Issue 1... (Finnish Edition) Click here if your download doesn"t start automatically Suomen Talonpoikaiss Dyn Keskustelup Yt Kirjat, Issue 1... (Finnish
Tilausvahvistus. Anttolan Urheilijat HENNA-RIIKKA HAIKONEN KUMMANNIEMENTIE 5 B RAHULA. Anttolan Urheilijat
7.80.4 Asiakasnumero: 3000359 KALLE MANNINEN KOVASTENLUODONTIE 46 51600 HAUKIVUORI Toimitusosoite: KUMMANNIEMENTIE 5 B 51720 RAHULA Viitteenne: Henna-Riikka Haikonen Viitteemme: Pyry Niemi +358400874498
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
Vertaispalaute. Vertaispalaute, /9
Vertaispalaute Vertaispalaute, 18.3.2014 1/9 Mistä on kyse? opiskelijat antavat palautetta toistensa töistä palaute ei vaikuta arvosanaan (palautteen antaminen voi vaikuttaa) opiskelija on työskennellyt
You can check above like this: Start->Control Panel->Programs->find if Microsoft Lync or Microsoft Lync Attendeed is listed
Online Meeting Guest Online Meeting for Guest Participant Lync Attendee Installation Online kokous vierailevalle osallistujalle Lync Attendee Asennus www.ruukki.com Overview Before you can join to Ruukki
Bioinformatics. Sequence Analysis: Part III. Pattern Searching and Gene Finding. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Sequence Analysis: Part III. Pattern Searching and Gene Finding Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18
Ajettavat luokat: SM: S1 (25 aika-ajon nopeinta)
SUPERMOTO SM 2013 OULU Lisämääräys ja ohje Oulun Moottorikerho ry ja Oulun Formula K-125ry toivottaa SuperMoto kuljettajat osallistumaan SuperMoto SM 2013 Oulu osakilpailuun. Kilpailu ajetaan karting radalla
Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy
Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy OVERVIEW- Method updated and written by Sarah Louie (6/19/08) Initially
Operatioanalyysi 2011, Harjoitus 4, viikko 40
Operatioanalyysi 2011, Harjoitus 4, viikko 40 H4t1, Exercise 4.2. H4t2, Exercise 4.3. H4t3, Exercise 4.4. H4t4, Exercise 4.5. H4t5, Exercise 4.6. (Exercise 4.2.) 1 4.2. Solve the LP max z = x 1 + 2x 2
Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)
Tilasto T1106120-s2012palaute Kyselyn T1106120+T1106120-s2012palaute yhteenveto: vastauksia (4) Kysymys 1 Degree programme: (4) TIK: TIK 1 25% ************** INF: INF 0 0% EST: EST 0 0% TLT: TLT 0 0% BIO:
Microsoft Lync 2010 Attendee
VYVI MEETING Lync Attendee 2010 Instruction 1 (15) Microsoft Lync 2010 Attendee Online meeting VYVI MEETING Lync Attendee 2010 Instruction 2 (15) Index 1 Microsoft LYNC 2010 Attendee... 3 2 Acquiring Lync
RINNAKKAINEN OHJELMOINTI A,
RINNAKKAINEN OHJELMOINTI 815301A, 18.6.2005 1. Vastaa lyhyesti (2p kustakin): a) Mitkä ovat rinnakkaisen ohjelman oikeellisuuskriteerit? b) Mitä tarkoittaa laiska säikeen luominen? c) Mitä ovat kohtaaminen
Immigration Studying. Studying - University. Stating that you want to enroll. Stating that you want to apply for a course.
- University I would like to enroll at a university. Stating that you want to enroll I want to apply for course. Stating that you want to apply for a course an undergraduate a postgraduate a PhD a full-time
ENE-C2001 Käytännön energiatekniikkaa. Aloitustapaaminen 11.4.2016. Osa II: Projekti- ja tiimityö
ENE-C2001 Käytännön energiatekniikkaa Aloitustapaaminen 11.4.2016 Osa II: Projekti- ja tiimityö Sisältö Projektityö Mitä on projektityö? Projektityön tekeminen: ositus, aikatauluhallinta, päätöksenteon
Counting quantities 1-3
Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X. Rastita Tick (X) (X) the kummassa box that has laatikossa