Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus

Save this PDF as:

Koko: px
Aloita esitys sivulta:

Download "Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus"


1 Katri Kärkkäinen Matti Haapanen Metsägenetiikan sovellukset: Metsägenetiikan haasteet: geenit, geenivarat ja metsänjalostus Katri Kärkkäinen ja Matti Haapanen Metsäntutkimuslaitos Vantaan tutkimuskeskus Metsänjalostus Geenivaratyö Geneettisen monimuotoisuuden säilyttämistä Kansainväliset sopimukset ja velvoitteet Miksi tutkia geneettistä monimuotoisuutta? Tutkimuksessa arvioidaan: Puiden populaatioiden elinkykyä nykyisenlaisessa ympäristössä Sopeutumiskykyä muuttuvaan ympäristöön (ilmastomuutos) Ihmistoiminnan vaikutusten arviointi (metsänviljely, siemensiirrot) Luontaisen geneettisen muuntelun perustan tunnistus: Miksi tutkia geenejä? Osataan hoitaa geenivaroja paremmin Osataan ennustaa vasteita ympäristönmuutoksiin Osataan jalostaa tehokkaammin AA AA AA Aa AA Aa aa aa aa aa Aa aa 1

2 Genomin koko eri eliöissä Geenien määrä eri eliöissä Genomin koko Geenien määrä? Lituruoho Poppeli Ihminen Mänty Banaanikärpänen Banaanikärpänen Lituruoho Poppeli Ihminen Mänty Havupuiden geenien sekvenssit samankaltaisia Esim. Geenin PST-1 DNA-sekvenssit: mänty (Pinus sylvestris) ja japaninmänty (Pinus densiflora) Pinus sylv : Pinus dens : Pinus sylv : Pinus dens : Pinus sylv : Pinus dens : * 20 * 40 agatggggggcgttgattttgaaggtttcaggaagttgcagagg AGATGGGGGGCGTTGATTTTGAAGGTTTCAGGAAGTTGCAGAGG AGATGGGGGGCGTTGATTTTGAAGGTTTCAGGAAGTTGCAGAGG * 60 * 80 gcagatggcttcgcttcgatccttgctatcggcactgccaatcc GCAGATGGCTTCGCTTCGATCCTTGCTATCGGCACTGCCAATCC GCAGATGGCTTCGCTTCGATCCTTGCTATCGGCACTGCCAATCC * 100 * 120 * acccaatgctgtggatcagagcacatatccagatttctactttc ACCCAATGCTGTGGATCAGAGCACATATCCAGATTACTACTTTC ACCCAATGCTGTGGATCAGAGCACATATCCAGATT CTACTTTC Miten löytää tärkeää geneettistä muuntelua? Kandidaattigeenilähestymistapa 1. Kartoitetaan yksilöiden välistä muuntelua Taimi 1: kasvu 60 päivää Geeni 1: DNA-tyyppi DD Geeni 2: DNA-tyyppi CC Taimi 2: kasvu 120 päivää Geeni 1: DNA-tyyppi AA Geeni 2: DNA-tyyppi CC 2. Tutkitaan mallilajeissa tärkeäksi tiedetyn geenin muuntelua samoista puista Metla/Marja-Leena Annala DNA-muuntelun ja ominaisuuden muuntelun assosiaatiot: Yhden geenin yhden DNA-emäksen muutoksen vaikutus kasvin ilmiasuun Ominaisuus EU-projekti "TREESNIPS" SOPEUTUMISEEN VAIKUTTAVIEN GEENIEN ETSINTÄ D/D A/D A/A DNA-tyyppi Koordinaattori Outi Savolainen, Oulun yliopisto INRA/Ranska, UNIUD/Italia, INIA/Espanja, UU/Ruotsi, SCRI/Iso-Britannia, METLA/Suomi 2

3 TREESNIPS: Männyn eurooppalaiset populaatiot voimakkaasti erilaistuneet kasvurytmiltään. Erilaistumisen aiheuttavia geenejä etsitään. % taimista lopettanut kasvun Kasvun loppumisaika, päivää kokeen alusta Kolari Uusikaupunki Kälviä Ruotsi Saksa Belgia Hollanti Itävalta Turkki Ranska Puola Slovakia Espanja10 Espanja17 Espanja5 Tutkittavia ominaisuuksia: Sopeutuminen ympäristöön Tutkittavia ominaisuuksia: Taudinkestävyys Tutkittavia ominaisuuksia: Puun laatu Puita ja geenejä 3

4 Miksi jalostusta? Metsänjalostuksen mahdollisuudet Matti Haapanen Metsäntutkimuslaitos Vantaan tutkimuskeskus Monet evoluution tuottamista puiden sopeutumista eivät ole ihmisen käyttötarkoitusten kannalta optimaalisia Jalostustavoitteet Parempaa laatua Sahatavaran ja vanerin arvoon vaikuttavat rungon laatutekijät Oksanpaksuus Oksakulma Rungon suoruus 1 Jalostustavoitteet Viljelyvarmuutta 2 Kylmänkestävyys Kasvurytmi Tuhojen vastustuskyky Jalostushyödyt realisoituvat nopeasti Jalostustavoitteet Kasvunopeutta Erinomainen kasvu ja rungon laatu yhdistyvät korkean satoindeksin puissa, joiden yhteyttämistuotteista keskimääräistä suurempi osuus ohjautuu runkopuuhun 3 Jalostussykli Pluspuut Valinta Risteytys Jälkeläistestaus Jalostushyödyt Siemenviljelykset tuottavat siementä metsänviljelyyn 4

5 Perintötekijät? Ympäristö Ympäristöstä johtuvat virheet puiden valinnassa minimoidaan perustamalla viljelykokeita, joissa puiden jälkeläisiä verrataan yhdenmukaisessa ympäristössä Jalostushyöty realisoituu eri ajankohtina Esimerkkejä metsänjalostuksen tuloksista Viljelyvarmuus Kasvunopeus ja puuntuotos Puun laatu v. Jalostetun viljelymetsän kiertoaika Normaali kiertoaika Metsänjalostuksen tuloksia 1 Metsänjalostuksen tuloksia 2 Laatu Kasvunopeus Männyn rungon laatuarvosanan paraneminen keskimäärin 16% Rauduskoivulla 2. polven siemenviljelysaineistossa tilavuuskasvun lisäys keskimäärin 26% Jaloste Vertailu 5

6 Metsänjalostuksen tuloksia Kasvullisesti lisätty kuusen genotyyppi V383 on tuottanut koeviljelyksellä Nurmijärvellä 20 vuodessa puuta 380 m 3 / ha 2 Jalostussyklin kesto pullonkaula V383 Myöhäinen kukinta Valinta Testaus Risteytys Koivu 25 vuotta Mänty, kuusi vuotta Pitkä nuoruusvaihe Tavoite! Kiitos! 1 2 Aika Valokuvat Metla/Risto Hagqvist Metla/Jouko Lehto Metla/Jaakko Napola Metla/Teijo Nikkanen Werner Holmberg: Maantie Hämeessä (1860) 6

Geenitutkimusta: evoluutiosta kohti geenivarojen suojelua ja jalostusta

Geenitutkimusta: evoluutiosta kohti geenivarojen suojelua ja jalostusta Geenitutkimusta: evoluutiosta kohti geenivarojen suojelua ja jalostusta 19.10.2016 Metsätieteen päivä Outi Savolainen, Oulun yliopisto, Genetiikan ja fysiologian tutkimusyksikkö Käyttölisenssi: CC BY 4.0


Siemenviljelyohjelman tilannekatsaus

Siemenviljelyohjelman tilannekatsaus Siemenviljelyohjelman tilannekatsaus Jukka Antola Metsätaimitarhapäivät Peurunka, Laukaa 21.1.2015 2 Jukka Antola Sv 165 Pyhäjärvi, Jörkki 3 Jukka Antola Sv 170 Korpilahti, Heinämäki 1½-polven siemenviljelysten


Metsäviljelyaineiston käyttöalueiden määrittely. Egbert Beuker Seppo Ruotsalainen

Metsäviljelyaineiston käyttöalueiden määrittely. Egbert Beuker Seppo Ruotsalainen Metsäviljelyaineiston käyttöalueiden määrittely Egbert Beuker Seppo Ruotsalainen Metsäviljelyaineiston käyttöalueiden määrittely Tutkimushanke 2013 2014 Tulevaisuuden metsät ja metsänhoito (MHO) Egbert


Jalostuksen talousvaikutukset valtakunnan tasolla. Arto Koistinen Metsätiedepaja

Jalostuksen talousvaikutukset valtakunnan tasolla. Arto Koistinen Metsätiedepaja Jalostuksen talousvaikutukset valtakunnan tasolla Arto Koistinen Metsätiedepaja 15.11.2016 Jalostuksen talousvaikutukset valtakunnan tasolla Tutkimusta ja tulkintaa Lähtökohtana tutkimukseen perustuvat



GEENIVARAT OVAT PERUSTA KASVINJALOSTUKSELLE. Merja Veteläinen Boreal Kasvinjalostus Oy GEENIVARAT OVAT PERUSTA KASVINJALOSTUKSELLE Merja Veteläinen Boreal Kasvinjalostus Oy OPIT TÄNÄÄN Miksi kasvinjalostus tarvitsee geenivaroja? Miten geenivaroja käytetään kasvinjalostuksessa? Geenivarat


Rauduskoivun uudet siemenviljelykset täsmäjalosteita koivunviljelyyn

Rauduskoivun uudet siemenviljelykset täsmäjalosteita koivunviljelyyn Rauduskoivun uudet siemenviljelykset täsmäjalosteita koivunviljelyyn Matti Haapanen Rauduskoivun siemenviljelykset perustettiin syyskuussa 2014 kahdelle paikkakunnalle Patama / Siemen Forelia Hausjärvi


Metsänjalostus 2050 pitkän aikavälin metsänjalostusohjelma

Metsänjalostus 2050 pitkän aikavälin metsänjalostusohjelma ISBN 978-951-40-2048-1 (PDF) ISSN 1795-150X Metsänjalostus 2050 pitkän aikavälin metsänjalostusohjelma Matti Haapanen ja Jouni Mikola Metlan työraportteja / Working Papers of the Finnish Forest


Punkaharjun yksikön esittely MMM:n alueyksikkötyöryhmän vierailulla

Punkaharjun yksikön esittely MMM:n alueyksikkötyöryhmän vierailulla Punkaharjun yksikön esittely MMM:n alueyksikkötyöryhmän vierailulla 9.9.2008 22.9.2008 1 22.9.2008 2 22.9.2008 3 22.9.2008 4 Punkaharjun toimintayksikkö Metlan Punkaharjun toimintayksikkö rakentaa metsäalan


Tuloksia metsikön kasvatusvaihtoehtojen vertailulaskelmista. Jari Hynynen & Motti-ryhmä/Metla

Tuloksia metsikön kasvatusvaihtoehtojen vertailulaskelmista. Jari Hynynen & Motti-ryhmä/Metla Tuloksia metsikön kasvatusvaihtoehtojen vertailulaskelmista Jari Hynynen & Motti-ryhmä/Metla TutkijaMOTTI - metsikkötason analyysityökalu Käyttäjän antamat tiedot Puusto- ja kasvupaikkatieto Metsänkäsittelyn


Geenitutkimus paljastaa PUUN SALAISUUKSIA

Geenitutkimus paljastaa PUUN SALAISUUKSIA Geenitutkimus paljastaa Ari Turunen PUUN SALAISUUKSIA Puulla on monimutkaisen rakenteensa vuoksi vielä paljon tuntemattomia käyttömahdollisuuksia. Geenitutkimuksen avulla pyritään vaikuttamaan myös puiden


Metsäteollisuuden ulkomaankauppa, lokakuu 2012

Metsäteollisuuden ulkomaankauppa, lokakuu 2012 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, lokakuu 2012 3/2013 18.1.2013 Aarre Peltola Puun tuonti nousussa lokakuussa Puun kuukausittainen



METSÄNJALOSTUKSEN HYÖDYT Lauri Ruotsalainen METSÄNJALOSTUKSEN HYÖDYT Opinnäytetyö Metsätalouden koulutusohjelma Kesäkuu 2012 KUVAILULEHTI Opinnäytetyön päivämäärä 1.6.2012 Tekijä Lauri Ruotsalainen Koulutusohjelma ja suuntautuminen


Naudan perinnöllisen monimuotoisuuden tutkimus

Naudan perinnöllisen monimuotoisuuden tutkimus Naudan perinnöllisen monimuotoisuuden tutkimus Terhi Iso-Touru 25.5.2012 Emeritusprofessori Kalle Maijalan 85-vuotisjuhlaseminaari Naudan domestikaatio eli kesyttäminen yli 45 kiloa painavia kasvinsyöjälajeja



3 SIEMEN- JA TAIMITUOTANTO 3 SIEMEN- JA TAIMITUOTANTO Havupuiden taimitarhakylvöjen määrä väheni vuonna 1996 hieman edellisvuodesta. Samanaikaisesti näihin kylvöihin käytetyn siemenen jalostusaste kuitenkin nousi. Kuusen osalta


Lisää kasvua ja laatua solukkolisäyksellä Tuija Aronen

Lisää kasvua ja laatua solukkolisäyksellä Tuija Aronen Lisää kasvua ja laatua solukkolisäyksellä Tuija Aronen Metsässä puhaltavat uudet tuulet Metlan ja Itä-Suomen yliopiston juhlaseminaari Mikkeli 11.9.2012 Metsäpuiden kasvullinen lisäys... tuottaa taimia,


Maljalta metsään -kuusen solukkoviljely tänään. Saila Varis

Maljalta metsään -kuusen solukkoviljely tänään. Saila Varis Maljalta metsään -kuusen solukkoviljely tänään Saila Varis Kasvullinen lisäys osaamista ja teknologiaa biotalouden tueksi Laadukkaan kuusen siemenmateriaalin saatavuus ajoittain huono johtuen kukinnan


a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla.

a. Mustan ja lyhytkarvaisen yksilön? b. Valkean ja pitkäkarvaisen yksilön? Perustele risteytyskaavion avulla. 1. Banaanikärpänen dihybridiristeytys. Banaanikärpäsillä silmät voivat olla valkoiset (resessiivinen ominaisuus, alleeli v) tai punaiset (alleeli V). Toisessa kromosomissa oleva geeni määrittää siipien


METSÄTILASTOTIEDOTE. Metsäteollisuuden ulkomaankauppa, syyskuu Metsäteollisuuden vienti vilkastui jälleen syyskuussa

METSÄTILASTOTIEDOTE. Metsäteollisuuden ulkomaankauppa, syyskuu Metsäteollisuuden vienti vilkastui jälleen syyskuussa Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, syyskuu 2014 50/2014 4.12.2014 Annu Kaila Metsäteollisuuden vienti vilkastui jälleen syyskuussa


Metsäteollisuuden ulkomaankauppa, helmikuu 2014

Metsäteollisuuden ulkomaankauppa, helmikuu 2014 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, helmikuu 2014 18/2014 15.5.2014 Aarre Peltola Venäläisen puun osuus tuonnista kasvussa Suomeen


Tuulituhot ja metsänhoito

Tuulituhot ja metsänhoito Tuulituhot ja metsänhoito Susanne Suvanto Metsänterveysseminaari 1 Susanne Suvanto, Metsänterveysseminaari Tuulituhot Suomessa Tuulituhot usein esiintyvät tuulennopeudet vs. myrskytuulet Myrskytuhot Syysmyrskyt


Metsäteollisuuden ulkomaankauppa, lokakuu 2014

Metsäteollisuuden ulkomaankauppa, lokakuu 2014 Luonnonvara- ja biotalouden tutkimus 1/2015 TILASTO: Metsäteollisuuden ulkomaankauppa, lokakuu 2014 15.1.2015 Aarre Peltola TILASTO Metsäteollisuuden ulkomaankauppa, lokakuu 2014 15.1.2015 Aarre Peltola


Metsäpuiden siementarvearviotyöryhmän muistio

Metsäpuiden siementarvearviotyöryhmän muistio Metsäpuiden siementarvearviotyöryhmän muistio Helsinki 2011 Työryhmämuistio mmm 2011:6 Metsäpuiden siementarvearviotyöryhmän muistio Helsinki 2011 Maa- ja metsätalousministeriölle Maa- ja metsätalousministeriö



3 SIEMEN- JA TAIMITUOTANTO 3 SIEMEN- JA TAIMITUOTANTO Luvussa esitetään metsäpuiden jalostetun siemenen tuottamiseen liittyviä tilastotietoja ja taimituotantoa kuvaavia lukuja. Metsänjalostuksen osalta lähteenä on käytetty Metsäntutkimuslaitoksen


Kuusen kasvullinen lisäys: taustaa ja uuden hankkeen lyhyt esittely

Kuusen kasvullinen lisäys: taustaa ja uuden hankkeen lyhyt esittely Kuusen kasvullinen lisäys: taustaa ja uuden hankkeen lyhyt esittely Kuusen kasvullinen lisäys kohti tulevaisuuden taimituotantoa hankkeen ohjausryhmän 1. kokous 19.2.2015 Tuija Aronen 1 Tuija Aronen Metsäpuiden


NordGen Metsä teemapäivä Karoliina Niemi Maa- ja metsätalousministeriö Metsäosasto

NordGen Metsä teemapäivä Karoliina Niemi Maa- ja metsätalousministeriö Metsäosasto Metsätalouden siemenhuolto ministeriön rooli NordGen Metsä teemapäivä..8 Karoliina Niemi Maa- ja metsätalousministeriö Metsäosasto Metsäpuiden siementen saatavuus - Siemenviljelykset - Siemenkeräysmetsiköt


Männyn laatukasvatus Jari Hynynen. Metsäntutkimuslaitos Skogsforskningsinstitutet Finnish Forest Research Institute

Männyn laatukasvatus Jari Hynynen. Metsäntutkimuslaitos Skogsforskningsinstitutet Finnish Forest Research Institute Männyn laatukasvatus Jari Hynynen Metsäntutkimuslaitos Skogsforskningsinstitutet Finnish Forest Research Institute Johdanto Suomen metsien luontaiset edellytykset soveltuvat hyvin laatupuun


Metsäteollisuuden ulkomaankauppa, maaliskuu 2011

Metsäteollisuuden ulkomaankauppa, maaliskuu 2011 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, maaliskuu 2011 24/2011 10.6.2011 Aarre Peltola Metsäteollisuustuotteiden vienti kasvoi reaalisesti


Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma

Evoluutio. BI Elämä ja evoluutio Leena Kangas-Järviluoma Evoluutio BI Elämä ja evoluutio Leena Kangas-Järviluoma 1 Evoluutio lajinkehitystä, jossa eliölajit muuttuvat ja niistä voi kehittyä uusia lajeja on jatkunut elämän synnystä saakka, sillä ei ole päämäärää


Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Eero Lukkari Tämä artikkeli kertoo perinnöllisyyden perusmekanismeista johdantona muille jalostus- ja terveysaiheisille artikkeleille. Koirien, kuten muidenkin eliöiden, perimä


Metsäteollisuuden ulkomaankauppa, helmikuu 2011

Metsäteollisuuden ulkomaankauppa, helmikuu 2011 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, helmikuu 2011 17/2011 6.5.2011 Aarre Peltola Metsäteollisuustuotteiden viennin arvo jatkoi kasvuaan


Männyn valiosiemenviljelysten perustamisperiaatteet

Männyn valiosiemenviljelysten perustamisperiaatteet Nikkanen & Antola Metsätieteen aikakauskirja Männyn valiosiemenviljelysten perustamisperiaatteet k a t s a u s Teijo Nikkanen ja Jukka Antola Männyn valiosiemenviljelysten perustamisperiaatteet Teijo Nikkanen


Metsäteollisuuden ulkomaankauppa, toukokuu 2011

Metsäteollisuuden ulkomaankauppa, toukokuu 2011 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, toukokuu 2011 31/2011 3.8.2011 Aarre Peltola Puun tuonti kiihtyi toukokuussa Suomeen tuotiin


Aasianrunkojäärä. Tilanne Vantaalla 18.11.2015

Aasianrunkojäärä. Tilanne Vantaalla 18.11.2015 Aasianrunkojäärä Tilanne Vantaalla 18.11.2015 Aino-Maija Alanko 18.11.2015 Sisällys Yleistä aasianrunkojäärästä Tilannekatsaus Kivipyykintien esiintymäpaikasta Kartoitukset Jatkotoimenpiteet Aino-Maija


Metsäteollisuustuotteita vietiin tammi elokuussa 7,43 miljardin euron arvosta

Metsäteollisuustuotteita vietiin tammi elokuussa 7,43 miljardin euron arvosta Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, elokuu 2014 46/2014 5.11.2014 Annu Kaila Metsäteollisuustuotteita vietiin tammi elokuussa 7,43


Metsäteollisuuden ulkomaankauppa, toukokuu 2012

Metsäteollisuuden ulkomaankauppa, toukokuu 2012 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, toukokuu 2012 33/2012 3.8.2012 Aarre Peltola Suomeen tuotiin tammi toukokuussa 3,8 miljoonaa


Metsänjalostussäätiön toiminnanjohtaja Matti Haapasen puhe Haapastensyrjän 50-vuotisjuhlissa 24.8.2011

Metsänjalostussäätiön toiminnanjohtaja Matti Haapasen puhe Haapastensyrjän 50-vuotisjuhlissa 24.8.2011 Metsänjalostussäätiön toiminnanjohtaja Matti Haapasen puhe Haapastensyrjän 50-vuotisjuhlissa 24.8.2011 HAAPASTENSYRJÄ 50 VUOTTA METSÄNJALOSTUSTA Arvoisat juhlavieraat, Haapastensyrjä on pieni kooltaan,


Solukkolisäyksen mahdollisuudet havupuiden taimituotannossa

Solukkolisäyksen mahdollisuudet havupuiden taimituotannossa Solukkolisäyksen mahdollisuudet havupuiden taimituotannossa BIOKOKKOLA 28.10.2015 Tuija Aronen 1 Tuija Aronen 11.2.2015 EAKR-hanke Kasvullinen lisäys osaamista ja teknologiaa biotalouden tueksi 2011-14


Metsäteollisuuden ulkomaankauppa, kesäkuu 2014

Metsäteollisuuden ulkomaankauppa, kesäkuu 2014 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, kesäkuu 2014 38/2014 8.9.2014 Annu Kaila Puun tuonti laski 12 prosenttia ensimmäisellä vuosipuoliskolla


Ajankohtaista kunta- ja aluetiedoista

Ajankohtaista kunta- ja aluetiedoista Ajankohtaista kunta- ja aluetiedoista Ulkomaalaiset Suomessa Yliaktuaari, Tilastokeskus Esityksessäni Hieman historiallista näkökulmaa ulkomaalaisuuteen Ulkomaalaiset Suomessa Ulkomaalaisten hedelmällisyys


Kansallinen metsästrategia 2025 ja metsänjalostus

Kansallinen metsästrategia 2025 ja metsänjalostus Kansallinen metsästrategia 2025 ja metsänjalostus Sanna Paanukoski maa- ja metsätalousministeriö 21.11.2016 1 Kansallinen metsästrategia 2025 Strategia listaa metsäalan tärkeimmät tavoitteet vuoteen 2025


Metsäntutkimuslaitos rakentaa metsäalan tulevaisuutta tuottamalla ja välittämällä tietoa sekä osaamista yhteiskunnan parhaaksi.

Metsäntutkimuslaitos rakentaa metsäalan tulevaisuutta tuottamalla ja välittämällä tietoa sekä osaamista yhteiskunnan parhaaksi. Metsäntutkimuslaitos rakentaa metsäalan tulevaisuutta tuottamalla ja välittämällä tietoa sekä osaamista yhteiskunnan parhaaksi. Metsäntutkimuslaitos Skogsforskningsinstitutet Finnish Forest Research Institute


Suomen metsävarat 2004-2005

Suomen metsävarat 2004-2005 Suomen metsävarat 24-2 Korhonen, K.T., Heikkinen, J., Henttonen, H., Ihalainen, A., Pitkänen, J. & Tuomainen, T. 26. Suomen metsävarat 24-2. Metsätieteen Aikakauskirja 1B/26 Metsäntutkimuslaitos Skogsforskningsinstitutet


Metsäteollisuuden ulkomaankauppa, kesäkuu 2010

Metsäteollisuuden ulkomaankauppa, kesäkuu 2010 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, kesäkuu 2010 37/2010 8.9.2010 Aarre Peltola Puun tuonti on lisääntynyt tasaisesti Puun tuonti


Lisää kasvua, laatua ja erikoisuuksia

Lisää kasvua, laatua ja erikoisuuksia Lisää kasvua, laatua ja erikoisuuksia Tuija Aronen Puissa kasvaa tulevaisuus Metlan Punkaharjun toimipaikan sidosryhmäseminaari Metsämuseo Lustossa, Punkaharjulla, 22.8.2014 Metsä on tärkein biotalouden


Raakapuun ja metsäteollisuustuotteiden ulkomaankauppa maittain 1997

Raakapuun ja metsäteollisuustuotteiden ulkomaankauppa maittain 1997 Raakapuun ja metsäteollisuustuotteiden ulkomaankauppa maittain 1997 Toimittajat: Aarre Peltola Helena Herrala-Ylinen 8.9.1998 447 Tuontiraakapuusta viisi kuudesosaa tuli Venäjältä Saksaan ja Iso-Britanniaan


Taimikonhoidon vaikutus. Taimikonhoidon vaikutus kasvatettavan puuston laatuun

Taimikonhoidon vaikutus. Taimikonhoidon vaikutus kasvatettavan puuston laatuun Taimikonhoidon vaikutus kasvatettavan puuston laatuun Taimikonhoidon teemapäivä 26.8.2010 MMT Metsäntutkimuslaitos, Suonenjoki Varhaishoito Pintakasvillisuuden torjunta - kilpailun vaikutukset Taimikonhoidon


Mikä on taimikonhoidon laadun taso?

Mikä on taimikonhoidon laadun taso? Mikä on taimikonhoidon laadun taso? MMT Timo Saksa Luonnonvarakeskus Suonenjoen toimipaikka Pienten taimikoiden laatu VMI:n mukaan Tyydyttävässä taimikossa kasvatettavien taimien määrä on metsänhoito-suositusta


Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen


Kaupan indikaattorit. Toukokuu Vähittäiskaupan ja teknisen kaupan luottamusindeksit

Kaupan indikaattorit. Toukokuu Vähittäiskaupan ja teknisen kaupan luottamusindeksit Kaupan indikaattorit Toukokuu 21 Vähittäiskaupan ja teknisen kaupan luottamusindeksit Luottamusindeksit kaupan alalla toukokuu 21 Vähittäiskaupan indeksit (ml. autojen vähittäiskauppa): 1. Suhdannekuva.


Metsänviljelyaineiston klooniyhdistelmien rekisteröinti

Metsänviljelyaineiston klooniyhdistelmien rekisteröinti Metsänviljelyaineiston klooniyhdistelmien rekisteröinti Tehoa tulevaisuuden taimituotantoon kasvullisen lisäyksen mahdollisuudet Punkaharju, Lusto 27.11.2012 Kari Leinonen Elintarviketurvallisuusvirasto


Metsäteollisuuden ulkomaankauppa, joulukuu 2012

Metsäteollisuuden ulkomaankauppa, joulukuu 2012 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, joulukuu 2012 9/2013 8.3.2013 Aarre Peltola Metsäteollisuustuotteiden vienti ja puun tuonti supistuivat


Metsäsektorin ulkomaankauppa maittain 1998

Metsäsektorin ulkomaankauppa maittain 1998 Metsäsektorin ulkomaankauppa maittain 1998 Toimittajat: Aarre Peltola Helena Herrala-Ylinen 19.7.1999 491 Tuontipuu virtasi Venäjältä Suomeen Saksaan ja Iso-Britanniaan 34 prosenttia metsäsektorimme viennistä


Tuodusta puusta 78 prosenttia (15,6 milj. m³) oli peräisin Venäjältä.

Tuodusta puusta 78 prosenttia (15,6 milj. m³) oli peräisin Venäjältä. A JI Metsäteollisuuden ulkomaankauppa maittain 2006 JE = I J JEA @ JA A JI JK J E K I = EJ I A JI JE = I J E A JEA J F = L A K F K D! ' B= N " Toimittaja: Aarre Peltola 27.7.2007 877 Metsäteollisuustuotteiden


Metsäteollisuuden ulkomaankauppa, elokuu 2009

Metsäteollisuuden ulkomaankauppa, elokuu 2009 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, elokuu 2009 42/2009 10.11.2009 Aarre Peltola Puuta tuotiin Suomeen tammi elokuussa vain 5,8 miljoonaa


Metsäteollisuuden ulkomaankauppa maittain 2011

Metsäteollisuuden ulkomaankauppa maittain 2011 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE 43/2012 Metsäteollisuuden ulkomaankauppa maittain 2011 24.10.2012 Aarre Peltola Puun tuonti 10,5 miljoonaa kuutiometriä ja metsäteollisuustuotteiden


Metsäpuiden siementuotannon tulevaisuus organisaatiorakenne ja julkinen rahoitus

Metsäpuiden siementuotannon tulevaisuus organisaatiorakenne ja julkinen rahoitus ISBN 978-951-40-2277-7 (PDF) ISSN 1795-150X Metsäpuiden siementuotannon tulevaisuus organisaatiorakenne ja julkinen rahoitus Metsäpuiden siementuotannon uudelleen organisointi -hankkeen loppuraportti Karoliina



GEENIVARAT MONIMUOTOISUUDEN TURVAAJINA GEENIVARAT MONIMUOTOISUUDEN TURVAAJINA Yrjö Tuunanen Yrjö Tuunanen Mitä geenivarat ovat ja miksi niitä suojellaan? Teijo Nikkanen Viljelykasvien, kotieläinten ja metsäpuiden geenivaroilla tarkoitetaan


Arkkitehtuurien tutkimus Outi Räihä. OHJ-3200 Ohjelmistoarkkitehtuurit. Darwin-projekti. Johdanto

Arkkitehtuurien tutkimus Outi Räihä. OHJ-3200 Ohjelmistoarkkitehtuurit. Darwin-projekti. Johdanto OHJ-3200 Ohjelmistoarkkitehtuurit 1 Arkkitehtuurien tutkimus Outi Räihä 2 Darwin-projekti Darwin-projekti: Akatemian rahoitus 2009-2011 Arkkitehtuurisuunnittelu etsintäongelmana Geneettiset algoritmit


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen Medicum, Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen Medicum, Biokemia ja kehitysbiologia 12.12.2017 Epigenetic inheritance: A heritable alteration in a cell s or organism s phenotype that does


Metsäteollisuuden ulkomaankauppa maittain 2012

Metsäteollisuuden ulkomaankauppa maittain 2012 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE 43/2013 Metsäteollisuuden ulkomaankauppa maittain 2012 8.11.2013 Aarre Peltola Puun tuonti 10 miljoonaa kuutiometriä ja metsäteollisuustuotteiden


Kasvullinen lisäys tarkoittaa valittujen puuyksilöiden

Kasvullinen lisäys tarkoittaa valittujen puuyksilöiden Metsätieteen aikakauskirja 1/2011 Tuija Aronen Kasvullisen lisäyksen mahdollisuudet havupuiden taimituotannossa e e m t a Johdanto Kasvullinen lisäys tarkoittaa valittujen puuyksilöiden monistamista, ja


Kasvu- ja tuotostutkimus. Tutkimuskohteena puiden kasvu ja metsien kehitys. Luontaisten kasvutekijöiden vaikutukset. Männikköä karulla rämeellä

Kasvu- ja tuotostutkimus. Tutkimuskohteena puiden kasvu ja metsien kehitys. Luontaisten kasvutekijöiden vaikutukset. Männikköä karulla rämeellä Kasvu- ja tuotostutkimus tutkittua tietoa puiden kasvusta ja metsien kehityksestä Jari Hynynen Metsäntutkimuslaitos Jari Hynynen Tutkimuskohteena puiden kasvu ja metsien kehitys Miten kasvuympäristö ja



KULUTTAJAHINTAINDEKSI 2010=100 KULUTTAJAHINTAINDEKSI 2010=100 Tilaisuuden avaus ylijohtaja Jarmo Hyrkkö, Tilastokeskus Inflaatio tammikuussa 2011 uudistetun kuluttajahintaindeksin 2010=100 mukaan tilastopäällikkö Mari Ylä-Jarkko, Tilastokeskus


Avainsanat: BI5 III Biotekniikan sovelluksia 7.Kasvin- ja eläinjalostuksella tehostetaan ravinnontuotantoa.

Avainsanat: BI5 III Biotekniikan sovelluksia 7.Kasvin- ja eläinjalostuksella tehostetaan ravinnontuotantoa. Avainsanat: kasvinjalostus eläinjalostus lajike risteytysjalostus itsepölytteinen ristipölytteinen puhdas linja heteroosi hybridilajike ylläpitojalostus geneettinen eroosio autopolyploidia allopolyploidia


Pakkaukset Siemenet Parhaat metsät kasvavat huippulaatuisesta siemenestä. TAIMITARHAT Kerimäki Saarijärvi

Pakkaukset Siemenet Parhaat metsät kasvavat huippulaatuisesta siemenestä. TAIMITARHAT Kerimäki Saarijärvi Pakkaukset Siemenet Parhaat metsät kasvavat huippulaatuisesta siemenestä. Männyn metsäkylvössä kannattaa aina käyttää perimältään parasta mahdollista siementä. TAIMITARHAT Taimitarhantie 800 Puhelin 00


Taimikoiden hirvituhot: tuhojen määrä, hirvikannan koon vaikutus tuhoihin, taimikoiden toipuminen, torjuntakeinot

Taimikoiden hirvituhot: tuhojen määrä, hirvikannan koon vaikutus tuhoihin, taimikoiden toipuminen, torjuntakeinot Taimikoiden hirvituhot: tuhojen määrä, hirvikannan koon vaikutus tuhoihin, taimikoiden toipuminen, torjuntakeinot Juho Matala METSÄNUUDISTAMISEN LAADUN ONGELMAT NordGen Metsä teemapäivä Maanantai 3.10.2011,



METSÄTILASTOTIEDOTE 48/2014 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE 48/2014 Metsäteollisuuden ulkomaankauppa maittain 2013 21.11.2014 Aarre Peltola Puuta tuotiin 11 miljoonaa kuutiometriä ja metsäteollisuustuotteita


Raaka- ja jätepuu Suomeen tuotiin viime vuonna 12,9 miljoonaa kuutiometriä raaka- ja jätepuuta.

Raaka- ja jätepuu Suomeen tuotiin viime vuonna 12,9 miljoonaa kuutiometriä raaka- ja jätepuuta. Metsäteollisuuden ulkomaankauppa maittain 2000 Toimittaja: Aarre Peltola 20.8.2001 589 Tuontipuusta 84 prosenttia tuli Venäjältä Saksaan viidennes metsäteollisuuden viennistä Raaka- ja jätepuu Suomeen


Kaupan indikaattorit. Maaliskuu Luottamusindeksit vähittäiskaupassa, autokaupassa ja teknisessä kaupassa

Kaupan indikaattorit. Maaliskuu Luottamusindeksit vähittäiskaupassa, autokaupassa ja teknisessä kaupassa Kaupan indikaattorit Maaliskuu 2010 Luottamusindeksit vähittäiskaupassa, autokaupassa ja teknisessä kaupassa Luottamusindeksit kaupan alalla Maaliskuu 2010 Vähittäiskaupan indeksit (ml. autojen vähittäiskauppa):


Metsäteollisuuden ulkomaankauppa, syyskuu 2009

Metsäteollisuuden ulkomaankauppa, syyskuu 2009 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, syyskuu 2009 46/2009 11.12.2009 Aarre Peltola Puun tuontivauhti jäi alle puoleen viime vuodesta


Kaupan indikaattorit. Huhtikuu Luottamusindeksit vähittäiskaupassa, autokaupassa ja teknisessä kaupassa

Kaupan indikaattorit. Huhtikuu Luottamusindeksit vähittäiskaupassa, autokaupassa ja teknisessä kaupassa Kaupan indikaattorit Huhtikuu 21 Luottamusindeksit vähittäiskaupassa, autokaupassa ja teknisessä kaupassa Luottamusindeksit kaupan alalla Huhtikuu 21 Vähittäiskaupan indeksit (ml. autojen vähittäiskauppa):


Välillisen verotuksen rooli elintarvikkeiden ja eräiden muiden tuotteiden hinnanmuodostuksessa

Välillisen verotuksen rooli elintarvikkeiden ja eräiden muiden tuotteiden hinnanmuodostuksessa Kauppa 2010 -päivä Päivittäistavarakaupan aamupäivä 30.9.2009 Välillisen verotuksen rooli elintarvikkeiden ja eräiden muiden tuotteiden hinnanmuodostuksessa Hanna Karikallio Pellervon taloudellinen tutkimuslaitos


Ruotsalaisen kuusen. MHaa1 siemenviljelysaineiston käyttökelpoisuus Suomessa. Seppo Ruotsalainen & Matti Haapanen Metsäntutkimuslaitos

Ruotsalaisen kuusen. MHaa1 siemenviljelysaineiston käyttökelpoisuus Suomessa. Seppo Ruotsalainen & Matti Haapanen Metsäntutkimuslaitos Ruotsalaisen kuusen MHaa1 siemenviljelysaineiston käyttökelpoisuus Suomessa Seppo Ruotsalainen & Matti Haapanen Metsäntutkimuslaitos Metsäntutkimuslaitos Skogsforskningsinstitutet Finnish Forest Research


Metsäteollisuuden ulkomaankauppa, kesäkuu 2009

Metsäteollisuuden ulkomaankauppa, kesäkuu 2009 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, kesäkuu 2009 36/2009 9.9.2009 Aarre Peltola Polttopuun tuonti on moninkertaistunut edellisvuodesta


KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla.

KOE 6 Biotekniikka. 1. Geenien kloonaus plasmidien avulla. Esseekysymyksistä 1-2 voi saada enintään 9 pistettä/kysymys. Vastauksia pisteytettäessä huomioidaan asiatiedot, joista voi saada enintään 7 pistettä. Lisäksi vastaaja saa enintään kaksi pistettä, mikäli


ja Latvian 4 prosenttia. Muiden maiden osuudet jäivät alle prosenttiin. Ulkomaankaupan tavaraluokituksen parantuminen mahdollisti

ja Latvian 4 prosenttia. Muiden maiden osuudet jäivät alle prosenttiin. Ulkomaankaupan tavaraluokituksen parantuminen mahdollisti A JI Metsäteollisuuden ulkomaankauppa maittain 2002 JE = I J JEA @ JA A JI JK J E K I = EJ I A JI JE = I J E A JEA J F = L A K F K D! ' B= N " Toimittaja: Aarre Peltola 1.8.2003 685 Puun tuonnissa 16 miljoonan


Koiran periytyvä persoonallisuus

Koiran periytyvä persoonallisuus Koiran periytyvä persoonallisuus Katriina Tiira, FT, Koirangeenit tutkimusryhmä, HY & Folkhälsan, Eläinten hyvinvoinnin tutkimuskeskus Periytyykö käyttäytyminen? Kaikki yksilön kokemukset kohtuajasta eteenpäin=


Metsäteollisuuden ulkomaankauppa, helmikuu 2009

Metsäteollisuuden ulkomaankauppa, helmikuu 2009 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, helmikuu 2009 17/2009 8.5.2009 Aarre Peltola Puun tuontivauhti on puolittunut viime vuodesta


Kurkistus tulevaisuuden taimitarhaan

Kurkistus tulevaisuuden taimitarhaan Kurkistus tulevaisuuden taimitarhaan Kasvullinen lisäys hankkeen tavoitteet, tuloksia ja tulevaisuuden näkymiä Hankkeen vastuullinen johtaja Tuija Aronen 27.11.2012 Metsäpuiden kasvullinen lisäys... tuottaa


Metsäteollisuuden ulkomaankauppa, tammikuu 2009

Metsäteollisuuden ulkomaankauppa, tammikuu 2009 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, tammikuu 2009 12/2009 14.4.2009 Aarre Peltola Puun tuonti Suomeen romahti tammikuussa Tammikuussa


Paljon puuta oli jo sotien aikana metsistä jouduttu

Paljon puuta oli jo sotien aikana metsistä jouduttu Metsätieteen aikakauskirja 3 4/2016 Veikko Koski Tutkimustieto olkoon metsänjalostuksen perusta Alkuasetelmat Paljon puuta oli jo sotien aikana metsistä jouduttu ottamaan käyttöön. Sotien jälkeen jällenrakentamisen,


Peruskuvioluettelo. Pituus m. Määrä/ha m 3 tai kpl. Kuusi 64 5,7 27 kpl 0. Mänty 64 6,0 220 kpl 0 0,1. keskiarvo 64 5,9 242 kpl 0

Peruskuvioluettelo. Pituus m. Määrä/ha m 3 tai kpl. Kuusi 64 5,7 27 kpl 0. Mänty 64 6,0 220 kpl 0 0,1. keskiarvo 64 5,9 242 kpl 0 Peruskuioluettelo Kuio 71 1,9 ha Inentoitu Joutoaa, äntyaltainen räe Kuusi 64 5,7 27 kpl 0 3 /ha Mänty 64 6,0 220 kpl 0 0,1 Yhteensä 6 3 keskiaro 64 5,9 242 kpl 0 ja /ha Kuio 72 2,3 ha kuiahko kangas,


III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 15. Populaatiogenetiikka ja evoluutio 1. Avainsanat 2. Evoluutio muuttaa geenipoolia 3. Mihin valinta kohdistuu? 4. Yksilön muuntelua


III Perinnöllisyystieteen perusteita

III Perinnöllisyystieteen perusteita Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita 12. Ominaisuuksien periytymistä tutkitaan risteytyksillä 1. Avainsanat 2. Geenit ja alleelit 3. Mendelin herneet 4. Monohybridiristeytys


KUORMA-AUTOJEN SUURIMMAT SALLITUT NOPEUDET. Muualla ei rajoitusta, tarkkailkaa liikennemerkkejä!

KUORMA-AUTOJEN SUURIMMAT SALLITUT NOPEUDET. Muualla ei rajoitusta, tarkkailkaa liikennemerkkejä! KUORMA-AUTOJEN SUURIMMAT SALLITUT NOPEUDET ALBANIA Taajamissa ALGERIA Taajamissa ei rajoitusta, tarkkailkaa liikennemerkkejä! AZERBAIDZHAN Taajamissa 40 km/h 70 km/t BELGIA Taajamissa yli 7,5 t kokonaispainoiset


Metsänuudistamisen laatu Valtakunnan Metsien Inventoinnin (VMI) tulosten mukaan

Metsänuudistamisen laatu Valtakunnan Metsien Inventoinnin (VMI) tulosten mukaan Metsänuudistamisen laatu Valtakunnan Metsien Inventoinnin (VMI) tulosten mukaan NordGen Metsä teemapäivä 3.10.2011 Kari T. Korhonen VMI/Metla Valokuvat: E.Oksanen/Metla / Metsäntutkimuslaitos Skogsforskningsinstitutet


Metsäteollisuuden ulkomaankauppa, joulukuu 2013

Metsäteollisuuden ulkomaankauppa, joulukuu 2013 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, joulukuu 2013 9/2014 13.3.2014 Aarre Peltola Puun tuonti ja metsäteollisuustuotteiden vienti


Kaupan indikaattorit

Kaupan indikaattorit Kaupan indikaattorit Toukokuu 11 Vähittäiskaupan ja teknisen kaupan luottamusindeksit Luottamusindeksit kaupan alalla Toukokuu 11 Tukkukaupan indeksit. Vähittäiskaupan indeksit (ml. autojen vähittäiskauppa):


Työaika Suomessa ja muissa maissa. Joulukuu 2010 Työmarkkinasektori EK

Työaika Suomessa ja muissa maissa. Joulukuu 2010 Työmarkkinasektori EK Työaika Suomessa ja muissa maissa Joulukuu 2010 EK Säännöllisen vuosityöajan pituus 1910-2010 Teollisuuden työntekijät päivätyössä 3000 2800 2600 2400 2200 Tuntia vuodessa Vuosityöajan pituus: vuonna 1920


Kaupan indikaattorit. Luottamusindeksit vähittäiskaupassa, autokaupassa ja teknisessä kaupassa

Kaupan indikaattorit. Luottamusindeksit vähittäiskaupassa, autokaupassa ja teknisessä kaupassa Kaupan indikaattorit Luottamusindeksit vähittäiskaupassa, autokaupassa ja teknisessä kaupassa Luottamusindeksit kaupan alalla Tammikuu 2010 Vähittäiskaupan indeksit (ml. autojen vähittäiskauppa): 1. Kokonaisindeksi


Siementen alkuperäketjun viranomaisvalvonta. Kari Leinonen Elintarviketurvallisuusvirasto Evira Kasvinterveysyksikkö 25.9.2015

Siementen alkuperäketjun viranomaisvalvonta. Kari Leinonen Elintarviketurvallisuusvirasto Evira Kasvinterveysyksikkö 25.9.2015 Siementen alkuperäketjun viranomaisvalvonta Kari Leinonen Elintarviketurvallisuusvirasto Evira Kasvinterveysyksikkö 25.9.2015 Sisältö Rekisteröinti Siemenkeräysten valvontaprosessi Metsänviljelyaineiston


Ulkoilumetsien hoidossa käytettävien toimenpiteiden kuvaukset Keskuspuiston luonnonhoidon yleissuunnitelma

Ulkoilumetsien hoidossa käytettävien toimenpiteiden kuvaukset Keskuspuiston luonnonhoidon yleissuunnitelma Ulkoilumetsien hoidossa käytettävien toimenpiteiden kuvaukset Keskuspuiston luonnonhoidon yleissuunnitelma 1.10.2015 Helsingin kaupunki Rakennusvirasto Keskuspuiston ulkoilumetsiä hoidetaan luonnonmukaisesti


Itä-ja keskieurooppalaisten kuusialkuperien menestyminen Etelä-Suomessa. Jaakko Napola Luke, Haapastensyrjä Metsätaimitarhapäivät 20.-21.1.

Itä-ja keskieurooppalaisten kuusialkuperien menestyminen Etelä-Suomessa. Jaakko Napola Luke, Haapastensyrjä Metsätaimitarhapäivät 20.-21.1. Itä-ja keskieurooppalaisten kuusialkuperien menestyminen Etelä-Suomessa Jaakko Napola Luke, Haapastensyrjä Metsätaimitarhapäivät 20.-21.1.2015 Julkaisu Napola, Jaakko. 2014. Itä-ja keskieurooppalaisten


Suomen Akatemia käynnisti keväällä 1998 puu

Suomen Akatemia käynnisti keväällä 1998 puu Pekka Saranpää Uutta puusta: pintaa syvemmältä Suomen Akatemia käynnisti keväällä 1998 puu raaka-aineen tutkimusohjelman Metsästä puutuotteeksi: puunjalostuksen materiaalitiede. Sen keskeisenä tavoitteena


Ilmastonmuutos ja metsät: sopeutumista ja hillintää

Ilmastonmuutos ja metsät: sopeutumista ja hillintää Ilmastonmuutos ja metsät: sopeutumista ja hillintää METLA / MIL-tutkimusohjelma 2007-2012 Elina Vapaavuori METLA/Elina Vapaavuori: ILMASE -työpaja 06.11.2012 1 1 Nykyinen CO 2 pitoisuus, ~390 ppm, on korkeampi


Metsäteollisuuden ulkomaankauppa elokuu Raakapuu. Metsäteollisuustuotteet. Metsäteollisuuden viennin arvo viisi prosenttia.

Metsäteollisuuden ulkomaankauppa elokuu Raakapuu. Metsäteollisuustuotteet. Metsäteollisuuden viennin arvo viisi prosenttia. Metsäteollisuuden ulkomaankauppa elokuu 22 Toimittaja: Jukka Torvelainen 22..22 648 Metsäteollisuuden viennin arvo viisi prosenttia jäljessä viime vuodesta Raakapuu Suomeen tuotiin elokuussa puuta 1, miljoonaa


Metsäteollisuuden ulkomaankauppa, tammikuu 2014

Metsäteollisuuden ulkomaankauppa, tammikuu 2014 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE Metsäteollisuuden ulkomaankauppa, tammikuu 2014 13/2014 14.4.2014 Aarre Peltola Metsäteollisuustuotteiden vienti käynnistyi tammikuussa


Metsäteollisuuden ulkomaankauppa maittain 2010

Metsäteollisuuden ulkomaankauppa maittain 2010 Metsäntutkimuslaitos, Metsätilastollinen tietopalvelu METSÄTILASTOTIEDOTE 40/2011 Metsäteollisuuden ulkomaankauppa maittain 2010 10.10.2011 Aarre Peltola Puun tuonti ja metsäteollisuustuotteiden vienti


T U O T E K U V A S T O. Fin Forelia Oy 2011 Oikeudet muutoksiin pidätetään

T U O T E K U V A S T O. Fin Forelia Oy 2011 Oikeudet muutoksiin pidätetään T U O T E K U V A S T O Fin Forelia Oy 2011 Oikeudet muutoksiin pidätetään 30 cm 20 cm 10 cm Kuusi, pikkupaakku Kuusi, pikkupaakku 2-VUOTIAS Kuusi, keskipaakku Kuusi, keskipaakku 2-VUOTIAS Paakkutyyppi
