Koko: px
Aloita esitys sivulta:




2 Aiheet Sydän- ja verisuonitautien preventiosta Suomessa Geneettiset riskilaskut Loppupäätelmät

3 Sydän- ja verisuonitautien riskitekijöitä Sukupuoli (mies) Ikä Sukurasite Tupakointi Ylipaino Epäedullinen rasvaprofiili Korkea verenpaine Geenit geneettinen tausta monitekijäinen 17/10/2013 Kirsi Auro 3

4 Minä lähden Pohjois-Karjalaan Erkki Vartiainen

5 Voin käyttö leivällä (miehet iät 30-59) % North Karelia Kuopio province Southwest Finland Helsinki area Oulu province Lapland province Erkki Vartiainen

6 Ikävakioitu sepelvaltimotautikuolleisuus vuotiailla miehillä ja naisilla ajanjaksolla Mortality/ Erkki Vartiainen

7 Prosenttiosuus miehistä, jotka tuntevat terveytensä hyväksi tai erittäin hyväksi Erkki Vartiainen

8 Havaittu ja ennustettavissa oleva koronaaritaudin kuolleisuus miehissä % Year Observed All risk factors Cholesterol Diastolic BP Smoking

9 ACS:sta hengissä selvinneiden prevalenssi >35 vuotiailla miehillä ja naisilla FINAMI / Veikko Salomaa 9

10 Suomi vanhenee Suomen väestö ikääntyy nopeasti ja on esitetty huoli, että väestön vanheneminen voi lisätä sepelvaltimotautikohtausten lukumääriä huomattavasti tulevaisuudessa ja aiheuttaa kuormitusta terveydenhuoltojärjestelmälle 17/10/2013 Kirsi Auro 10

11 Summa summarum Ikävakioitu sepelvaltimotautikohtausten ja kuolleisuuden esiintyvyys on ollut voimakkaassa laskussa Dramaattinen muutos CVD-sairastavuudessa luvulta alkaen on selitettävissä pääosin muokattavien riskitekijöiden avulla Sydäninfarktin diagnostiset kriteerit ja infarktivauriota heijastavat biomarkkerit ovat muuttuneet jatkuvasti Kirsi Auro 11

12 Teknologian riemuvoitto yksi variantti (10 0 SNP; 10 3 genotyyppiä) Yhden geenin tarkka läpikäynti (10 2 SNPiä; genotyyppiä) Alueen kattava tutkimus (10 4 SNPiä; 10 8 genotyyppiä) genome-wide association (GWA) (10 6 SNPiä; genotyyppiä) Genomin resekvensointi (10 8 SNPiä / genotyyppiä)

13 Familiaalinen hyperkolesterolemia - geenivirhe LDL-reseptorissa johtaa korkeaan kolesterolitasoon - Suomessa arviolta geenivirheen kantajaa 17/10/2013 Kirsi Auro 13

14 Julkaistut genominlaajuiset assosiaatiotutkimukset 2012 mennessä NHGRI GWA Catalog

15 We ve Been Picking the Low-hanging fruits...and next?

16 Lisätietoa tarvitaan Kliininen lääketiede Auttavatko geenilöydökset ennustamaan CVD-riskiä? Genetiikka Mitkä ovat tautia ennustavat geenivariantit? Geneettinen epidemiologia Geenien keskinäiset kytkökset ja niiden vaikutukset Tunnetut geenivariantit Solubiologia Mitkä ovat molekyylibiologiset tautimekanismit? Farmakogenetiikka Vaikuttavatko geenilöydäkset myös lääkityksen valintaan/tehoon? Epidemiologia Mitkä ovat väestötason riskit ja mahdolliset interventiot? Fysiologia Miten geenilöydökset vaikuttavat fysiologisella tasolla? Kiitokset: Mark McCarthy 17/10/2013 Kirsi Auro 16

17 Kansainväliset konsortiot yhdistävät voimia ENGAGE, Genetic prediction for type 2 diabetes (T2DM) ENGAGE, genotyping flagship project, Large-scale genotyping of selected causal variants (BMI, HDL, LDL, CHOL, TG, DBP, SBP) CHARGE, FTO/MC4R, Diet and Obesity (dietary intakes, BMI) GIANT, bodyshape GWAS (Weight, Height, BMI, WHR, waist, hip) GIANT, body fat percentage (BFP) GIANT BSA* CHARGE, Diet Score, GIANT SNPs, and BMI, WHR (Dietary intakes, BMI, WHR) CHARGE, GWAS for Fish intake, (Fish and EDA + DHA intakes) GIANT, interaction between genome-wide snp data and physical activity (physical activity) GIANT(?), GWAS of Leptin & Leptin-to-Adiponectin Ratio (Leptin, adiponectin) ICBP (International Consortium for Blood Pressure),Replication and Fine Mapping Experiments for Blood Pressure Traits (SBP, DBP) CARDIoGRAMPlus, Replication of SNPs from the Discovery Studies (MI, CAD) GIANT, Replication of GIANT GWA findings with MORGAM metabochip genotype data (BMI, WC, WHR, HEIGHT, WEIGHT, extreme obesity) ADIPOGen, GWAS of adiponectin, (apidonectin) CHARGE, Drug-Gene GWAS Consortium, UAZ CERT-Classified, QT-Prolonging Drug-Gene Interactions and QT (QT-interval, medication) CHARGE, PharmacoGenetics Workgroup, PhGx QT interval Diuretics use (QT-interval, medication) SUMMIT, diabetic complications, (T1DM, T2DM) CARDIoGRAMPlus, Gene-smoking intearctions in CAD risk (smoking, CAD) Heart Rate Consortium: pulssi MAGIC gender specific: fasting insulin + glucose MAGIC gene-bmi interaction: fasting insulin + glucose + homa-ir + homa-b ENGAGE telomere flagship project: telomere length CHARGE urate: serum urate Kirsi Auro 17

18 17/06/2010 Kirsi Auro 18

19 CARDIoGRAMplusC4D Consortium koronaaritautista ja kontrollia 46 uutta sydäntautilokusta 17/10/2013 Kirsi Auro 19

20 17/10/2013 BIG BIOLOGY / LR2010 / Markus Perola 20

21 28 lokusta, ihmistä Cardiogram-tutkimuksen merkitsevimmät löydökset 12 vuoden seuranta koronaaritautitapausta, CVD-tapausta, 731 akuuttia koronaarisyndroomaa 17/10/2013 Kirsi Auro 21

22 Riskialleelien kantajuus 17/10/2013 Kirsi Auro 22

23 Koronaaritaudin riski desiileittäin 17/10/2013 Kirsi Auro 23

24 Estettyjä kuolemia? Jos 10-20% riskin omaavia, mutta geneettisesti alttiita hoidettaisiin statiineilla, arviolta 135 koronaarikuolemaa 14 vuoden aikana estyisi 17/10/2013 Kirsi Auro 24

25 mmol/l Arvioitu vaikutus seerumin kolesteroliin (Finriski) Medication effect Dietary effect Medication+dietary effect Observed S-Chol Year

26 Geenitestien käsite ja merkitys muuttuu nopeasti Erilaisten geenitestien käytännön merkitys on dramaattisen erilainen ja riippuvainen ihmisen elämänvaiheesta

27 Mikä on hyvä (geeni)testi Pelkkä tieto ei riitä: tiedon tulee hyödyttää myös kliinisesti, tarjota parempaa hoitoa, tarkempaa diagnostiikkaa, ennustetta yms. Osoitus vaikuttavuudesta puuttuu useimmilta geenitesteiltä Turha tieto luo turhaa tuskaa tai valheellista suojauskoa

28 Translational medicine demands more than an advertisement and an information leaflet. Multifaceted evaluation of genetic tests for clinical applications will be a major effort, not only focusing on the test properties but also on the clinical utility Genetic knowledge relevant for daily practice was insufficient in many health-care workers just a few years ago, before the advent of the genome-wide association studies 17/10/2013 Kirsi Auro 28

29 10/17/

30 Onko aika kypsä geenitesteille koronaaritaudissa? Mielenkiintoisia tutkimustuloksia, joilla voi olla tulevaisuudessa merkitystä yhtenä sydäntautityökaluna Interventiotutkimukset vielä puuttuvat Ei ole itsestäänselvää, miten geenitiedon antaminen muokkaa käyttäytymistä muiden riskitekijöiden suhteen. Ennen kuin varauksettomaan kliiniseen käyttöön rynnätään, on syytä tehdä mainittuja interventiotutkimuksia. Voimalaskut vaativat ISON materiaalin kallista 17/10/2013 Kirsi Auro 30

SVT, diabetes ja metabolinen oireyhtymä

SVT, diabetes ja metabolinen oireyhtymä SVT, diabetes ja metabolinen oireyhtymä Veikko Salomaa, MD, PhD Research Professor 10/21/11 SVT, DM, MeTS / Salomaa 1 10/21/11 Presentation name / Author 2 35-64 - vuo*aiden ikävakioitu sepelval*motau*kuolleisuus


Voidaanko geenitiedolla lisätä kansanterveyttä?

Voidaanko geenitiedolla lisätä kansanterveyttä? Voidaanko geenitiedolla lisätä kansanterveyttä? Duodecimin vuosipäivä 14.11.2014 Veikko Salomaa, LKT, tutkimusprofessori 21.11.2014 Esityksen nimi / Tekijä 1 Sidonnaisuudet Ei ole 21.11.2014 Esityksen


Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Markus Perola, LT, geneettisen epidemiologian tutkimusprofessori THL, KATO, GETY Määritelmiä L3/13.9.2012


Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys

Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Yleisten tautien ja ominaisuuksien genetiikka kansantautien perimä ja sen merkitys Markus Perola, LT, geneettisen epidemiologian tutkimusprofessori THL, KATO, GETY Määritelmiä L3/28.8.2013


Ravitsemus näkyy riskitekijöissä FINRISKI 2012 tuloksia

Ravitsemus näkyy riskitekijöissä FINRISKI 2012 tuloksia Ravitsemus näkyy riskitekijöissä FINRISKI 2012 tuloksia Erkki Vartiainen, LKT, professori, ylijohtaja 7.10.2013 1 Jyrkkä lasku sepelvaltimotautikuolleisuudessa Pohjois-Karjala ja koko Suomi 35 64-vuotiaat


Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä


Tieteellinen yhteistyö lääkekehityksessä merkittävistä geenivarianteista (IPHG)

Tieteellinen yhteistyö lääkekehityksessä merkittävistä geenivarianteista (IPHG) 16 BIOPANKKI 16 BIOPANKKI... 1 16.001 Tieteellinen yhteistyö lääkekehityksessä merkittävistä geenivarianteista (IPHG)... 2 16.002 Samuli Ripatti et al.... 2 16.003 Aarno Palotie et al.... 3 16.004 Josine


Suomiko terveyden edistämisen. Tiedätkö, montako diabeetikkoa maassamme on tällä hetkellä?

Suomiko terveyden edistämisen. Tiedätkö, montako diabeetikkoa maassamme on tällä hetkellä? Terveyden edistämisen professori Tiina Laatikainen Kansallinen diabetesfoorumi 15.5.212 Suomiko terveyden edistämisen mallimaa? Tiedätkö, montako diabeetikkoa maassamme on tällä hetkellä? Tyypin 2 Diabetes


Matti Uusitupa 18.5.2011. Uusinta tutkimustietoa rasvoista Mikä on muuttunut vai onko mikään?

Matti Uusitupa 18.5.2011. Uusinta tutkimustietoa rasvoista Mikä on muuttunut vai onko mikään? Matti Uusitupa 18.5.2011 Uusinta tutkimustietoa rasvoista Mikä on muuttunut vai onko mikään? Luennon pääasiallinen sisältö Ateroskleroosin patogeneesi ja LDL-kolesteroli Mistä rasvakeskustelu sai taas



KASVISSYÖJIEN KOLESTEROLI, VERENPAINE JA YLIPAINO KASVISSYÖJIEN KOLESTEROLI, VERENPAINE JA YLIPAINO Näyttöä väestötutkimuksista, 1960 2015 2 Meta- analyysi Tutkimus Maa Vuodet Key ym. 1999 Adven7st Mortality USA 1960 65 Mukana Adven7st


Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä Matti Pirinen Suomen molekyylilääketieteen instituutti (FIMM) Helsingin Yliopisto 17.2.2015 Tilastollisen päättelyn kurssi Kumpula Sisältö


Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012. Lihavuus kansanterveyden haasteena

Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012. Lihavuus kansanterveyden haasteena Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012 Lihavuus kansanterveyden haasteena Lihavuus kuoleman vaaratekijänä Yli 6000 lihavan keskimäärin 15 vuoden seuranta


Kuinka ohjeistaa sydänpotilaan liikuntaa

Kuinka ohjeistaa sydänpotilaan liikuntaa Kuinka ohjeistaa sydänpotilaan liikuntaa Mikko Tulppo, Dos, FT, LitM Verve, Oulu, Finland Oulun Yliopisto, Oulu, Finland Ennenaikaisten kuolemien Syyt USA:ssa (vuosittain) Sydänperäinen äkkikuolema 300.000


Sydän- ja verisuonitautien riskitekijät Suomessa

Sydän- ja verisuonitautien riskitekijät Suomessa Sydän- ja verisuonitautien riskitekijät Suomessa FINRISKI-terveystutkimuksen tuloksia Pekka Jousilahti Tutkimusprofessori, THL 25.10.2014 Kansallinen FINRISKI 2012 -terveystutkimus - Viisi aluetta Suomessa


Suomalaiset vahvuudet

Suomalaiset vahvuudet Suomalaiset vahvuudet Korkealaatuinen terveydenhuoltojärjestelmä Luotettavat terveydenhuollon rekisterit Väestöaineistot ja terveydenhuollon näytekokoelmat Geneettisesti homogeeninen väestö Kansainvälisesti


Terveyttä pohjoismaisesta ruokavaliosta. Ravitsemus Suomessa seminaari Matti Uusitupa, Säätytalo 4.10.2013

Terveyttä pohjoismaisesta ruokavaliosta. Ravitsemus Suomessa seminaari Matti Uusitupa, Säätytalo 4.10.2013 Terveyttä pohjoismaisesta ruokavaliosta Ravitsemus Suomessa seminaari Matti Uusitupa, Säätytalo 4.10.2013 Muuttuva ruokakulttuuri Heränneen kansan arkea ja pyhää, WSOY, 1952 Matti Uusitupa 4.10. 2014 Säätytalo


Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve


HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism

HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism Final SmPC and PL wording agreed by PhVWP December 2011 SUMMARY OF PRODUCT CHARACTERISTICS New Class Warnings


Nuorten ylipainon syitä jäljittämässä

Nuorten ylipainon syitä jäljittämässä SALVE Päätösseminaari 21.11.2012 Nuorten ylipainon syitä jäljittämässä Väestötutkimuksia lihavuuden vaara- ja suojatekijöistä Pohjois-Suomen syntymäkohortissa 1986 Anne Jääskeläinen, TtM Nuorten ylipainon


Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


Dementia ja Alzheimerin tauti Suomessa voidaanko niitä ehkäistä? Miia Kivipelto, MD, PhD Associate Professor

Dementia ja Alzheimerin tauti Suomessa voidaanko niitä ehkäistä? Miia Kivipelto, MD, PhD Associate Professor Dementia ja Alzheimerin tauti Suomessa voidaanko niitä ehkäistä? Miia Kivipelto, MD, PhD Associate Professor VII Valtakunnallinen Kansanterveyspäivä 14.1.11 Voidaanko dementiaa ehkäistä? Taustaa Riskitekijät


Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori


WHO:n globaalit kroonisten tautien ehkäisyn tavoitteet ja niiden toteutuminen Suomessa

WHO:n globaalit kroonisten tautien ehkäisyn tavoitteet ja niiden toteutuminen Suomessa WHO:n globaalit kroonisten tautien ehkäisyn tavoitteet ja niiden toteutuminen Suomessa Erkki Vartiainen, professori, Terveysosaston johtaja 11.10.2016 1 WHO:n globaalit tavoitteet 1. 25% lasku kuolleisuudessa


Pohjois-Suomen syntymäkohortti v seurantatutkimus Diabetes ja sydän- ja verisuonitaudit

Pohjois-Suomen syntymäkohortti v seurantatutkimus Diabetes ja sydän- ja verisuonitaudit Pohjois-Suomen syntymäkohorttitutkimus Yleisöluento 12.11.2016, Oulu Pohjois-Suomen syntymäkohortti 1966 46v seurantatutkimus Diabetes ja sydän- ja verisuonitaudit Sirkka Keinänen-Kiukaanniemi, professori,



MIKÄ ON TÄRKEINTÄ RUOKAVALIOSSA RASVAN MÄÄRÄ VAI LAATU. Matti Uusitupa 15.012010 MIKÄ ON TÄRKEINTÄ RUOKAVALIOSSA RASVAN MÄÄRÄ VAI LAATU Matti Uusitupa 15.012010 Ruokavalio ja rasvan laatu Veren rasva arvot ja lipoproteiinit +++ Verenpaine + Endoteelifunktio + Insuliiniherkkyys + Tulehdustekijät


Helsingin Johtajatutkimus 1964-2005. 1919-34 syntyneiden johtajien 26-39 vuoden seurantatutkimus

Helsingin Johtajatutkimus 1964-2005. 1919-34 syntyneiden johtajien 26-39 vuoden seurantatutkimus Helsingin Johtajatutkimus 1964-05 Timo Strandberg Geriatrian professori Oulun yliopisto Helsingin Johtajatutkimus 1964-05 Elämänlaatu, successful aging, compression of morbidity Painonmuutoksen merkitys


Suomalaisten veren kolesterolitasot ja rasvan ruokavaliossa FINRISKI 2012-tutkimuksen mukaan

Suomalaisten veren kolesterolitasot ja rasvan ruokavaliossa FINRISKI 2012-tutkimuksen mukaan Suomalaisten veren kolesterolitasot ja rasvan ruokavaliossa FINRISKI 2012-tutkimuksen mukaan Erkki Vartiainen, LKT, professori, ylijohtaja 25.11.2012 1 Kolesterolitason muutokset 1982-2012 Miehet 6,4 6,2


Tupakkapoliittisten toimenpiteiden vaikutus. Satu Helakorpi Terveyden edistämisen ja kroonisten tautien ehkäisyn osasto Terveyden edistämisen yksikkö

Tupakkapoliittisten toimenpiteiden vaikutus. Satu Helakorpi Terveyden edistämisen ja kroonisten tautien ehkäisyn osasto Terveyden edistämisen yksikkö Tupakkapoliittisten toimenpiteiden vaikutus Satu Helakorpi Terveyden edistämisen ja kroonisten tautien ehkäisyn osasto Terveyden edistämisen yksikkö Päivittäin tupakoivien osuus (%) 1978 2006 % 50 40 30





Pekka Puska Pääjohtaja Terveyden ja hyvinvoinnin laitos (THL) Miten potilaiden ja väestön riskikäyttäytymiseen voidaan vaikuttaa?

Pekka Puska Pääjohtaja Terveyden ja hyvinvoinnin laitos (THL) Miten potilaiden ja väestön riskikäyttäytymiseen voidaan vaikuttaa? Pekka Puska Pääjohtaja Terveyden ja hyvinvoinnin laitos (THL) Miten potilaiden ja väestön riskikäyttäytymiseen voidaan vaikuttaa? Kansanterveyspäivä, Helsinki 23.11.2012 Kansantautien (elintapasairauksien)


METELI-projekti lopetuskokous 12.4.2005

METELI-projekti lopetuskokous 12.4.2005 METELI-projekti lopetuskokous 12.4.2005 -hankkeen tavoite -keskeiset tulokset, kliininen ja kineettiset kokeet -johtopäätökset Hankkeen tavoite Tuottaa tietoa antioksidatiivisesti vaikuttavien, terveysvaikutteisten


Lihavuus ja liitännäissairaudet

Lihavuus ja liitännäissairaudet Rasvahapot valtimotaudin vaaran arvioinnissa Lihavuus ja liitännäissairaudet Antti Jula, ylilääkäri, sisätautiopin dosentti, THL VIII Valtakunnallinen Kansanterveyspäivä 12.12.2011 Lihavuus ja liitännäissairaudet


Miten pidetään sydäninfarktin sairastanut hengissä?

Miten pidetään sydäninfarktin sairastanut hengissä? Miten pidetään sydäninfarktin sairastanut hengissä? Yleislääkäreiden kevätkokous, 13.05.2016 Veikko Salomaa, tutkimusprofessori Sidonnaisuudet: ei ole 14.5.2016 Esityksen nimi / Tekijä 1 Korkea riski Sydäninfarktin


Metabolinen oireyhtymä tyypin 1 diabeteksessa

Metabolinen oireyhtymä tyypin 1 diabeteksessa Metabolinen oireyhtymä tyypin 1 diabeteksessa Lena Thorn HYKS, sisätaudit, nefrologian klinikka, Biomedicum Helsinki Sipoon terveyskeskus VIII Valtakunnallinen diabetespäivä 12.11.2009, Dipoli, Espoo Väitöskirjan


Mikko Syvänne. Dosentti, ylilääkäri Suomen Sydänliitto ry. Valtimotautien riskitekijät ja riskiyksilöiden tunnistaminen MS 13.10.

Mikko Syvänne. Dosentti, ylilääkäri Suomen Sydänliitto ry. Valtimotautien riskitekijät ja riskiyksilöiden tunnistaminen MS 13.10. Mikko Syvänne Dosentti, ylilääkäri Suomen Sydänliitto ry Valtimotautien riskitekijät ja riskiyksilöiden tunnistaminen MS 13.10.2010 1 Klassiset valtimotaudin riskitekijät Kohonnut veren kolesteroli Kohonnut


Kun farkut vaihtuu lökäreihin koululaisten ylipainosta. Harri Niinikoski Dosentti, osastonylilääkäri TYKS lasten- ja nuortenklinikka Kevät 2013

Kun farkut vaihtuu lökäreihin koululaisten ylipainosta. Harri Niinikoski Dosentti, osastonylilääkäri TYKS lasten- ja nuortenklinikka Kevät 2013 Kun farkut vaihtuu lökäreihin koululaisten ylipainosta Harri Niinikoski Dosentti, osastonylilääkäri TYKS lasten- ja nuortenklinikka Kevät 2013 4/2013 1 Outline Uusia tutkimustuloksia ylipainoisuuden yleisyydestä


Monilääkityksen yhteys ravitsemustilaan, fyysiseen toimintakykyyn ja kognitiiviseen kapasiteettiin iäkkäillä

Monilääkityksen yhteys ravitsemustilaan, fyysiseen toimintakykyyn ja kognitiiviseen kapasiteettiin iäkkäillä Monilääkityksen yhteys ravitsemustilaan, fyysiseen toimintakykyyn ja kognitiiviseen kapasiteettiin iäkkäillä FaT, tutkija Johanna Jyrkkä Lääkehoitojen arviointi -prosessi Lääkealan turvallisuus- ja kehittämiskeskus,


Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen 20.2.2017 Esityksen nimi / Tekijä 1 Tutkimus helpottuu ja hankaloituu + Tiedon käsittely ja monet laboratoriomenetelmät kehittyvät tuottaen


Sosioekonomisen aseman ja suvun diabetestaustan vaikutus elintapaohjauksen tehoon D2Dhankkeessa. Diabeteksen ehkäisy kannattaa- seminaari 27.9.

Sosioekonomisen aseman ja suvun diabetestaustan vaikutus elintapaohjauksen tehoon D2Dhankkeessa. Diabeteksen ehkäisy kannattaa- seminaari 27.9. Sosioekonomisen aseman ja suvun diabetestaustan vaikutus elintapaohjauksen tehoon D2Dhankkeessa TUTKIJARYHMÄ: Nina Rautio, Pirkanmaan shp, Jari Jokelainen, Oulun yliopisto Heikki Oksa,


Mitä uudet intensiivihoitotutkimukset kertovat meille hyperglykemian hoidosta

Mitä uudet intensiivihoitotutkimukset kertovat meille hyperglykemian hoidosta Mitä uudet intensiivihoitotutkimukset kertovat meille hyperglykemian hoidosta Leena Moilanen, dosentti Sisätautien ja endokrinologian erikoislääkäri Sisätautien klinikka KYS Valtakunnallinen diabetespäivä


Milloin määrittää ja miten seurata D-vitamiinipitoisuuksia? Christel Lamberg-Allardt 27.11.2014 Yleislääkärit

Milloin määrittää ja miten seurata D-vitamiinipitoisuuksia? Christel Lamberg-Allardt 27.11.2014 Yleislääkärit Milloin määrittää ja miten seurata D-vitamiinipitoisuuksia? Christel Lamberg-Allardt 27.11.2014 Yleislääkärit Jones 2013 Jones 2013 Jones 2013 Norman and Bouillon 2013 Norman and Bouillon 2013 D-vitamiiniitilanteen


Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä


Elämänkulku ja vanheneminen

Elämänkulku ja vanheneminen Elämänkulku ja vanheneminen Taina Rantanen Gerontologian ja kansanterveyden professori Gerontologian tutkimuskeskus Terveystieteiden laitos Jyväskylän yliopisto Miksi tutkia pitkäikäisyyttä ja vanhuuden


Pohjois-Karjalasta maailmalle Onko terveydenhuollolla roolia terveyden edistämisessä vai tulisiko panostus olla yhteiskunnallisessa kehittämisessä?

Pohjois-Karjalasta maailmalle Onko terveydenhuollolla roolia terveyden edistämisessä vai tulisiko panostus olla yhteiskunnallisessa kehittämisessä? Pekka Puska, professori Ex pääjohtaja, THL Presidentti, Kansanterveyslaitosten Maailmanjärjestö (IANPHI) Pohjois-Karjalasta maailmalle Onko terveydenhuollolla roolia terveyden edistämisessä vai tulisiko


Sepelvaltimotaudin riskitekijät ja riski koulutusryhmittäin

Sepelvaltimotaudin riskitekijät ja riski koulutusryhmittäin TUTKIMUKSESTA TIIVIISTI 9 TOUKOKUU 2016 1982 2012 Päälöydökset Miesten tupakointi väheni eniten ylimmässä koulutusryhmässä. Naisten tupakointi lisääntyi alimmassa koulutusryhmässä ja väheni ylimmässä.


Terveyden edistämistä molemmin puolin rajaa

Terveyden edistämistä molemmin puolin rajaa Terveyden edistämistä molemmin puolin rajaa Vesa Korpelainen toiminnanjohtaja Pohjois-Karjalan kansanterveyden keskus Pohjois-Karjala mallina Suomessa N Pitkäranta mallina Karjalan


Onko testosteronihoito turvallista?

Onko testosteronihoito turvallista? Onko testosteronihoito turvallista? Antti Saraste kardiologi, apulaisprofessori Sydänkeskus ja Valtakunnallinen PET keskus, TYKS ja Turun yliopisto, Turku Reproduktioendokrinologia 12.2.2016 J Am Coll


Tyypin 2 diabeteksen ehkäisyohjelma: Dehkon 2D-hankkeen (D2D) arviointitutkimus

Tyypin 2 diabeteksen ehkäisyohjelma: Dehkon 2D-hankkeen (D2D) arviointitutkimus Tyypin 2 diabeteksen ehkäisyohjelma: Dehkon 2D-hankkeen (D2D) arviointitutkimus Markku Peltonen PhD, dosentti, yksikön päällikkö Terveyden ja hyvinvoinnin laitos 30.11.2011 Terveydenhuoltotutkimuksen päivät


Onnistummeko HIV-potilaiden kardiovaskulaaririskien hoidossa? Pia Kivelä 11.2.2015

Onnistummeko HIV-potilaiden kardiovaskulaaririskien hoidossa? Pia Kivelä 11.2.2015 Onnistummeko HIV-potilaiden kardiovaskulaaririskien hoidossa? Pia Kivelä 11.2.2015 Mitä HIV-potilaiden kardiovaskulaaritautien riskit ovat? Mitä pitäisi tehdä ja kenelle? Olemmeko onnistuneet? Mitä voisimme


Tyypin 2 diabeteksen ennaltaehkäisy väestötasollatasolla

Tyypin 2 diabeteksen ennaltaehkäisy väestötasollatasolla Yhteiset kansanterveytemme haasteet riskitiedoista toimintaan Tyypin 2 diabeteksen ennaltaehkäisy väestötasollatasolla Markku Peltonen PhD,, dosentti, yksikön n pääp äällikkö Diabetesyksikkö Terveyden


Suomalaisten verenpaine FINRISKI 2012 tutkimuksen mukaan

Suomalaisten verenpaine FINRISKI 2012 tutkimuksen mukaan Suomalaisten verenpaine FINRISKI 2012 tutkimuksen mukaan Tiina Laatikainen, LT, tutkimusprofessori 24.11.2012 1 Kohonnut verenpaine Lisää riskiä sairastua sydän- ja verisuonitauteihin Sepelvaltimotaudin


Mitä ylipaino ja metabolinen oireyhtymä tekevät verenkiertoelimistön säätelylle? SVPY:n syyskokous 5.9.2015 Pauliina Kangas, EL Tampereen yliopisto

Mitä ylipaino ja metabolinen oireyhtymä tekevät verenkiertoelimistön säätelylle? SVPY:n syyskokous 5.9.2015 Pauliina Kangas, EL Tampereen yliopisto Mitä ylipaino ja metabolinen oireyhtymä tekevät verenkiertoelimistön säätelylle? SVPY:n syyskokous 5.9.2015 Pauliina Kangas, EL Tampereen yliopisto Taustaa q Metabolinen oireyhtymä (MBO, MetS) on etenkin


Renewing Health Projekti, Eksote. Tuula Karhula

Renewing Health Projekti, Eksote. Tuula Karhula Renewing Health Projekti, Eksote Tuula Karhula Etelä-Karjalan sosiaali- ja terveyspiiri, Eksote! Vastaamme alueemme sosiaali- ja terveydenhuollon kokonaisuudesta Väestö 133.000 Budjetti 400 M Työntekijöitä


Suolan terveyshaitat ja kustannukset

Suolan terveyshaitat ja kustannukset Suolan terveyshaitat ja kustannukset Antti Jula, ylilääkäri, sisätautiopin dosentti, THL Seminaari Suola Näkymätön vaara 8.2.2011 Verenpaine ja aivohalvauskuolleisuus Prospective Studies Collaboration,


Ainoa tapa pysyä terveenä on syödä sitä mitä ei halua, juoda sitä mistä ei pidä ja tehdä sitä minkä mieluummin jättäisi tekemättä

Ainoa tapa pysyä terveenä on syödä sitä mitä ei halua, juoda sitä mistä ei pidä ja tehdä sitä minkä mieluummin jättäisi tekemättä Tyypin 2 diabeteksen ja metabolisen oireyhtymän ennaltaehkäisy elintapamuutos vai lääkehoito? Ainoa tapa pysyä terveenä on syödä sitä mitä ei halua, juoda sitä mistä ei pidä ja tehdä sitä minkä mieluummin


Uusia mahdollisuuksia FoundationOne

Uusia mahdollisuuksia FoundationOne Uusia mahdollisuuksia FoundationOne FI/FMI/1703/0019 Maaliskuu 2017 FoundationOne -palvelu FoundationOne on kattava genomianalysointipalvelu, jossa tutkitaan 315 geenistä koko koodaava alue sekä 28 geenistä


Ylidiagnostiikkaa: onko kohta enää terveitä? LL Iris Pasternack HYKS Psykiatrian klinikka, tiistailuento 25.2.2014

Ylidiagnostiikkaa: onko kohta enää terveitä? LL Iris Pasternack HYKS Psykiatrian klinikka, tiistailuento 25.2.2014 Ylidiagnostiikkaa: onko kohta enää terveitä? LL Iris Pasternack HYKS Psykiatrian klinikka, tiistailuento 25.2.2014 The New York Times Feb 11 2014 Miller A et al. 25 year follow up for breast cancer incidence


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Timo Saaristo VALTIMOTERVEYDEKSI! Valtimoterveyttä kaikille -miksi?

Timo Saaristo VALTIMOTERVEYDEKSI! Valtimoterveyttä kaikille -miksi? Timo Saaristo VALTIMOTERVEYDEKSI! Valtimoterveyttä kaikille -miksi? Sepelvaltimotauti Ei ole vielä voitettu Olisi 80%:sti ehkäistävissä, jos syötäisiin terveellisimmin, liikuttaisiin enemmän ja vältettäisiin


Alzheimerin taudin ehkäisy

Alzheimerin taudin ehkäisy Alzheimerin taudin ehkäisy Tiia Ngandu MD, PhD 5.9.2012 Karjalan XII Lääketiedepäivät/ Tiia Ngandu 1 Alzheimerin taudin ennaltaehkäisy Taustaa Vaara- ja suojatekijät Interventiotutkimukset 5.9.2012 Karjalan


Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta


Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän


Biopankit miksi ja millä ehdoilla?

Biopankit miksi ja millä ehdoilla? Suomalaisen Tiedeakatemian 100 v-symposium, Helsinki 4.9.2008 Biopankit miksi ja millä ehdoilla? Juha Kere Karolinska Institutet, Stockholm, Sverige ja Helsingin yliopisto Tautien tutkimus Geeni/ valkuaisaine


Kohonnut verenpaine Vaitelias vaaratekijä. Kimmo Kontula Sisätautiopin professori, ylilääkäri HY ja HYKS Labquality Days 11.02.

Kohonnut verenpaine Vaitelias vaaratekijä. Kimmo Kontula Sisätautiopin professori, ylilääkäri HY ja HYKS Labquality Days 11.02. Kohonnut verenpaine Vaitelias vaaratekijä Kimmo Kontula Sisätautiopin professori, ylilääkäri HY ja HYKS Labquality Days 11.02.2016 Ihmiskunnan kriittisen tärkeät sairaudet ja riskitekijät Global Burden


Kahvin juonti keski-iässä ja myöhäisiän dementiariski: väestöpohjainen CAIDE -tutkimus

Kahvin juonti keski-iässä ja myöhäisiän dementiariski: väestöpohjainen CAIDE -tutkimus CARDIOVASCULAR RISK FACTORS, AGING AND DEMENTIA - Sydän- ja verisuonitautien Riskitekijät, t, Ikää ääntyminen ja Dementia Kahvin juonti keski-iässä ja myöhäisiän dementiariski: väestöpohjainen CAIDE -tutkimus


Vaikuttava ja yksilöllinen liikuntahoito työterveydenhuollossa

Vaikuttava ja yksilöllinen liikuntahoito työterveydenhuollossa Vaikuttava ja yksilöllinen liikuntahoito työterveydenhuollossa LL Sergei Iljukov Liikuntalääketieteeseen erikoistuva lääkäri Kuopion liikuntalääketieteen tutkimuslaitos Terveys on täydellinen fyysisen,


April 21, 2015. FIMM - Institute for Molecular Medicine Finland

April 21, 2015. FIMM - Institute for Molecular Medicine Finland April 21, 2015 FIMM - Institute for Molecular Medicine Finland Tutkimus Soveltaminen Miten ihmiset suhtautuvat geenitietoonsa KardioKompassi tutkimuksesta opittua Mari Kaunisto, FIMM 16.4.2015 Sitran teettämä


The relationship between leisuretime physical activity and work stress with special reference to heart rate variability analyses

The relationship between leisuretime physical activity and work stress with special reference to heart rate variability analyses The relationship between leisuretime physical activity and work stress with special reference to heart rate variability analyses Teisala Tiina, TtM, tohtorikoulutettava Jyväskylän yliopisto Terveystieteiden


Diabetes, ylipaino ja ilmailulääketiede. Leena Moilanen, dosentti Sisätautien ja endokrinologian erikoislääkäri KYS 19.9.2010

Diabetes, ylipaino ja ilmailulääketiede. Leena Moilanen, dosentti Sisätautien ja endokrinologian erikoislääkäri KYS 19.9.2010 Diabetes, ylipaino ja ilmailulääketiede Leena Moilanen, dosentti Sisätautien ja endokrinologian erikoislääkäri KYS 19.9.2010 Esityksen sisältö T2DM epidemiologiaa Lihavuuden epidemiologiaa Diabeetikoiden


Iäkkään verenpaineen hoito. Antti Jula Geriatripäivät 2012, 26.1.2012 Turku

Iäkkään verenpaineen hoito. Antti Jula Geriatripäivät 2012, 26.1.2012 Turku Iäkkään verenpaineen hoito Antti Jula Geriatripäivät 2012, 26.1.2012 Turku Verenpaine ja aivohalvauskuolleisuus Prospective Studies Collaboration, Lancet 2002;360:1903-13 Verenpaine ja sepelvaltimotautikuolleisuus



TM ETRS-TM35FIN-ETRS89 WTG VE1 SHADOW - Main Result Calculation: 8 x Nordex N131 x HH145m Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please


Verenpaine,sen säätely ja käyttäytyminen levossa ja rasituksessa. Jyrki Taurio Sisätautilääkäri TAYS/PSS 25.10.2012

Verenpaine,sen säätely ja käyttäytyminen levossa ja rasituksessa. Jyrki Taurio Sisätautilääkäri TAYS/PSS 25.10.2012 Verenpaine,sen säätely ja käyttäytyminen levossa ja rasituksessa Jyrki Taurio Sisätautilääkäri TAYS/PSS 25.10.2012 Kohonnut verenpaine Yleisin yleislääkärille tehtävän vastaanottokäynnin aihe Lääkitys


WindPRO version joulu 2012 Printed/Page :47 / 1. SHADOW - Main Result

WindPRO version joulu 2012 Printed/Page :47 / 1. SHADOW - Main Result SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579


Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122

Bioinformatiikan maisteriohjelman infotilaisuus Exactum D122 Bioinformatiikan maisteriohjelman infotilaisuus 15.11.2007 Exactum D122 Bio- ja lääketieteiden opiskelu MBImaisteriohjelmassa Outi Monni, Dos, FT Biolääketieteen laitos 15.11.2007 Bioinformatiikan maisteriohjelma


GEENIT SKITSOFRENIAN AIHEUTTAJANA. Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9.

GEENIT SKITSOFRENIAN AIHEUTTAJANA. Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9. GEENIT SKITSOFRENIAN AIHEUTTAJANA Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9.2009 SKITSOFRENIAN ETIOLOGIAA Hermoston kehityksen häiriö Poikkeava neurotransmissio


Accommodation statistics

Accommodation statistics Transport and Tourism 2011 Accommodation statistics 2011, January Nights spent by foreign tourists in Finland increased by per cent in January The number of recorded nights spent by foreign tourists at


Tupakointi ja geenit. Jaakko Kaprio HY ja KTL

Tupakointi ja geenit. Jaakko Kaprio HY ja KTL Tupakointi ja geenit Jaakko Kaprio HY ja KTL Kansantautien geneettinen tausta Monitekijäisiä Mikä on geenien merkitys Miten tauti periytyy? (yksi geeni vai monitekijäinen tauti)? Tavoitteeni tunnistaa



1.9.2006/SRI,AR TYYPIN 2 DIABETES VAARATEKIJÄT 1.9.2006/SRI,AR TYYPIN 2 DIABETES VAARATEKIJÄT 1. HOMA indeksit...2 2. Metabolisen oireyhtymän liittyviä vaaratekijöitä...3 3. Metabolisen oireyhtymän esiintyvyyttä kuvaavat muuttujat...7 1 1. HOMA indeksit


Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:


Terveysalan uudistaminen yritysten, korkeakoulujen ja palvelujärjestelmän yhteistyöllä 15.4.2015

Terveysalan uudistaminen yritysten, korkeakoulujen ja palvelujärjestelmän yhteistyöllä 15.4.2015 Terveysalan uudistaminen yritysten, korkeakoulujen ja palvelujärjestelmän yhteistyöllä 15.4.2015 Reijo Salonen Johtaja, Lääketutkimus ja kehitys Orion Yliopistot Terveydenhoito Teollisuus Kolme pilaria,


Diabetes mellitus, diagnostiikka

Diabetes mellitus, diagnostiikka Diabetes mellitus, diagnostiikka Tiimiklubi 26.10.2013 Diabetes mellitus Paastoglukoosi tai 2-tunnin glukoosi* tai HbA1c Heikentynyt glukoosinsieto (IGT) 2-tunnin glukoosi* Onko tutkittavalla diabetes?



TM ETRS-TM35FIN-ETRS89 WTG SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.9.269






DOSE-RESPONSES TO EXERCISE TRAINING - DR's EXTRA KANSANELÄKELAITOS/ Tutkimussopimus Dnro 4/26/2010 Loppuraportti 04.08.2014 DOSE-RESPONSES TO EXERCISE TRAINING - DR's EXTRA - A Randomized Controlled 4-year Trial on the Effects of Regular Physical Exercise


Metsälamminkankaan tuulivoimapuiston osayleiskaava

Metsälamminkankaan tuulivoimapuiston osayleiskaava VAALAN KUNTA TUULISAIMAA OY Metsälamminkankaan tuulivoimapuiston osayleiskaava Liite 3. Varjostusmallinnus FCG SUUNNITTELU JA TEKNIIKKA OY 12.5.2015 P25370 SHADOW - Main Result Assumptions for shadow calculations


Data quality points. ICAR, Berlin,

Data quality points. ICAR, Berlin, Data quality points an immediate and motivating supervision tool ICAR, Berlin, 22.5.2014 Association of ProAgria Centres Development project of Milk Recording Project manager, Heli Wahlroos



TM ETRS-TM35FIN-ETRS89 WTG SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579



TM ETRS-TM35FIN-ETRS89 WTG SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 5.11.2013 16:44 / 1 Minimum


GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma

GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma Miika Linna, dos. TkT. Aalto-yliopisto HEMA / Terveyden ja hyvinvoinnin laitos Taustaa Uudet genomitietoon perustuvat hoidon


RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla

RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua


Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet



TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti


Valintakoe klo Liikuntalääketiede/Itä-Suomen yliopisto

Valintakoe klo Liikuntalääketiede/Itä-Suomen yliopisto Valintakoe klo 13-16 12.5.2015 Liikuntalääketiede/Itä-Suomen yliopisto Mediteknia Nimi Henkilötunnus Tehtävä 1 (max 8 pistettä) Saatte oheisen artikkelin 1 Exercise blood pressure and the risk for future


Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen käyttöön liittyviä haasteita Juhani Eskola 310505 7.6.2005 1 Valitut painopistealueet Kansantautien ja terveyden geenitausta Mikrobit ja



TM ETRS-TM35FIN-ETRS89 WTG SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579


Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes)

Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes) SYLY- päivät 2014 Helsinki 28.11.2014 Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes) Diabeteslääkäri Mikko Honkasalo Nurmijärven terveyskeskus


WindPRO version joulu 2012 Printed/Page :42 / 1. SHADOW - Main Result

WindPRO version joulu 2012 Printed/Page :42 / 1. SHADOW - Main Result SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 13.6.2013 19:42 / 1 Minimum


( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145

( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145 OX2 9 x N131 x HH145 Rakennuskanta Asuinrakennus Lomarakennus Liike- tai julkinen rakennus Teollinen rakennus Kirkko tai kirkollinen rak. Muu rakennus Allas Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 2 km


,0 Yes ,0 120, ,8

,0 Yes ,0 120, ,8 SHADOW - Main Result Calculation: Alue 2 ( x 9 x HH120) TuuliSaimaa kaavaluonnos Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered


Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a

Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a , Tuulivoimahanke Layout 9 x N131 x HH145 Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 km 2 SHADOW - Main Result Assumptions for shadow calculations
