GEENIT JA KORONAARITAUDIN RISKI

Koko: px
Aloita esitys sivulta:

Download "GEENIT JA KORONAARITAUDIN RISKI"

Transkriptio

1 GEENIT JA KORONAARITAUDIN RISKI LT Kirsi Auro 17/10/2013 1

2 Aiheet Sydän- ja verisuonitautien preventiosta Suomessa Geneettiset riskilaskut Loppupäätelmät

3 Sydän- ja verisuonitautien riskitekijöitä Sukupuoli (mies) Ikä Sukurasite Tupakointi Ylipaino Epäedullinen rasvaprofiili Korkea verenpaine Geenit geneettinen tausta monitekijäinen 17/10/2013 Kirsi Auro 3

4 Minä lähden Pohjois-Karjalaan Erkki Vartiainen

5 Voin käyttö leivällä (miehet iät 30-59) % North Karelia Kuopio province Southwest Finland Helsinki area Oulu province Lapland province Erkki Vartiainen

6 Ikävakioitu sepelvaltimotautikuolleisuus vuotiailla miehillä ja naisilla ajanjaksolla Mortality/ Erkki Vartiainen

7 Prosenttiosuus miehistä, jotka tuntevat terveytensä hyväksi tai erittäin hyväksi Erkki Vartiainen

8 Havaittu ja ennustettavissa oleva koronaaritaudin kuolleisuus miehissä % Year Observed All risk factors Cholesterol Diastolic BP Smoking

9 ACS:sta hengissä selvinneiden prevalenssi >35 vuotiailla miehillä ja naisilla FINAMI / Veikko Salomaa 9

10 Suomi vanhenee Suomen väestö ikääntyy nopeasti ja on esitetty huoli, että väestön vanheneminen voi lisätä sepelvaltimotautikohtausten lukumääriä huomattavasti tulevaisuudessa ja aiheuttaa kuormitusta terveydenhuoltojärjestelmälle 17/10/2013 Kirsi Auro 10

11 Summa summarum Ikävakioitu sepelvaltimotautikohtausten ja kuolleisuuden esiintyvyys on ollut voimakkaassa laskussa Dramaattinen muutos CVD-sairastavuudessa luvulta alkaen on selitettävissä pääosin muokattavien riskitekijöiden avulla Sydäninfarktin diagnostiset kriteerit ja infarktivauriota heijastavat biomarkkerit ovat muuttuneet jatkuvasti Kirsi Auro 11

12 Teknologian riemuvoitto yksi variantti (10 0 SNP; 10 3 genotyyppiä) Yhden geenin tarkka läpikäynti (10 2 SNPiä; genotyyppiä) Alueen kattava tutkimus (10 4 SNPiä; 10 8 genotyyppiä) genome-wide association (GWA) (10 6 SNPiä; genotyyppiä) Genomin resekvensointi (10 8 SNPiä / genotyyppiä)

13 Familiaalinen hyperkolesterolemia - geenivirhe LDL-reseptorissa johtaa korkeaan kolesterolitasoon - Suomessa arviolta geenivirheen kantajaa 17/10/2013 Kirsi Auro 13

14 Julkaistut genominlaajuiset assosiaatiotutkimukset 2012 mennessä NHGRI GWA Catalog

15 We ve Been Picking the Low-hanging fruits...and next?

16 Lisätietoa tarvitaan Kliininen lääketiede Auttavatko geenilöydökset ennustamaan CVD-riskiä? Genetiikka Mitkä ovat tautia ennustavat geenivariantit? Geneettinen epidemiologia Geenien keskinäiset kytkökset ja niiden vaikutukset Tunnetut geenivariantit Solubiologia Mitkä ovat molekyylibiologiset tautimekanismit? Farmakogenetiikka Vaikuttavatko geenilöydäkset myös lääkityksen valintaan/tehoon? Epidemiologia Mitkä ovat väestötason riskit ja mahdolliset interventiot? Fysiologia Miten geenilöydökset vaikuttavat fysiologisella tasolla? Kiitokset: Mark McCarthy 17/10/2013 Kirsi Auro 16

17 Kansainväliset konsortiot yhdistävät voimia ENGAGE, Genetic prediction for type 2 diabetes (T2DM) ENGAGE, genotyping flagship project, Large-scale genotyping of selected causal variants (BMI, HDL, LDL, CHOL, TG, DBP, SBP) CHARGE, FTO/MC4R, Diet and Obesity (dietary intakes, BMI) GIANT, bodyshape GWAS (Weight, Height, BMI, WHR, waist, hip) GIANT, body fat percentage (BFP) GIANT BSA* CHARGE, Diet Score, GIANT SNPs, and BMI, WHR (Dietary intakes, BMI, WHR) CHARGE, GWAS for Fish intake, (Fish and EDA + DHA intakes) GIANT, interaction between genome-wide snp data and physical activity (physical activity) GIANT(?), GWAS of Leptin & Leptin-to-Adiponectin Ratio (Leptin, adiponectin) ICBP (International Consortium for Blood Pressure),Replication and Fine Mapping Experiments for Blood Pressure Traits (SBP, DBP) CARDIoGRAMPlus, Replication of SNPs from the Discovery Studies (MI, CAD) GIANT, Replication of GIANT GWA findings with MORGAM metabochip genotype data (BMI, WC, WHR, HEIGHT, WEIGHT, extreme obesity) ADIPOGen, GWAS of adiponectin, (apidonectin) CHARGE, Drug-Gene GWAS Consortium, UAZ CERT-Classified, QT-Prolonging Drug-Gene Interactions and QT (QT-interval, medication) CHARGE, PharmacoGenetics Workgroup, PhGx QT interval Diuretics use (QT-interval, medication) SUMMIT, diabetic complications, (T1DM, T2DM) CARDIoGRAMPlus, Gene-smoking intearctions in CAD risk (smoking, CAD) Heart Rate Consortium: pulssi MAGIC gender specific: fasting insulin + glucose MAGIC gene-bmi interaction: fasting insulin + glucose + homa-ir + homa-b ENGAGE telomere flagship project: telomere length CHARGE urate: serum urate Kirsi Auro 17

18 17/06/2010 Kirsi Auro 18

19 CARDIoGRAMplusC4D Consortium koronaaritautista ja kontrollia 46 uutta sydäntautilokusta 17/10/2013 Kirsi Auro 19

20 17/10/2013 BIG BIOLOGY / LR2010 / Markus Perola 20

21 28 lokusta, ihmistä Cardiogram-tutkimuksen merkitsevimmät löydökset 12 vuoden seuranta koronaaritautitapausta, CVD-tapausta, 731 akuuttia koronaarisyndroomaa 17/10/2013 Kirsi Auro 21

22 Riskialleelien kantajuus 17/10/2013 Kirsi Auro 22

23 Koronaaritaudin riski desiileittäin 17/10/2013 Kirsi Auro 23

24 Estettyjä kuolemia? Jos 10-20% riskin omaavia, mutta geneettisesti alttiita hoidettaisiin statiineilla, arviolta 135 koronaarikuolemaa 14 vuoden aikana estyisi 17/10/2013 Kirsi Auro 24

25 mmol/l Arvioitu vaikutus seerumin kolesteroliin (Finriski) Medication effect Dietary effect Medication+dietary effect Observed S-Chol Year

26 Geenitestien käsite ja merkitys muuttuu nopeasti Erilaisten geenitestien käytännön merkitys on dramaattisen erilainen ja riippuvainen ihmisen elämänvaiheesta

27 Mikä on hyvä (geeni)testi Pelkkä tieto ei riitä: tiedon tulee hyödyttää myös kliinisesti, tarjota parempaa hoitoa, tarkempaa diagnostiikkaa, ennustetta yms. Osoitus vaikuttavuudesta puuttuu useimmilta geenitesteiltä Turha tieto luo turhaa tuskaa tai valheellista suojauskoa

28 Translational medicine demands more than an advertisement and an information leaflet. Multifaceted evaluation of genetic tests for clinical applications will be a major effort, not only focusing on the test properties but also on the clinical utility Genetic knowledge relevant for daily practice was insufficient in many health-care workers just a few years ago, before the advent of the genome-wide association studies 17/10/2013 Kirsi Auro 28

29 10/17/

30 Onko aika kypsä geenitesteille koronaaritaudissa? Mielenkiintoisia tutkimustuloksia, joilla voi olla tulevaisuudessa merkitystä yhtenä sydäntautityökaluna Interventiotutkimukset vielä puuttuvat Ei ole itsestäänselvää, miten geenitiedon antaminen muokkaa käyttäytymistä muiden riskitekijöiden suhteen. Ennen kuin varauksettomaan kliiniseen käyttöön rynnätään, on syytä tehdä mainittuja interventiotutkimuksia. Voimalaskut vaativat ISON materiaalin kallista 17/10/2013 Kirsi Auro 30

SVT, diabetes ja metabolinen oireyhtymä

SVT, diabetes ja metabolinen oireyhtymä SVT, diabetes ja metabolinen oireyhtymä Veikko Salomaa, MD, PhD Research Professor 10/21/11 SVT, DM, MeTS / Salomaa 1 10/21/11 Presentation name / Author 2 35-64 - vuo*aiden ikävakioitu sepelval*motau*kuolleisuus

Lisätiedot

Voidaanko geenitiedolla lisätä kansanterveyttä?

Voidaanko geenitiedolla lisätä kansanterveyttä? Voidaanko geenitiedolla lisätä kansanterveyttä? Duodecimin vuosipäivä 14.11.2014 Veikko Salomaa, LKT, tutkimusprofessori 21.11.2014 Esityksen nimi / Tekijä 1 Sidonnaisuudet Ei ole 21.11.2014 Esityksen

Lisätiedot

Ravitsemus näkyy riskitekijöissä FINRISKI 2012 tuloksia

Ravitsemus näkyy riskitekijöissä FINRISKI 2012 tuloksia Ravitsemus näkyy riskitekijöissä FINRISKI 2012 tuloksia Erkki Vartiainen, LKT, professori, ylijohtaja 7.10.2013 1 Jyrkkä lasku sepelvaltimotautikuolleisuudessa Pohjois-Karjala ja koko Suomi 35 64-vuotiaat

Lisätiedot

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä

Lisätiedot

Suomiko terveyden edistämisen. Tiedätkö, montako diabeetikkoa maassamme on tällä hetkellä?

Suomiko terveyden edistämisen. Tiedätkö, montako diabeetikkoa maassamme on tällä hetkellä? Terveyden edistämisen professori Tiina Laatikainen Kansallinen diabetesfoorumi 15.5.212 Suomiko terveyden edistämisen mallimaa? Tiedätkö, montako diabeetikkoa maassamme on tällä hetkellä? Tyypin 2 Diabetes

Lisätiedot

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen

Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä. Matti Pirinen Tilastollinen päättely genominlaajuisissa assosiaatioanalyyseissä Matti Pirinen Suomen molekyylilääketieteen instituutti (FIMM) Helsingin Yliopisto 17.2.2015 Tilastollisen päättelyn kurssi Kumpula Sisältö

Lisätiedot

KASVISSYÖJIEN KOLESTEROLI, VERENPAINE JA YLIPAINO

KASVISSYÖJIEN KOLESTEROLI, VERENPAINE JA YLIPAINO KASVISSYÖJIEN KOLESTEROLI, VERENPAINE JA YLIPAINO Näyttöä väestötutkimuksista, 1960 2015 www.puolikiloa.fi 2 Meta- analyysi Tutkimus Maa Vuodet Key ym. 1999 Adven7st Mortality USA 1960 65 Mukana Adven7st

Lisätiedot

Matti Uusitupa 18.5.2011. Uusinta tutkimustietoa rasvoista Mikä on muuttunut vai onko mikään?

Matti Uusitupa 18.5.2011. Uusinta tutkimustietoa rasvoista Mikä on muuttunut vai onko mikään? Matti Uusitupa 18.5.2011 Uusinta tutkimustietoa rasvoista Mikä on muuttunut vai onko mikään? Luennon pääasiallinen sisältö Ateroskleroosin patogeneesi ja LDL-kolesteroli Mistä rasvakeskustelu sai taas

Lisätiedot

Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012. Lihavuus kansanterveyden haasteena

Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012. Lihavuus kansanterveyden haasteena Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012 Lihavuus kansanterveyden haasteena Lihavuus kuoleman vaaratekijänä Yli 6000 lihavan keskimäärin 15 vuoden seuranta

Lisätiedot

Kuinka ohjeistaa sydänpotilaan liikuntaa

Kuinka ohjeistaa sydänpotilaan liikuntaa Kuinka ohjeistaa sydänpotilaan liikuntaa Mikko Tulppo, Dos, FT, LitM Verve, Oulu, Finland Oulun Yliopisto, Oulu, Finland Ennenaikaisten kuolemien Syyt USA:ssa (vuosittain) Sydänperäinen äkkikuolema 300.000

Lisätiedot

Sydän- ja verisuonitautien riskitekijät Suomessa

Sydän- ja verisuonitautien riskitekijät Suomessa Sydän- ja verisuonitautien riskitekijät Suomessa FINRISKI-terveystutkimuksen tuloksia Pekka Jousilahti Tutkimusprofessori, THL 25.10.2014 Kansallinen FINRISKI 2012 -terveystutkimus - Viisi aluetta Suomessa

Lisätiedot

Suomalaiset vahvuudet

Suomalaiset vahvuudet Suomalaiset vahvuudet Korkealaatuinen terveydenhuoltojärjestelmä Luotettavat terveydenhuollon rekisterit Väestöaineistot ja terveydenhuollon näytekokoelmat Geneettisesti homogeeninen väestö Kansainvälisesti

Lisätiedot

Terveyttä pohjoismaisesta ruokavaliosta. Ravitsemus Suomessa seminaari Matti Uusitupa, Säätytalo 4.10.2013

Terveyttä pohjoismaisesta ruokavaliosta. Ravitsemus Suomessa seminaari Matti Uusitupa, Säätytalo 4.10.2013 Terveyttä pohjoismaisesta ruokavaliosta Ravitsemus Suomessa seminaari Matti Uusitupa, Säätytalo 4.10.2013 Muuttuva ruokakulttuuri Heränneen kansan arkea ja pyhää, WSOY, 1952 Matti Uusitupa 4.10. 2014 Säätytalo

Lisätiedot

HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism

HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism Final SmPC and PL wording agreed by PhVWP December 2011 SUMMARY OF PRODUCT CHARACTERISTICS New Class Warnings

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Nuorten ylipainon syitä jäljittämässä

Nuorten ylipainon syitä jäljittämässä SALVE Päätösseminaari 21.11.2012 Nuorten ylipainon syitä jäljittämässä Väestötutkimuksia lihavuuden vaara- ja suojatekijöistä Pohjois-Suomen syntymäkohortissa 1986 Anne Jääskeläinen, TtM Nuorten ylipainon

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori

Lisätiedot

Helsingin Johtajatutkimus 1964-2005. 1919-34 syntyneiden johtajien 26-39 vuoden seurantatutkimus

Helsingin Johtajatutkimus 1964-2005. 1919-34 syntyneiden johtajien 26-39 vuoden seurantatutkimus Helsingin Johtajatutkimus 1964-05 Timo Strandberg Geriatrian professori Oulun yliopisto Helsingin Johtajatutkimus 1964-05 Elämänlaatu, successful aging, compression of morbidity Painonmuutoksen merkitys

Lisätiedot

Lihavuus ja liitännäissairaudet

Lihavuus ja liitännäissairaudet Rasvahapot valtimotaudin vaaran arvioinnissa Lihavuus ja liitännäissairaudet Antti Jula, ylilääkäri, sisätautiopin dosentti, THL VIII Valtakunnallinen Kansanterveyspäivä 12.12.2011 Lihavuus ja liitännäissairaudet

Lisätiedot

Mikko Syvänne. Dosentti, ylilääkäri Suomen Sydänliitto ry. Valtimotautien riskitekijät ja riskiyksilöiden tunnistaminen MS 13.10.

Mikko Syvänne. Dosentti, ylilääkäri Suomen Sydänliitto ry. Valtimotautien riskitekijät ja riskiyksilöiden tunnistaminen MS 13.10. Mikko Syvänne Dosentti, ylilääkäri Suomen Sydänliitto ry Valtimotautien riskitekijät ja riskiyksilöiden tunnistaminen MS 13.10.2010 1 Klassiset valtimotaudin riskitekijät Kohonnut veren kolesteroli Kohonnut

Lisätiedot

Suomalaisten veren kolesterolitasot ja rasvan ruokavaliossa FINRISKI 2012-tutkimuksen mukaan

Suomalaisten veren kolesterolitasot ja rasvan ruokavaliossa FINRISKI 2012-tutkimuksen mukaan Suomalaisten veren kolesterolitasot ja rasvan ruokavaliossa FINRISKI 2012-tutkimuksen mukaan Erkki Vartiainen, LKT, professori, ylijohtaja 25.11.2012 1 Kolesterolitason muutokset 1982-2012 Miehet 6,4 6,2

Lisätiedot

Dementia ja Alzheimerin tauti Suomessa voidaanko niitä ehkäistä? Miia Kivipelto, MD, PhD Associate Professor

Dementia ja Alzheimerin tauti Suomessa voidaanko niitä ehkäistä? Miia Kivipelto, MD, PhD Associate Professor Dementia ja Alzheimerin tauti Suomessa voidaanko niitä ehkäistä? Miia Kivipelto, MD, PhD Associate Professor VII Valtakunnallinen Kansanterveyspäivä 14.1.11 Voidaanko dementiaa ehkäistä? Taustaa Riskitekijät

Lisätiedot

Sosioekonomisen aseman ja suvun diabetestaustan vaikutus elintapaohjauksen tehoon D2Dhankkeessa. Diabeteksen ehkäisy kannattaa- seminaari 27.9.

Sosioekonomisen aseman ja suvun diabetestaustan vaikutus elintapaohjauksen tehoon D2Dhankkeessa. Diabeteksen ehkäisy kannattaa- seminaari 27.9. Sosioekonomisen aseman ja suvun diabetestaustan vaikutus elintapaohjauksen tehoon D2Dhankkeessa TUTKIJARYHMÄ: Nina Rautio, Pirkanmaan shp, nina.rautio@oulu.fi Jari Jokelainen, Oulun yliopisto Heikki Oksa,

Lisätiedot

Metabolinen oireyhtymä tyypin 1 diabeteksessa

Metabolinen oireyhtymä tyypin 1 diabeteksessa Metabolinen oireyhtymä tyypin 1 diabeteksessa Lena Thorn HYKS, sisätaudit, nefrologian klinikka, Biomedicum Helsinki Sipoon terveyskeskus VIII Valtakunnallinen diabetespäivä 12.11.2009, Dipoli, Espoo Väitöskirjan

Lisätiedot

Monilääkityksen yhteys ravitsemustilaan, fyysiseen toimintakykyyn ja kognitiiviseen kapasiteettiin iäkkäillä

Monilääkityksen yhteys ravitsemustilaan, fyysiseen toimintakykyyn ja kognitiiviseen kapasiteettiin iäkkäillä Monilääkityksen yhteys ravitsemustilaan, fyysiseen toimintakykyyn ja kognitiiviseen kapasiteettiin iäkkäillä FaT, tutkija Johanna Jyrkkä Lääkehoitojen arviointi -prosessi Lääkealan turvallisuus- ja kehittämiskeskus,

Lisätiedot

Pekka Puska Pääjohtaja Terveyden ja hyvinvoinnin laitos (THL) Miten potilaiden ja väestön riskikäyttäytymiseen voidaan vaikuttaa?

Pekka Puska Pääjohtaja Terveyden ja hyvinvoinnin laitos (THL) Miten potilaiden ja väestön riskikäyttäytymiseen voidaan vaikuttaa? Pekka Puska Pääjohtaja Terveyden ja hyvinvoinnin laitos (THL) Miten potilaiden ja väestön riskikäyttäytymiseen voidaan vaikuttaa? Kansanterveyspäivä, Helsinki 23.11.2012 Kansantautien (elintapasairauksien)

Lisätiedot

Tupakkapoliittisten toimenpiteiden vaikutus. Satu Helakorpi Terveyden edistämisen ja kroonisten tautien ehkäisyn osasto Terveyden edistämisen yksikkö

Tupakkapoliittisten toimenpiteiden vaikutus. Satu Helakorpi Terveyden edistämisen ja kroonisten tautien ehkäisyn osasto Terveyden edistämisen yksikkö Tupakkapoliittisten toimenpiteiden vaikutus Satu Helakorpi Terveyden edistämisen ja kroonisten tautien ehkäisyn osasto Terveyden edistämisen yksikkö Päivittäin tupakoivien osuus (%) 1978 2006 % 50 40 30

Lisätiedot

MIKÄ ON TÄRKEINTÄ RUOKAVALIOSSA RASVAN MÄÄRÄ VAI LAATU. Matti Uusitupa 15.012010

MIKÄ ON TÄRKEINTÄ RUOKAVALIOSSA RASVAN MÄÄRÄ VAI LAATU. Matti Uusitupa 15.012010 MIKÄ ON TÄRKEINTÄ RUOKAVALIOSSA RASVAN MÄÄRÄ VAI LAATU Matti Uusitupa 15.012010 Ruokavalio ja rasvan laatu Veren rasva arvot ja lipoproteiinit +++ Verenpaine + Endoteelifunktio + Insuliiniherkkyys + Tulehdustekijät

Lisätiedot

METELI-projekti lopetuskokous 12.4.2005

METELI-projekti lopetuskokous 12.4.2005 METELI-projekti lopetuskokous 12.4.2005 -hankkeen tavoite -keskeiset tulokset, kliininen ja kineettiset kokeet -johtopäätökset Hankkeen tavoite Tuottaa tietoa antioksidatiivisesti vaikuttavien, terveysvaikutteisten

Lisätiedot

Kun farkut vaihtuu lökäreihin koululaisten ylipainosta. Harri Niinikoski Dosentti, osastonylilääkäri TYKS lasten- ja nuortenklinikka Kevät 2013

Kun farkut vaihtuu lökäreihin koululaisten ylipainosta. Harri Niinikoski Dosentti, osastonylilääkäri TYKS lasten- ja nuortenklinikka Kevät 2013 Kun farkut vaihtuu lökäreihin koululaisten ylipainosta Harri Niinikoski Dosentti, osastonylilääkäri TYKS lasten- ja nuortenklinikka Kevät 2013 4/2013 1 Outline Uusia tutkimustuloksia ylipainoisuuden yleisyydestä

Lisätiedot

Mitä uudet intensiivihoitotutkimukset kertovat meille hyperglykemian hoidosta

Mitä uudet intensiivihoitotutkimukset kertovat meille hyperglykemian hoidosta Mitä uudet intensiivihoitotutkimukset kertovat meille hyperglykemian hoidosta Leena Moilanen, dosentti Sisätautien ja endokrinologian erikoislääkäri Sisätautien klinikka KYS Valtakunnallinen diabetespäivä

Lisätiedot

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä

Lisätiedot

Milloin määrittää ja miten seurata D-vitamiinipitoisuuksia? Christel Lamberg-Allardt 27.11.2014 Yleislääkärit

Milloin määrittää ja miten seurata D-vitamiinipitoisuuksia? Christel Lamberg-Allardt 27.11.2014 Yleislääkärit Milloin määrittää ja miten seurata D-vitamiinipitoisuuksia? Christel Lamberg-Allardt 27.11.2014 Yleislääkärit Jones 2013 Jones 2013 Jones 2013 Norman and Bouillon 2013 Norman and Bouillon 2013 D-vitamiiniitilanteen

Lisätiedot

Elämänkulku ja vanheneminen

Elämänkulku ja vanheneminen Elämänkulku ja vanheneminen Taina Rantanen Gerontologian ja kansanterveyden professori Gerontologian tutkimuskeskus Terveystieteiden laitos Jyväskylän yliopisto Miksi tutkia pitkäikäisyyttä ja vanhuuden

Lisätiedot

Onnistummeko HIV-potilaiden kardiovaskulaaririskien hoidossa? Pia Kivelä 11.2.2015

Onnistummeko HIV-potilaiden kardiovaskulaaririskien hoidossa? Pia Kivelä 11.2.2015 Onnistummeko HIV-potilaiden kardiovaskulaaririskien hoidossa? Pia Kivelä 11.2.2015 Mitä HIV-potilaiden kardiovaskulaaritautien riskit ovat? Mitä pitäisi tehdä ja kenelle? Olemmeko onnistuneet? Mitä voisimme

Lisätiedot

Suomalaisten verenpaine FINRISKI 2012 tutkimuksen mukaan

Suomalaisten verenpaine FINRISKI 2012 tutkimuksen mukaan Suomalaisten verenpaine FINRISKI 2012 tutkimuksen mukaan Tiina Laatikainen, LT, tutkimusprofessori 24.11.2012 1 Kohonnut verenpaine Lisää riskiä sairastua sydän- ja verisuonitauteihin Sepelvaltimotaudin

Lisätiedot

Mitä ylipaino ja metabolinen oireyhtymä tekevät verenkiertoelimistön säätelylle? SVPY:n syyskokous 5.9.2015 Pauliina Kangas, EL Tampereen yliopisto

Mitä ylipaino ja metabolinen oireyhtymä tekevät verenkiertoelimistön säätelylle? SVPY:n syyskokous 5.9.2015 Pauliina Kangas, EL Tampereen yliopisto Mitä ylipaino ja metabolinen oireyhtymä tekevät verenkiertoelimistön säätelylle? SVPY:n syyskokous 5.9.2015 Pauliina Kangas, EL Tampereen yliopisto Taustaa q Metabolinen oireyhtymä (MBO, MetS) on etenkin

Lisätiedot

Suolan terveyshaitat ja kustannukset

Suolan terveyshaitat ja kustannukset Suolan terveyshaitat ja kustannukset Antti Jula, ylilääkäri, sisätautiopin dosentti, THL Seminaari Suola Näkymätön vaara 8.2.2011 Verenpaine ja aivohalvauskuolleisuus Prospective Studies Collaboration,

Lisätiedot

Tyypin 2 diabeteksen ehkäisyohjelma: Dehkon 2D-hankkeen (D2D) arviointitutkimus

Tyypin 2 diabeteksen ehkäisyohjelma: Dehkon 2D-hankkeen (D2D) arviointitutkimus Tyypin 2 diabeteksen ehkäisyohjelma: Dehkon 2D-hankkeen (D2D) arviointitutkimus Markku Peltonen PhD, dosentti, yksikön päällikkö Terveyden ja hyvinvoinnin laitos 30.11.2011 Terveydenhuoltotutkimuksen päivät

Lisätiedot

Pohjois-Karjalasta maailmalle Onko terveydenhuollolla roolia terveyden edistämisessä vai tulisiko panostus olla yhteiskunnallisessa kehittämisessä?

Pohjois-Karjalasta maailmalle Onko terveydenhuollolla roolia terveyden edistämisessä vai tulisiko panostus olla yhteiskunnallisessa kehittämisessä? Pekka Puska, professori Ex pääjohtaja, THL Presidentti, Kansanterveyslaitosten Maailmanjärjestö (IANPHI) Pohjois-Karjalasta maailmalle Onko terveydenhuollolla roolia terveyden edistämisessä vai tulisiko

Lisätiedot

Tyypin 2 diabeteksen ennaltaehkäisy väestötasollatasolla

Tyypin 2 diabeteksen ennaltaehkäisy väestötasollatasolla Yhteiset kansanterveytemme haasteet riskitiedoista toimintaan Tyypin 2 diabeteksen ennaltaehkäisy väestötasollatasolla Markku Peltonen PhD,, dosentti, yksikön n pääp äällikkö Diabetesyksikkö Terveyden

Lisätiedot

Onko testosteronihoito turvallista?

Onko testosteronihoito turvallista? Onko testosteronihoito turvallista? Antti Saraste kardiologi, apulaisprofessori Sydänkeskus ja Valtakunnallinen PET keskus, TYKS ja Turun yliopisto, Turku Reproduktioendokrinologia 12.2.2016 J Am Coll

Lisätiedot

Ainoa tapa pysyä terveenä on syödä sitä mitä ei halua, juoda sitä mistä ei pidä ja tehdä sitä minkä mieluummin jättäisi tekemättä

Ainoa tapa pysyä terveenä on syödä sitä mitä ei halua, juoda sitä mistä ei pidä ja tehdä sitä minkä mieluummin jättäisi tekemättä Tyypin 2 diabeteksen ja metabolisen oireyhtymän ennaltaehkäisy elintapamuutos vai lääkehoito? Ainoa tapa pysyä terveenä on syödä sitä mitä ei halua, juoda sitä mistä ei pidä ja tehdä sitä minkä mieluummin

Lisätiedot

Renewing Health Projekti, Eksote. Tuula Karhula

Renewing Health Projekti, Eksote. Tuula Karhula Renewing Health Projekti, Eksote Tuula Karhula Etelä-Karjalan sosiaali- ja terveyspiiri, Eksote! Vastaamme alueemme sosiaali- ja terveydenhuollon kokonaisuudesta Väestö 133.000 Budjetti 400 M Työntekijöitä

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

Ylidiagnostiikkaa: onko kohta enää terveitä? LL Iris Pasternack HYKS Psykiatrian klinikka, tiistailuento 25.2.2014

Ylidiagnostiikkaa: onko kohta enää terveitä? LL Iris Pasternack HYKS Psykiatrian klinikka, tiistailuento 25.2.2014 Ylidiagnostiikkaa: onko kohta enää terveitä? LL Iris Pasternack HYKS Psykiatrian klinikka, tiistailuento 25.2.2014 The New York Times Feb 11 2014 Miller A et al. 25 year follow up for breast cancer incidence

Lisätiedot

DOSE-RESPONSES TO EXERCISE TRAINING - DR's EXTRA

DOSE-RESPONSES TO EXERCISE TRAINING - DR's EXTRA KANSANELÄKELAITOS/ Tutkimussopimus Dnro 4/26/2010 Loppuraportti 04.08.2014 DOSE-RESPONSES TO EXERCISE TRAINING - DR's EXTRA - A Randomized Controlled 4-year Trial on the Effects of Regular Physical Exercise

Lisätiedot

Timo Saaristo VALTIMOTERVEYDEKSI! Valtimoterveyttä kaikille -miksi?

Timo Saaristo VALTIMOTERVEYDEKSI! Valtimoterveyttä kaikille -miksi? Timo Saaristo VALTIMOTERVEYDEKSI! Valtimoterveyttä kaikille -miksi? Sepelvaltimotauti Ei ole vielä voitettu Olisi 80%:sti ehkäistävissä, jos syötäisiin terveellisimmin, liikuttaisiin enemmän ja vältettäisiin

Lisätiedot

Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta

Lisätiedot

Terveyden edistämistä molemmin puolin rajaa

Terveyden edistämistä molemmin puolin rajaa Terveyden edistämistä molemmin puolin rajaa Vesa Korpelainen toiminnanjohtaja Pohjois-Karjalan kansanterveyden keskus www.kansanterveys.info Pohjois-Karjala mallina Suomessa N Pitkäranta mallina Karjalan

Lisätiedot

Kohonnut verenpaine Vaitelias vaaratekijä. Kimmo Kontula Sisätautiopin professori, ylilääkäri HY ja HYKS Labquality Days 11.02.

Kohonnut verenpaine Vaitelias vaaratekijä. Kimmo Kontula Sisätautiopin professori, ylilääkäri HY ja HYKS Labquality Days 11.02. Kohonnut verenpaine Vaitelias vaaratekijä Kimmo Kontula Sisätautiopin professori, ylilääkäri HY ja HYKS Labquality Days 11.02.2016 Ihmiskunnan kriittisen tärkeät sairaudet ja riskitekijät Global Burden

Lisätiedot

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän

Lisätiedot

Alzheimerin taudin ehkäisy

Alzheimerin taudin ehkäisy Alzheimerin taudin ehkäisy Tiia Ngandu MD, PhD 5.9.2012 Karjalan XII Lääketiedepäivät/ Tiia Ngandu 1 Alzheimerin taudin ennaltaehkäisy Taustaa Vaara- ja suojatekijät Interventiotutkimukset 5.9.2012 Karjalan

Lisätiedot

GEENIT SKITSOFRENIAN AIHEUTTAJANA. Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9.

GEENIT SKITSOFRENIAN AIHEUTTAJANA. Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9. GEENIT SKITSOFRENIAN AIHEUTTAJANA Tiina Paunio Dosentti Psykiatrian erikoislääkäri Skitsofreniaverkoston symposium Kuopio 11.9.2009 SKITSOFRENIAN ETIOLOGIAA Hermoston kehityksen häiriö Poikkeava neurotransmissio

Lisätiedot

Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:

Lisätiedot

Vaikuttava ja yksilöllinen liikuntahoito työterveydenhuollossa

Vaikuttava ja yksilöllinen liikuntahoito työterveydenhuollossa Vaikuttava ja yksilöllinen liikuntahoito työterveydenhuollossa LL Sergei Iljukov Liikuntalääketieteeseen erikoistuva lääkäri Kuopion liikuntalääketieteen tutkimuslaitos Terveys on täydellinen fyysisen,

Lisätiedot

The relationship between leisuretime physical activity and work stress with special reference to heart rate variability analyses

The relationship between leisuretime physical activity and work stress with special reference to heart rate variability analyses The relationship between leisuretime physical activity and work stress with special reference to heart rate variability analyses Teisala Tiina, TtM, tohtorikoulutettava Jyväskylän yliopisto Terveystieteiden

Lisätiedot

April 21, 2015. FIMM - Institute for Molecular Medicine Finland www.fimm.fi

April 21, 2015. FIMM - Institute for Molecular Medicine Finland www.fimm.fi April 21, 2015 FIMM - Institute for Molecular Medicine Finland Tutkimus Soveltaminen Miten ihmiset suhtautuvat geenitietoonsa KardioKompassi tutkimuksesta opittua Mari Kaunisto, FIMM 16.4.2015 Sitran teettämä

Lisätiedot

Farmakogeneettiset testit apuna lääkehoidon arvioinnissa

Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit Farmakogenetiikalla tarkoitetaan geneettisiä variaatioita, jotka vaikuttavat lääkeainevasteeseen. Geneettisen tiedon hyödyntäminen

Lisätiedot

Verenpaine,sen säätely ja käyttäytyminen levossa ja rasituksessa. Jyrki Taurio Sisätautilääkäri TAYS/PSS 25.10.2012

Verenpaine,sen säätely ja käyttäytyminen levossa ja rasituksessa. Jyrki Taurio Sisätautilääkäri TAYS/PSS 25.10.2012 Verenpaine,sen säätely ja käyttäytyminen levossa ja rasituksessa Jyrki Taurio Sisätautilääkäri TAYS/PSS 25.10.2012 Kohonnut verenpaine Yleisin yleislääkärille tehtävän vastaanottokäynnin aihe Lääkitys

Lisätiedot

Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes)

Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes) SYLY- päivät 2014 Helsinki 28.11.2014 Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes) Diabeteslääkäri Mikko Honkasalo Nurmijärven terveyskeskus

Lisätiedot

Sairauksien ehkäisyn strategiat

Sairauksien ehkäisyn strategiat VALTIMOTERVEYDEKSI! Miten arvioidaan diabeteksen ja valtimotautien riski ja tunnistetaan oikeat henkilöt riskinhallinnan piiriin? Mikko Syvänne, dosentti, ylilääkäri, Suomen Sydänliitto ry Sairauksien

Lisätiedot

Terveysalan uudistaminen yritysten, korkeakoulujen ja palvelujärjestelmän yhteistyöllä 15.4.2015

Terveysalan uudistaminen yritysten, korkeakoulujen ja palvelujärjestelmän yhteistyöllä 15.4.2015 Terveysalan uudistaminen yritysten, korkeakoulujen ja palvelujärjestelmän yhteistyöllä 15.4.2015 Reijo Salonen Johtaja, Lääketutkimus ja kehitys Orion Yliopistot Terveydenhoito Teollisuus Kolme pilaria,

Lisätiedot

Kahvin juonti keski-iässä ja myöhäisiän dementiariski: väestöpohjainen CAIDE -tutkimus

Kahvin juonti keski-iässä ja myöhäisiän dementiariski: väestöpohjainen CAIDE -tutkimus CARDIOVASCULAR RISK FACTORS, AGING AND DEMENTIA - Sydän- ja verisuonitautien Riskitekijät, t, Ikää ääntyminen ja Dementia Kahvin juonti keski-iässä ja myöhäisiän dementiariski: väestöpohjainen CAIDE -tutkimus

Lisätiedot

1.9.2006/SRI,AR TYYPIN 2 DIABETES VAARATEKIJÄT

1.9.2006/SRI,AR TYYPIN 2 DIABETES VAARATEKIJÄT 1.9.2006/SRI,AR TYYPIN 2 DIABETES VAARATEKIJÄT 1. HOMA indeksit...2 2. Metabolisen oireyhtymän liittyviä vaaratekijöitä...3 3. Metabolisen oireyhtymän esiintyvyyttä kuvaavat muuttujat...7 1 1. HOMA indeksit

Lisätiedot

Diabetes mellitus, diagnostiikka

Diabetes mellitus, diagnostiikka Diabetes mellitus, diagnostiikka Tiimiklubi 26.10.2013 Diabetes mellitus Paastoglukoosi tai 2-tunnin glukoosi* tai HbA1c Heikentynyt glukoosinsieto (IGT) 2-tunnin glukoosi* Onko tutkittavalla diabetes?

Lisätiedot

Metsälamminkankaan tuulivoimapuiston osayleiskaava

Metsälamminkankaan tuulivoimapuiston osayleiskaava VAALAN KUNTA TUULISAIMAA OY Metsälamminkankaan tuulivoimapuiston osayleiskaava Liite 3. Varjostusmallinnus FCG SUUNNITTELU JA TEKNIIKKA OY 12.5.2015 P25370 SHADOW - Main Result Assumptions for shadow calculations

Lisätiedot

DIABETES JA AIVOT AIVOJEN INSULIINIRESISTENSSI

DIABETES JA AIVOT AIVOJEN INSULIINIRESISTENSSI DIABETES JA AIVOT AIVOJEN INSULIINIRESISTENSSI Outi Heikkilä Valtakunnallinen diabetespäivä 17.11.2015 AIVOJEN INSULIINIRESISTENSSI 1. AIVOJEN INSULIININ FYSIOLOGINEN ROOLI? 2. MITÄ AIVOJEN INSULIINIRESISTENSSI

Lisätiedot

Iäkkään verenpaineen hoito. Antti Jula Geriatripäivät 2012, 26.1.2012 Turku

Iäkkään verenpaineen hoito. Antti Jula Geriatripäivät 2012, 26.1.2012 Turku Iäkkään verenpaineen hoito Antti Jula Geriatripäivät 2012, 26.1.2012 Turku Verenpaine ja aivohalvauskuolleisuus Prospective Studies Collaboration, Lancet 2002;360:1903-13 Verenpaine ja sepelvaltimotautikuolleisuus

Lisätiedot

Sydänpurjehdus 8.10.2013. Sepelvaltimotauti todettu - Milloin varjoainekuvaus, pallolaajennus tai ohitusleikkaus? Juhani Airaksinen TYKS, Sydänkeskus

Sydänpurjehdus 8.10.2013. Sepelvaltimotauti todettu - Milloin varjoainekuvaus, pallolaajennus tai ohitusleikkaus? Juhani Airaksinen TYKS, Sydänkeskus Sydänpurjehdus 8.10.2013 Sepelvaltimotauti todettu - Milloin varjoainekuvaus, pallolaajennus tai ohitusleikkaus? Juhani Airaksinen TYKS, Sydänkeskus Oireet RasitusEKG - CT Sepelvaltimoiden varjoainekuvaukset

Lisätiedot

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti

Molekyyligenetiikka. Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Arto Orpana, FT dos. apulaisylikemisti Molekyyligenetiikka Pikaperusteet Miten meillä Automaation aika Geenitestien käyttö Mihin menossa Molekyyligenetiikka: pikaperusteet DNAn rakennevirheet

Lisätiedot

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen käyttöön liittyviä haasteita Juhani Eskola 310505 7.6.2005 1 Valitut painopistealueet Kansantautien ja terveyden geenitausta Mikrobit ja

Lisätiedot

TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015

TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti

Lisätiedot

GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma

GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma GENOMITIETO JA TERVEYSTALOUS Riittävätkö rahat? terveystaloustieteen näkökulma Miika Linna, dos. TkT. Aalto-yliopisto HEMA / Terveyden ja hyvinvoinnin laitos Taustaa Uudet genomitietoon perustuvat hoidon

Lisätiedot

Diabetes, ylipaino ja ilmailulääketiede. Leena Moilanen, dosentti Sisätautien ja endokrinologian erikoislääkäri KYS 19.9.2010

Diabetes, ylipaino ja ilmailulääketiede. Leena Moilanen, dosentti Sisätautien ja endokrinologian erikoislääkäri KYS 19.9.2010 Diabetes, ylipaino ja ilmailulääketiede Leena Moilanen, dosentti Sisätautien ja endokrinologian erikoislääkäri KYS 19.9.2010 Esityksen sisältö T2DM epidemiologiaa Lihavuuden epidemiologiaa Diabeetikoiden

Lisätiedot

Erkki Vartiainen, ylijohtaja, professori

Erkki Vartiainen, ylijohtaja, professori Lihavuus Suomessa Erkki Vartiainen, ylijohtaja, professori 28.12.2011 Esityksen nimi / Tekijä 1 Lihavuus 70-80 % ylimääräisestä energiasta varastoituu rasvana. Loput varastoituu proteiineina ja niihin

Lisätiedot

Fysiologiset signaalit ylikuormituksen varhaisessa tunnistamisessa. Harri Lindholm erikoislääkäri Työterveyslaitos

Fysiologiset signaalit ylikuormituksen varhaisessa tunnistamisessa. Harri Lindholm erikoislääkäri Työterveyslaitos Fysiologiset signaalit ylikuormituksen varhaisessa tunnistamisessa Harri Lindholm erikoislääkäri Työterveyslaitos Stressin merkitys terveydelle Työelämän fysiologiset stressitekijät Aikapaine Työn vaatimukset

Lisätiedot

Eturauhassyövän seulonta. Patrik Finne

Eturauhassyövän seulonta. Patrik Finne Eturauhassyövän seulonta Patrik Finne Ulf-Håkan Stenman-juhlasymposiumi, 21.4.2009 Seulonnan tavoite löytää syöpä aikaisemmin, ennen kuin se on levinnyt mahdollistaa radikaalinen hoito Vähentää kuolleisuutta

Lisätiedot

Ikääntyvän työntekijän muotokuva TOKI-seminaari Oulussa 10.6.2011

Ikääntyvän työntekijän muotokuva TOKI-seminaari Oulussa 10.6.2011 Ikääntyvän työntekijän muotokuva TOKI-seminaari Oulussa 10.6.2011 Lähteenä: 65-vuotiaiden aikuisneuvolan tutkimustiedot & Sosioekonomiset terveyserot Pohjois-Pohjanmaalla 16.6.2011 geriatrian ylilääkäri

Lisätiedot

Sisällysluettelo 1. Tausta 2. Menetelmät 3. Tulokset 3.1 Osallistuminen 3.2 Diabetes ja heikentynyt glukoosinsietokyky 3.3 Lihavuus ja metabolinen

Sisällysluettelo 1. Tausta 2. Menetelmät 3. Tulokset 3.1 Osallistuminen 3.2 Diabetes ja heikentynyt glukoosinsietokyky 3.3 Lihavuus ja metabolinen PPP-Botnia-tutkimus 2004-2008 Diabeteksen esiintyvyys, ennustettavuus ja ehkäisy Pohjanmaalla (Prevalens, Prediktion och Prevention av diabetes i Österbotten) Bo Isomaa 1 Sisällysluettelo 1. Tausta 2.

Lisätiedot

Itämeren ruokavalio niin lähellä ja niin hyvää!

Itämeren ruokavalio niin lähellä ja niin hyvää! Tiimiklubi Diabeteskeskus 12.10.2012 Itämeren ruokavalio niin lähellä ja niin hyvää! Marjukka Kolehmainen FT, dosentti Itä-Suomen yliopisto Lääketieteen laitos Kansanterveystieteen ja kliinisen ravitsemustieteen

Lisätiedot

Ongelmana labiili ja vaikeasti saavutettava sokeritasapaino. Jorma Lahtela TAYS, sisätaudit

Ongelmana labiili ja vaikeasti saavutettava sokeritasapaino. Jorma Lahtela TAYS, sisätaudit Ongelmana labiili ja vaikeasti saavutettava sokeritasapaino Jorma Lahtela TAYS, sisätaudit Valtakunnallinen diabetespäivä 17.11.2015 38-vuotias nainen Diabetes todettu 12 vuotiaana Monipistoshoito 16-vuotiaasta

Lisätiedot

Skene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene

Skene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene Skene Muokkaa perustyyl. Games Refueled napsautt. @Games for Health, Kuopio Muokkaa alaotsikon perustyyliä napsautt. 2013 kari.korhonen@tekes.fi www.tekes.fi/skene 10.9.201 3 Muokkaa Skene boosts perustyyl.

Lisätiedot

Metabolinen oireyhtymä yhteiskunnallinen haaste?

Metabolinen oireyhtymä yhteiskunnallinen haaste? Metabolinen oireyhtymä yhteiskunnallinen haaste? Carol Forsblom, D.M.Sc. FinnDiane, kliininen koordinaattori HYKS Sisätaudit, Nefrologian klinikka Folkhälsanin tutkimuskeskus LabQuality 2008-02-07 Diabetes

Lisätiedot

Alkoholin suurkulutuksen tunnistaminen laboratoriodiagnostiikalla. Onni Niemelä

Alkoholin suurkulutuksen tunnistaminen laboratoriodiagnostiikalla. Onni Niemelä Alkoholin suurkulutuksen tunnistaminen laboratoriodiagnostiikalla Onni Niemelä EPSHP Seinäjoki 7.9.2009 Tausta Jo 12 % aikuisväestöstä kuluttaa alkoholia niin paljon, että terveyshaittoja aiheuttavat rajat

Lisätiedot

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project

Lisätiedot

Miten elämänhallintaa voi mitata?

Miten elämänhallintaa voi mitata? Miten elämänhallintaa voi mitata? Varsinais-Suomen XII Yleislääkäripäivä 11.5.2016 Päivi Korhonen Terveenä pysyy parhaiten, jos: Ei tupakoi Liikkuu 30 min 5 kertaa viikossa Syö terveellisesti Ei ole ylipainoinen

Lisätiedot

Genomitieto kliinikon apuna nyt ja tulevaisuudessa

Genomitieto kliinikon apuna nyt ja tulevaisuudessa Genomitieto kliinikon apuna nyt ja tulevaisuudessa Helena Kääriäinen Tutkimusprofessori 19.3.2014 Genomitieto / Helena Kääriäinen 1 Mistä kliinikosta puhumme? Kliinisistä geeneetikoista eli perinnöllisyyslääkäreistä?

Lisätiedot

REUMA JA SYDÄN KARI EKLUND HELSINGIN REUMAKESKUS

REUMA JA SYDÄN KARI EKLUND HELSINGIN REUMAKESKUS REUMA JA SYDÄN KARI EKLUND HELSINGIN REUMAKESKUS Sisältö Sydän ja nivelreuma Sydän- ja verisuonitaudit - ateroskleroosi - riskitekijät Nivelreuma ja sydän- ja verisuonitaudit - reumalääkitys ja sydän Kuinka

Lisätiedot

Verenpaine valtimotautien riskitekijänä-mihin hoidossa tulee kiinnittää huomiota

Verenpaine valtimotautien riskitekijänä-mihin hoidossa tulee kiinnittää huomiota Verenpaine valtimotautien riskitekijänä-mihin hoidossa tulee kiinnittää huomiota Ilkka Kantola Hoyl, dosentti. Sisätautien el TYKS sisätautien klinikka Hypertension and Target-Organ Sequelae Eyes Retinopathy

Lisätiedot

Optimaalista liikuntaa painonpudottajalle. 12.12.2013, Pori Timo Haikarainen, LitM

Optimaalista liikuntaa painonpudottajalle. 12.12.2013, Pori Timo Haikarainen, LitM Optimaalista liikuntaa painonpudottajalle 12.12.2013, Pori Timo Haikarainen, LitM Sisältö Liikunnan vaikutus fysiologiaan Liikunta painon pudotusta vai painonhallintaa? Liikunnan psyykkiset vaikutukset

Lisätiedot

Estrogeenireseptorimodulaatio stroken riskitekijänä. Tomi Mikkola HYKS Naistensairaala

Estrogeenireseptorimodulaatio stroken riskitekijänä. Tomi Mikkola HYKS Naistensairaala Estrogeenireseptorimodulaatio stroken riskitekijänä Tomi Mikkola HYKS Naistensairaala Sidonnaisuudet Toiminut asiantuntijana seuraaville lääkeyrityksille: Bayer Schering, Schering-Plough Luennoitsijana

Lisätiedot

ITÄSUOMALAISET LIHAVAT LAPSET JA NUORET MIKKELI 8.12.2015 Marketta Dalla Valle

ITÄSUOMALAISET LIHAVAT LAPSET JA NUORET MIKKELI 8.12.2015 Marketta Dalla Valle ITÄSUOMALAISET LIHAVAT LAPSET JA NUORET MIKKELI 8.12.2015 Marketta Dalla Valle Taakankantajat Dalla Valle M, Laatikainen T, Kalliokoski T, Nykänen P, Jääskeläinen J. Childhood obesity in specialist care

Lisätiedot

AVH-potilaan masennuksen kulku akuuttivaiheen jälkeen ja omaisen masennusoireilu

AVH-potilaan masennuksen kulku akuuttivaiheen jälkeen ja omaisen masennusoireilu AVH-potilaan masennuksen kulku akuuttivaiheen jälkeen ja omaisen masennusoireilu AVH-päivät 13.10.2010 Helsinki Anu Berg, PsT anu.berg@eksote.fi Masennus on yleistä aivoverenkiertohäiriöiden jälkeen noin

Lisätiedot

OVATKO SUOLAN SAANNIN SUOSITUKSET KUNNOSSA?

OVATKO SUOLAN SAANNIN SUOSITUKSET KUNNOSSA? OVATKO SUOLAN SAANNIN SUOSITUKSET KUNNOSSA? Carol Forsblom, DMSc FinnDiane, kansainvälinen koordinaattori Folkhälsanin tutkimuskeskus Sisätautilääkäripäivät 23.11.2012, Biomedicum Helsinki Sidonnaisuudet

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

FINRISKI-tutkimus: Väestön kolesterolitaso on vuosikymmenien laskun jälkeen kääntynyt nousuun

FINRISKI-tutkimus: Väestön kolesterolitaso on vuosikymmenien laskun jälkeen kääntynyt nousuun alkuperäistutkimus Erkki Vartiainen LKT, professori, ylijohtaja Terveyden ja hyvinvoinnin laitos, Hyvinvoinnin ja terveyden edistämisen toimiala Katja Borodulin FT, dosentti, erikoistukija Jouko Sundvall

Lisätiedot

Ongelma: Poikkeaako perusjoukon suhteellinen osuus vertailuarvosta?

Ongelma: Poikkeaako perusjoukon suhteellinen osuus vertailuarvosta? Yhden otoksen suhteellisen osuuden testaus Ongelma: Poikkeaako perusjoukon suhteellinen osuus vertailuarvosta? Hypoteesit H 0 : p = p 0 H 1 : p p 0 tai H 1 : p > p 0 tai H 1 : p < p 0 Suhteellinen osuus

Lisätiedot

Työterveyshuolto ehkäisee vuorotyön ja elintapojen terveysriskejä

Työterveyshuolto ehkäisee vuorotyön ja elintapojen terveysriskejä Työterveyshuolto ehkäisee vuorotyön ja elintapojen terveysriskejä Tyypin 2 diabeteksen seulonta ja ehkäisy ilmailualan työterveyshuollossa Tutkimus- ja kehittämishanke. Rahoittajat: Työsuojelurahasto,

Lisätiedot