Norovirus sairaalaympäristössä

Koko: px
Aloita esitys sivulta:

Download "Norovirus sairaalaympäristössä"


1 Norovirus sairaalaympäristössä Heidi Grönroos LK HUS Sairaalahygieniayksikkö Helsinki Tutkielma Ohjaaja: Mari Kanerva LT HELSINGIN YLIOPISTO Lääketieteellinen tiedekunta

2 i HELSINGIN YLIOPISTO HELSINGFORS UNIVERSITET Tiedekunta/Osasto Fakultet/Sektion Faculty Lääketieteellinen tiedekunta Tekijä Författare Author Heidi Grönroos Työn nimi Arbetets titel Title Norovirus sairaalaympäristössä Oppiaine Läroämne Subject Laitos Institution Department Työn laji Arbetets art Level Tutkielma Tiivistelmä Referat Abstract Aika Datum Month and year Sivumäärä -Sidoantal - Number of pages Norovirukset ovat tavallisimpia aikuisten virusvatsatautien aiheuttajia. Norovirus tarttuu helposti ihmisestä toiseen useimmiten feko-oraaliteitse. Vatsatauti on tavallisesti nopea ja itsestään ohi menevä eikä vaadi sairaalahoitoa, mutta voi aiheuttaa perussairaille vakavankin taudin. Tartuttavuutensa ja kestävyytensä ansiosta norovirus aiheuttaa epidemioita esimerkiksi sairaaloissa, jossa se leviää potilaasta toiseen henkilökunnan välityksellä. Epidemiat aiheuttavat sairaaloille kustannuksia ja johtavat ylimääräisiin kuolemiin. Kunnollisella siivouksella ja käsihygienialla voidaan epidemioita merkittävästi rajoittaa. Tutkimuksen tarkoituksena oli yrittää tunnistaa vuodeosastolla sellaisia pintoja, joista norovirus on vaikeasti puhdistettavissa, jotta siivous osattaisiin kohdistaa riskipaikkoihin. Näytteitä otettiin Kaunialan sairaalan vuodeosastolta, jossa oli äskettäin ollut norovirusepidemia. Kolmesta huoneesta otettiin yhteensä 25 pintanäytettä pumpulitikuilla ja sideharsoilla. Näytteet analysoitiin reaaliaikaisella RT-PCR:llä. Yhdestä näytteestä löytyi noroviruksen nukleiinihappoa. Se oli peräisin potilas-wc:n suihkutuolista. Kyseisen huoneen potilaalla oli vatsatautioireita edellisen kerran 10 vuorokautta sitten näytteenottohetkestä. Tutkimus osoittaa että helposti ulosteella kontaminoituvat paikat, kuten suihkutuolit ja alusastiat, voisivat käsin kosketettaessa toimia epidemian ylläpitäjänä ja levittäjänä, jos niitä ei puhdisteta kunnolla. (150 sanaa) Avainsanat Nyckelord Keywords Norovirus, Disease outbreaks, Disease transmission, Fomites, Disinfection Säilytyspaikka Förvaringställe Where deposited Terkko Document Space Muita tietoja Övriga uppgifter Additional information

3 ii 1 Johdanto Menetelmät Epidemian kuvaus ja näytteidenottoympäristö Näytteenottotekniikat Analyysimenetelmät..8 3 Tulokset Pintanäytteet Sideharsojen analysointimenetelmän toimivuuskoe Pohdinta 14 Lähteet.19 Liite

4 1 1 Johdanto Norovirukset, jotka kuuluvat Caliciviridae-heimoon, ovat tavallisimpia ihmisten virusgastroenteriittien aiheuttajia ympäri maailman. Norovirukset ovat pieniä, vaipattomia viruksia, joiden genomi on yksisäikeistä RNA:ta (1). Ne jaetaan viiteen genoryhmään, joista ryhmät I, II ja IV kykenevät infektoimaan ihmisen. Genoryhmät jakautuvat edelleen genotyyppeihin. Norovirukset ovat hyvin sopeutumiskykyisiä ja kehittyvät antigeenimuuntelun ja mahdollisesti rekombinaation avulla, minkä seurauksena syntyy uusia genotyyppejä. (2) Noroviruksen GII.4-genotyyppi on ollut vallitseva norovirusvariantti mm. Euroopassa ja USA:ssa viimeisen vuosikymmenen aikana (3). Uusia GII.4-genotyypin variantteja on ilmaantunut 3-6 vuoden välein ja ne ovat aiheuttaneet influenssavirusten tapaan laajoja pandemioita. Vuonna 2006 tunnistettiin noroviruksen uusimmat variantit, GII a ja b. (2) Ne ovat aiheuttaneet sekä Suomessa että muualla maailmassa laajoja epidemioita, jotka ovat aiheuttaneet suuria kustannuksia yhteiskunnalle (4), (5), (6). Noroviruksen aiheuttamalle gastroenteriitille on tyypillistä tunnin inkubaatioaika sekä lyhytkestoinen 1-2 päivää kestävä tauti, jonka oireisiin lukeutuvat pahoinvointi, oksentelu, ripulointi ja osalla potilaista kuume. Infektion aikaansaama immuniteetti on lyhytaikainen, ja sama norovirustyyppi pystyy infektoimaan ihmisen uudelleen jo noin kuuden kuukauden kuluttua. Viidenneksellä eurooppalaisista on kuitenkin perinnöllinen vastustuskyky ainakin tiettyjä norovirusinfektiota vastaan (7). Norovirusvatsatauteja tavataan ympäri vuoden, mutta epidemiakausi keskittyy kevättalveen. Feko-oraalitie on noroviruksen tärkein tartuntareitti (8). Ilmoitettujen norovirusvatsatautitapausten määrä on Suomessa noussut selvästi luvun alusta, ja erityisen paljon mikrobiologisesti varmistettuja tapauksia todettiin vuonna 2002 ja vuoden 2006 jälkeen. Suomessa tartuntatautirekisteriin ilmoitettiin vuonna 2008 yhteensä 2574 norovirustapausta. Vuonna 2009 oli tautitapausten lukumäärää syyskuun loppuun mennessä yhteensä 1970, ja näistä ylivoimaisesti suurin osa, 541 tapausta, ilmoitettiin maaliskuussa. Vuonna 2008 syyskuun loppuun mennessä

5 2 oli ilmoituksia tehty jo 2323 kappaletta, joten vuoden 2009 ilmoitettujen tapausten summa jäänee edellisvuotta pienemmäksi. (9) Tartuntatautirekisteriin ilmoitetut norovirusvatsatautitapaukset ovat kuitenkin vain pieni osa kaikista tautitapauksista, koska norovirusvatsatauti menee tavallisesti nopeasti ohi itsestään. Kaikki eivät hakeudu oireiden vuoksi lääkäriin, joten diagnoosia ei varmisteta mikrobiologisesti, eikä kaikkia tapauksia siten rekisteröidä. Infektiivinen annos on erittäin pieni. Uusien tutkimusten mukaan todennäköisyys saada infektio yhdestä viruspartikkelista on jopa 0,5 (10). Norovirusta erittyy infektion aikana runsaasti ulosteen sekä oksennuksen mukana, ja tästä sekä pienestä infektiivisestä annoksesta johtuen norovirus leviää hyvin helposti. Se leviää suoraan ihmisestä toiseen tai vaihtoehtoisesti epäsuorasti kontaminoitujen pintojen sekä veden ja ruoan välityksellä (8), (11). Eri tutkimusten mukaan norovirus voi säilyä infektiokykyisenä erilaisilla pinnoilla muutamasta tunnista jopa 3-4 viikkoon (12), (13). Norovirus leviää myös pidempiä matkoja aerosolina oksentelun yhteydessä, ja infektion riski korreloi tällaisessa tilanteessa käänteisesti alttiina olevan henkilön etäisyyteen oksentavasta henkilöstä (14), (15). Oksentamisen yhteydessä ympäristöön voi levitä aerosolina jopa 3x10 7 noroviruspartikkelia (16). Viruksen eritys ulosteisiin voi jatkua jopa useita viikkoja infektion oireiden loputtua. Atmar ym. (2008) totesivat tuoreessa tutkimuksessaan että vapaaehtoiset koehenkilöt erittivät norovirusta ulosteissaan keskimäärin 28 vuorokauden ajan infektoitumisesta. Pisimmillään eritystä tapahtui vielä 56 vuorokauden jälkeen. (17) Oireetonkin kantaja erittää ilmeisesti vastaavia määriä virusta ulosteissaan, ja tällaiset henkilöt ovat suuri riski työskennellessään terveydenhuollossa sekä elintarvikkeiden käsittelyssä (5). Hollannissa ravintolaepidemian yhteydessä tehdyssä tutkimuksessa noroviruksen RNA:ta löydettiin elintarvikkeita käsittelevän työntekijän käsistä (18).

6 3 Vaikka norovirus-gastroenteriitti siis useimmiten menee ohi itsestään eikä tällöin vaadi erityishoitoa, ovat laajat epidemiat suuri ongelma esimerkiksi sairaaloissa ja vanhustenhoitolaitoksissa, joissa norovirus voi aiheuttaa heikkokuntoisille potilaille paljon vakavamman ja pidempikestoisemman taudin kuin normaaliväestölle. Riskiryhmiin kuuluvat erityisesti vanhukset ja immuunipuutteiset sekä vakavia perussairauksia sairastavat potilaat. Sairaalan vuodeosastolla syntyneen epidemian kontrollointi on erittäin vaikeaa, ja näissä tilanteissa potilaiden eristämisellä, henkilökunnan käsihygienialla sekä tarpeeksi tehokkaalla siivouksella on suuri merkitys. Virus leviää helposti potilaasta toiseen kosketuspintojen, hoitajien ja muun henkilökunnan välityksellä, ja vuodeosastolla viruksen pitkäaikainen erittyminen ulosteiden mukana on ongelmallista. (4) Norovirusdiagnostiikalla ei juurikaan käytetä yksittäisten potilaiden oireiden selvittämiseen, vaan sillä on suurempi merkitys juuri epidemioiden selvittelyssä. Diagnostiikassa voidaan käyttää erilaisia menetelmiä: ulosteesta virukset voidaan tunnistaa elektronimikroskoopin, geenimonistuksen (RT-PCR) tai antigeenin osoituksen avulla (ELISA). Norovirusta ei voida viljellä tavallisessa soluviljelmässä. Tästä johtuen monissa tutkimuksissa on käytetty noroviruksen sijasta kissan kalikivirusta. Vaikka tämä virus aiheuttaakin hengitystieinfektioita eikä gastroenteriittejä, se kuitenkin vaikuttaisi olevan muilta ominaisuuksiltaan lähempänä norovirusta kuin muut enteeriset kalikivirukset. Kissan kalikivirusta on käytetty koeasetelmissa, joissa on tutkittu esimerkiksi viruksen säilyvyyttä kosketuspinnoilla. (12) Tässä tutkimuksessa oli tarkoitus selventää miten norovirus voi epidemian aikana levitä sairaalan vuodeosastolla. Tutkimus toteutettiin keräämällä näytteitä vuodeosastolta, jossa oli äskettäin ollut vatsatauti-epidemia. Sairastuneista osalla oli mikrobiologisesti varmennettu norovirus-gastroenteriitti. Näytteistä etsittiin norovirusta käyttämällä reaaliaikaista RT-PCR-menetelmää, joka on herkin käytössä olevista metodeista noroviruksen havaitsemiseksi (19), (20). Se on tästä syystä parhaiten pintanäytteiden analysointiin sopiva menetelmä, koska pintanäytteissä voi olla myös hyvin pieniä

7 4 määriä virusta. Muista noroviruksen tunnistamiseen käytetyistä menetelmistä elektronimikroskopia on kaikkein epäherkin, koska se vaatii että ulostenäyte sisältää vähintään 10 6 viruspartikkelia yhdessä millilitrassa ulostetta (20). Norovirusta erittyy ulosteissa vielä pitkään oireiden loputtua ja se voi säilyä pitkiä aikoja tartuntakykyisenä kosketuspinnoilla. Tutkimuksen tarkoituksena oli tunnistaa potilashuoneessa sellaisia pintoja, jotka helposti kontaminoituvat, mutta joita ei välttämättä vastaavasti siivota tarpeeksi hyvin. Riittämätön siivous ja henkilökunnan puutteellinen käsihygienia voisi epäsuoran kosketustartuntatien kautta johtaa viruksen leviämiseen osastolla. 2 Menetelmät 2.1 Epidemian kuvaus ja näytteidenottoympäristö Tutkimus tehtiin Kaunialan sotavammasairaalassa, jossa välisenä aikana 45 potilasta ja 28 henkilökunnan jäsentä sairastui akuuttiin vatsatautiin viidellä eri osastolla (Taulukko 1). Epidemia alkoi osastolta C, jonne kuntoutukseen tulleen potilaan lähipiirissä oli ollut norovirusvatsatautia. Epidemian aiheuttajan selvittämiseksi sairaalassa otettiin seitsemältä potilaalta ulostenäytteitä. Näistä viidessä todettiin norovirusta ja yhdessä Clostridium difficile -bakteeri. Positiivisista noroviruslöydöksistä neljä saatiin maaliskuussa ja kaksi huhtikuussa. Yhdeltäkään henkilökuntaan kuuluvalta vatsatautiin sairastuneelta ei otettu ulostenäytteitä. Henkilökuntaan luettiin hoitajat, lääkärit ja laitoshuoltajat. Yksikään ravintokeskuksen työntekijä ei sairastunut. Ympäristönäytteet kerättiin vuodeosastolta A, jossa 12 potilasta sairastui vatsatautiin. Ensimmäinen potilas alkoi oireilla alkaen, mutta potilaasta ei tuolloin otettu ulostenäytteitä, eikä tautia siis ollut mikrobiologisesti varmistettu noroviruksen

8 5 aiheuttamaksi. Viimeinen potilas samalla osastolla sairastui ja oireet loppuivat samana päivänä. Tästäkään potilaasta ei oltu otettu ulostenäytteitä. Viimeiset norovirusnäytteet samalta osastolta otettiin kahdelta potilaalta 9.4, ja molemmat olivat positiiviset. Osaston hoitajista yhdellä oli vatsatautioireita epidemian aikana. Osasto Kaikki potilaat Sairastuneet potilaat % Henkilökunta Sairastuneet henkilökuntaan kuuluvat % A ,1 B ,6 C D E Yhteensä ,2 Taulukko 1. Vatsatautiin sairastuneiden sekä altistuneiden potilaiden ja hoitajien lukumäärät eri osastoilla Pintanäytteet otettiin , jolloin osastolla ei enää ollut ripuli- tai oksennusoireisia potilaita. Tutkimuksen aineistona käytettiin äskettäin norovirusgastroenteriitin sairastaneiden potilaiden huoneista otettuja pintanäytteitä. Pintanäytteitä otettiin kolmesta potilashuoneesta, joissa ei epidemian loppumisen jälkeen ollut tapahtunut potilasvaihtoa. Näytteet otettiin iltapäivällä, jolloin normaalista aamusiivouksesta oli kulunut muutamia tunteja. Yhdessä huoneessa oli yksi potilas (huone 1), kahdessa muussa kaksi potilasta (huoneet 2 ja 3). Koska kyseessä oli yksityinen sairaala, anottiin näytteidenottoon lupa sairaalan johtokunnalta. Kaikki potilaat olivat yhteistyöhaluisia ja suostuivat näytteidenottoon. Huoneen 1 potilaalla oli alkanut mikrobiologisesti varmistettu norovirusvatsatauti 9.4. Oireina olivat ripuli sekä oksentelu. Potilas oli suhteellisen omatoiminen, kävi

9 6 itsenäisesti wc:ssä sekä pesulla. Suihkussa ollessaan potilas istui seinään kiinnitetyllä alas taittuvalla muovituolilla. Potilaan oireilu päättyi 12.4., joten näytteet otettiin vasta 16 vuorokautta tämän jälkeen. Näytteitä otettiin itse huoneesta sekä sen yhteydessä olevasta wc/suihkutilasta. Huoneessa 2 oli kaksi potilasta, joista vain toisella oli ollut oireina oksentelua alkaen. Potilaasta ei ollut otettu ulostenäytteitä. Samalla potilaalla oli ollut vatsatautia myös , kun taas huoneen toinen potilas oli oireeton koko epidemian ajan. Huoneen kummatkin potilaat olivat vuodepotilaita, jotka eivät käyneet itsenäisesti wc:ssä tai suihkussa eivätkä liikkuneet huoneessa ilman hoitohenkilökunnan apua. Näytteet otettiin 9 vuorokautta oireiden päättymisen jälkeen vatsataudin sairastaneen potilaan käyttämistä huonekaluista ja tavaroista. Näytteitä otettiin lisäksi molempien potilaiden käyttämästä yhteisestä huoneen yhteydestä olevasta wc/suihkutilasta. Edellä mainitun potilaan pesemisessä käytettiin apuna suihkutuolia, toinen potilas pestiin suihkusängyllä. Huoneessa 3 oli kaksi vuodepotilasta, joilla oli epäilty kliinisen kuvan perusteella norovirusvatsatautia. Oireet kestivät molemmilla potilailla , ja niitä olivat sekä ripulointi, oksentelu että lämpöily. Samoin kuin huoneessa 2, näytteitä otettiin ainoastaan toisen potilaan käyttämistä tavaroista ja huonekaluista sekä yhteisestä wc/suihkutilasta, kaksi viikkoa oireiden päättymisen jälkeen. Potilas pestiin suihkutuolia apuna käyttäen. Näytteet otettiin lähes kaikilta pinnoilta sekä steriilillä sideharsotaitoksella (Selefatrade REF /2, 10 x 10 cm) että puuvartisella näytteenottotikulla (Selefatrade SEE ), mutta osalta pinnoista vain sideharsolla. Yhteensä näytteitä kerättiin 25 kappaletta, joista 15 oli sideharsonäytteitä ja 10 tikkunäytteitä. Huoneesta 1 kerättiin ainoastaan sideharsonäytteet, koska potilaan oireilusta oli jo kulunut niin pitkä aika. Yhteensä viisi sideharsonäytettä otettiin potilaan pöydän pinnasta, sängyn laidassa olevasta tukikahvasta, potilashuoneen oman television

10 7 kaukosäätimestä, wc-pöntön istuinosasta sekä suihkussa olevasta jo aiemmin mainitusta muovituolista. Huoneesta 2 otettiin sekä sideharso- että tikkunäytteitä. Viisi tikkunäytettä otettiin potilaan sängynlaidasta, sängyn nosturin napeista, muovisesta liukuesteestä potilaan ruokailutasolta, suihkutuolin istuinosasta sekä wc:n vesihanasta. Viisi sideharsonäytettä otettiin vastaavista paikoista kuin tikkunäytteet, mutta aina hieman eri kohdasta kuin tikkunäytteet. Huoneesta 3 kerättiin myös sekä sideharso- että tikkunäytteitä. Viisi tikkunäytettä otettiin potilaan sängynlaidasta, sängyn nosturin napeista, potilaan pöydän pinnasta, suihkutuolin istuinosasta sekä wc:n vesihanasta. Viisi sideharsonäytettä otettiin samoilta pinnoilta kuin tikkunäytteet. 2.2 Näytteenottotekniikat Tikkunäytteet Ennen näytteenottoa pumpulitikku kostutettiin 15 ml putkessa olevalla fosfaattipuskuroidulla keittosuola (PBS) liuoksella (noin 1 ml) kastamalla tikun pumpulipää puskuriin. Tikkunäyte otettiin pinnasta voimakkaasti hankaamalla, jonka jälkeen tikku laitettiin samaan 15 ml putkeen jossa se alun perin kostutettiin. Tämän jälkeen putki suljettiin. Tikut poistettiin putkista 1 tunnin kuluttua, ennen kuin puuvarsi oli ehtinyt imeä itseensä putkessa olevaa nestettä. Tällöin putkia ensin ravisteltiin voimakkaasti ja sen jälkeen puristettiin tikun pumpuliosaa putken sisäseinää vasten, jotta näyte irtoaisi tikusta mahdollisimman hyvin. Jokaisen tikun poiston jälkeen vaihdettiin puhtaat suojakäsineet. Tikkunäyte otettiin aina ennen samalta pinnalta otettavaa sideharsonäytettä, paitsi huoneessa 1, josta otettiin pelkät sideharsonäytteet.

11 Sideharsonäytteet Sideharsonäytteet kerättiin siis vastaavilta pinnoilta kuin tikkunäytteet, mutta aina hieman eri kohdasta. Näyte otettiin hankaamalla näytteenottopintaa yhdellä steriilistä paketista otetulla sideharsolla. Ennen näytteenottoa sideharso kostutettiin kaatamalla yhden Eppendorf-putken sisältö (2 ml PBS-liuosta) liinan keskiosaan. Näytteenoton jälkeen sideharso taiteltiin ja laitettiin mahdollisimman väljästi 50 ml steriiliin putkeen, jonka jälkeen putki suljettiin. Aina jokaisen näytteenoton jälkeen vaihdettiin puhtaat suojakäsineet. Yhdellä sideharsolla saatiin pyyhittyä paljon suurempi pinta-ala kuin näytteenottotikulla. Kaikki näytteitä sisältävät putket laitettiin mahdollisimman pian näytteenoton jälkeen kylmäpakkauksilla viilennettyyn kylmälaukkuun. Tämän jälkeen, ennen näytteiden analysointia, ne säilytettiin kylmiössä noin 4 C:n lämpötilassa. 2.3 Analyysimenetelmät Näytteet analysoitiin nukleiinihapposaostuksen jälkeen käyttämällä käänteistranskriptaasi-pcr-, eli RT-PCR-menetelmää. RT-PCR:n uusilla reaaliaikaisilla testeillä voidaan tunnistaa lähes kaikki eri norovirus-genotyypit, koska geenimonistus tapahtuu noroviruksen genomin hyvin konservoituneesta kohdasta polymeraasin ja kapsidin liitosalueelta (2), (21). Tämän tutkimuksen näytteiden analysoinnissa käytetty metodi pohjautuu Loisy ym. (2005) kehittelemään RT-PCR-menetelmään (19). Kyseisessä tutkimuksessa menetelmä kehiteltiin käytettäväksi noroviruksen löytämiseksi äyriäisistä, mutta se soveltuu käytettäväksi myös muista lähteistä peräisin olevien norovirus-näytteiden analysointiin. Itse näytteiden analysoinnin lisäksi tehtiin koe, jonka tarkoitus oli testata sideharsojen analysointimenetelmän toimivuutta. Koe tehtiin pipetoimalla eri määriä norovirusta PBS-puskuriin laimennettuna sideharsoille. Käytetyt laimennokset olivat 10 8, 10 7 sekä 10 5, joita kutakin pipetoitiin 1 ml kahdelle sideharsolle. Lisäksi tehtiin yksi negatiivinen

12 9 kontrolli PBS-liuoksella. Näistä harsoista etsittiin sitten norovirusta samoilla alla kuvatuilla analyysimenetelmillä kuin pintanäytesideharsoistakin. Myös alkuperäisestä noroviruslaimennoksesta tehtiin suoraan nukleiinihappoeristys, jolloin voitiin verrata virusmäärää ennen ja jälkeen saostusprosessin, ja laskea menetelmän virussaanto. Tikku-näytteenottomenetelmän toimivuutta ei testattu Näytteiden nukleiinihappoeristys Nukleiinihappoeristyksen avulla eristetään nukleiinihapot muusta näytteiden sisältämästä materiaalista. Tikku- ja sideharsonäytteiden nukleiinihappoeristyksessä käytettiin hieman erityyppisiä menetelmiä, mutta kumpikin perustuu siihen, että näytteiden sisältämä RNA sitoutuu piidioksidiin (silica). Silica toimii kiinteänä faasina näyteliuoksessa, jolloin kaikki partikkelit, jotka eivät ole tarttuneet siihen, pestään pois pesupuskurilla. Lopuksi nukleiinihapot eluoidaan silicasta Tikkunäytteet Tikut poistettiin näyteputkista jo tunnin päästä näytteenotosta, kuten aiemmin on kerrottu, ja putkeen jäi tämän jälkeen noin 1ml PBS-liuosta. Tästä liuoksesta otettiin 140 l nestettä. Eristyksessä käytettiin QIAamp Viral RNA kittiä, jonka avulla voi eristää näytteistä ainoastaan RNA:ta. RNA eristettiin mikrosentrifugia käyttäen. Näytenesteisiin lisättiin prosessin aikana lyysispuskuria, kahta erilaista pesupuskuria sekä eluointipuskuria. Lyysispuskuriin lisättiin ennen käyttöä kantaja RNA:ta (Carrier RNA), joka lisää RNA:n sitoutumista silica-kalvoon, sekä rajoittaa mahdollista RNaasi-aktiviteettia. Ensin pipetoitiin 560 l lyysispuskuria 1,5 ml mikrosenrtifugi-putkeen. Putkeen lisättiin 140 l näytettä, jonka jälkeen seos vorteksoitiin 15 sekunnin ajan. Näytettä inkuboitiiin huoneenlämmössä 10 minuutin ajan. Inkuboinnin jälkeen näyteputki sentrifugoitiin lyhyesti pisaroiden poistamiseksi putken kannen sisäpuolelta. Näytteeseen lisättiin 560 l etanolia, ja seosta vorteksoitiin 15 sekunnin ajan. Sekoituksen jälkeen putkea taas sentrifugoitiin lyhyesti.

13 10 Yllä kuvattujen vaiheiden jälkeen 630 l näyteseosta laitettiin varovasti QIAamp minikolumniin (joka oli 2 ml keräysputkessa). Putki suljettiin ja sitä sentrifugoitiin 6000 g:ssä 1 minuutin ajan. Tämän jälkeen mini-kolumni laitettiin puhtaaseen 2 ml keräysputkeen. Mini-kolumni avattiin ja siihen lisättiin taas 630 l näyteseosta. Minikolumnia sentrifugoitiin 6000 g:ssä minuutin ajan. Keräysputki vaihdettiin uuteen, puhtaaseen putkeen. Mini-kolumniin lisättiin nyt 500 l ensimmäistä pesupuskuria, ja sitä sentrifugoitiin 6000 g:ssä minuutin ajan. Keräysputki vaihdettiin puhtaaseen, ja mini-kolumniin laitettiin 500 l toista pesupuskuria. Seosta sentrifugoitiin g:ssä 3 minuutin ajan. Sentrifugoinnin jälkeen poistettiin mini-kolumni keräysputkesta, ja se laitettiin puhtaaseen 1,5 ml mikrosentrifugi-putkeen. Viimeiseksi lisättiin mini-kolumniin 60 l huoneenlämpöistä eluointipuskuria, ja seosta inkuboitiin huoneenlämmössä 1 minuutin ajan. Tämän jälkeen sentrifugoitiin näytettä minuutin ajan 6000 g:ssä. Sentrifugoinnin jälkeen seos pipetoitiin 1,5 ml Eppendorfputkeen Sideharsonäytteet Näytteiden keräyksen yhteydessä sideharsot siis kostutettiin 2 ml PBS-liuosta. Neste saatiin harsosta puristelemalla sitä pinseteillä näyteputken seinämää vasten. Tämän jälkeen sideharsoon lisättiin vielä 2 ml steriiliä vettä, joka puristettiin pois. Ensin näytteitä säilytettiin 20 minuuttia huoneenlämmössä, jonka jälkeen niihin lisättiin lyysispuskuri (NucliSens Lysis Buffer). Nestettä oli tämän vaiheen jälkeen yhteensä noin 7 ml. Saostuksessa käytettiin yhteensä kolmea erilaista pesupuskuria, yhtä eluointipuskuria ja silica-magneettihelmiä (NucliSens Magnetic Extraction Reagents) sekä magneettista saostuslaitetta (NucliSens minimag). Ennen käyttöä silica vorteksoitiin hyvin, niin ettei putken pohjalle jäänyt magneettipartikkeleita. Tämän jälkeen näyteseokseen pipetoitiin 50 l silicaa. Seos sekoitettiin nopeasti ja inkuboitiin 10 min huoneenlämmössä enää sekoittamatta. Inkuboinnin jälkeen sentrifugoitiin näyteseos 2

14 11 min ajan 1500 g:ssä (iso Eppendorf- sentrifugi jossa kaksipaikkaiset adapterit). Tämän jälkeen poistettiin neste. Seuraavaksi lisättiin 400 l pesupuskuria 1. Koko seos pipetoitiin 1,5 ml minimagputkeen, ja sitä pestiin 30 sekuntia magneetti ylhäällä. Neste poistettiin, ja putkeen lisättiin taas 400 l pesupuskuria 1, jonka jälkeen pestiin 30 sekuntia magneetti alhaalla ja poistettiin neste. Toisen pesun jälkeen lisättiin putkeen 500 l pesupuskuria 2, pestiin jälleen 30 sekuntia magneetti alhaalla ja neste poistettiin. Viimeksi mainittu vaihe toistettiin kaksi kertaa. Sen jälkeen lisättiin 500 l pesupuskuria 3, pestiin 15 sekuntia magneetti alhaalla ja poistettiin neste. Pesujen jälkeen lisättiin putkeen 50 l eluointipuskuria ja seos vorteksoitiin lyhyesti niin, että kaikki neste oli putken pohjalla. Neste inkuboitiin lämpöblokissa (60 C) 5 min ajan. Lopuksi kaikki neste siirrettiin pipetoimalla 1,5 ml Eppendorf-putkeen Reaaliaikainen RT-PCR Näytteiden nukleiinihappoeristyksen jälkeen tehtiin RT-PCR Light Cycler 2.0-koneella. RT-PCR:ssä käytettiin QIAGEN :in QuantiTect RT-PCR-kittiä. Geenikoettimina käytettiin TaqMan -koettimia (Applied Biosystems). Reaktioseos valmistettiin alukkeista ja koettimista, sekä kittiin sisältyvistä liuoksista ja templaatti-rna:sta. Virussaantokoe tehtiin GII-genotyypin noroviruksella, ja käytetyt alukkeet ja koetin käyvät ilmi taulukosta 2. Varsinaisessa pintanäyteanalyysissä käytettiin noroviruksen GI-genoryhmälle spesifisiä alukkeita ja koetinta (Maunula L, julkaisematon). Muilta osin GI- ja GII-genoryhmien analyysimenetelmä on samanlainen. Virussaannon määrityskokeessa käytettiin kvantitatiivista RT-PCR-määritystä. Tunnetusta norovirusnäytteestä tehtyä laimennossarjaa käyttäen tehtiin standardikäyrä, johon tuloksia verrattiin, ja voitiin arvioida näytteiden virusmäärä.

15 12 Alukkeet ja koetin Nukleotidisekvenssi (GII-genoryhmä) 1. QNIF2d (+) ATGTTCAGRTGGATGAGRTTCTCWGA 2. COG2R (-) TCGACGCCATCTTCATTCACA 3. QNIFS (+) FAM-AGCACGTGGGAGGGCGATCG-TAMRA Taulukko 2. Virussaantokokeen reaaliaikaisessa RT-PCR:ssä käytetyt alukkeet ja koettimet. Y vastaa C:tä tai T:tä, R vastaa A:ta tai G:tä ja W vastaa A:ta tai T:tä. Koetin (3.) on merkitty 5 -päästä FAM-molekyylillä (6-carboxy fluorescein) ja 3 -päästä TAMRAmolekyylillä (6-carboxy-tetramethylrhodamine). Aluksi sulatettiin reaktioseokseen tulevat liuokset. Yksittäiset liuokset sekoitettiin ja laitettiin jäille. Reaktioseos valmistettiin ohjeen mukaan ja sekoitettiin hyvin. Seosta pipetoitiin 15 l PCR kapillaareihin, jonka jälkeen lisättiin kapillaareihin 5 l templaatti-rna:ta reaktiota kohden. Kapillaarit laitettiin karusellissa PCR-koneeseen, joka ohjelmoitiin taulukossa 3 ilmenevän kaavan mukaisesti. Monistussykli toistettiin 50 kertaa. Vaihe Vaiheen kesto Lämpötila Käänteistranskriptio 20 min 50 C DNA-polymeraasin aktivaatio 15 min 95 C 3-vaiheinen monistus: 1. Denaturaatiovaihe 3 s 95 C 2. Liittymisvaihe 25 s 54 C 3. Ekstensiovaihe 25 s 72 C Taulukko 3. Reaaliaikaisen RT-PCR:n vaiheet

16 13 3 Tulokset 3.1 Pintanäytteet Kaikki 25 pintanäytettä analysoitiin yllä kuvatulla menetelmällä. Yksi näyte oli positiivinen noroviruksen suhteen RT-PCR-menetelmällä. Kyseinen näyte oli otettu sideharson avulla wc:n suihkutuolin istuinosasta potilashuoneesta 2, yhdeksän vuorokautta suihkutuolia käyttäneen potilaan oireiden päättymisen jälkeen. Istuimessa oli keskellä wc-istuimeen verrattavissa oleva reikä. Näytteenoton yhteydessä harsolla oli pyyhitty istuinta laajalta alueelta, erityisen tarkasti reiän reunoilta. Koska näytteitä ei analysoitu kvantitatiivisesti, ei virusgenomin määrää näytteessä voitu mitata. Positiivisessa näytteessä oli kuitenkin huomattavasti vähemmän viruspartikkeleita kuin kontrollinäytteessä. RT-PCR:ssä (Light Cycler 2.0) näyte tuli positiiviseksi vasta ajokierroksella 34, kun taas positiivinen kontrolli tuli positiiviseksi kierroksella 24. Pintanäytteestä löytynyt virus kuului genoryhmään I. 3.2 Sideharsojen analysointimenetelmän toimivuuskoe PCR-analyysissä niistä sideharsoista, joihin oli pipetoitu 10 8 ja 10 7 viruslaimennoksia, ei löytynyt norovirusta, eikä näiden laimennosten perusteella voinut laskea saantoprosenttia. Sen sijaan sideharsoista, joihin oli lisätty 10 5 laimennosta, löytyi virusta. Harsoista löytyi keskimäärin 27,25 PCR-yksikköä viruspartikkeleita 1 ml:sta ja alkuperäisestä laimennoksesta tehdyssä suorassa saostuksessa löytyi keskimäärin 10,65 PCR-yksikköä 150 l:sta. Numeroarvot saatiin vertaamalla tuloksia PCR-koneella ajettuun standardikäyrään. Niiden perusteella menetelmän virussaantoprosentiksi laskettiin 38,4.

17 14 4 Pohdinta Yhdessä tutkimuksen ympäristönäytteessä todettiin noroviruksen nukleiinihappoa 10 vuorokauden kuluttua huoneessa asuvan vatsatautipotilaan oireiden loppumisen jälkeen. Näyte oli otettu kylpyhuoneen suihkutuolin muovisesta istuinrenkaasta sideharson avulla. Muista tutkituista kohdista tai huoneista virusta ei löytynyt. Kahdessa muussa huoneessa näytteiden otto tapahtui 14 ja 16 vuorokautta asukkaan oireiden loppumisen jälkeen. Pintanäytteestä löydetty norovirus kuului siis genoryhmään GI. Saman genoryhmän viruksia oli löytynyt Kaunialan sairaalasta myös potilasnäytteistä, jotka oli otettu kyseisen epidemian aikana. Koska osastolla ei ollut enää oireilevia potilaita, ennakolta pidettiin epätodennäköisenä, että norovirusta löytyisi yhdestäkään huoneesta. Jos virusta olisi yhä ollut useilla pinnoilla, olisi kosketuspintojen kautta voinut tapahtua leviämistä ja epidemia olisi todennäköisesti jatkunut. Tutkimuksissa on saatu paljon todisteita siitä, että ympäristön kontaminoituminen voi ylläpitää tartuntoja esimerkiksi sairaalan vuodeosastolla, jos kosketuspintoja ei puhdisteta kunnolla (4), (22). Barker ym. (2004) osoittivat tutkimuksessaan että noroviruksella kontaminoidut sormet voivat siirtää viruspartikkeleita jopa seitsemälle ennestään puhtaalle pinnalle, kun näitä pintoja kosketaan peräjälkeen (16). Jos siis kontaminoituja pintoja ei puhdisteta riittävän tehokkaasti, voi se johtaa uusien potilaiden ja työntekijöiden sairastumiseen. Siivouksen lisäksi on tärkeää huolehtia käsien pesusta ja desinfioinnista. Oikeaoppista käsihygieniaa pidetäänkin tärkeimpänä yksittäisenä epidemiaa rajoittavana tekijänä (23). Epidemian rajoittamiseksi on tärkeää että torjuntatoimet aloitetaan viivyttelemättä. Hoitohenkilökunnalla on epidemiatilanteessa ratkaiseva rooli. Tilanteesta tulisi tiedottaa henkilökunnalle ja antaa toimintaohjeet mieluiten kirjallisena. (4) Myös potilaita sekä omaisia tulisi informoida.

18 15 Gallimore ym. päätyivät vuonna 2008 julkaistussa tutkimuksessaan siihen, että hoitohenkilökunnan informointi hygieniatoimenpiteiden tehostamisesta vähensi merkittävästi noroviruksen esiintymistä erilaisilla pinnoilla sairaalan vuodeosastolla (24). Tutkimuksessa kerättiin pintanäytteitä kahdelta eri lasten vuodeosastolta, ja tuloksia verrattiin samoilta osastoilta aikaisemmassa tutkimuksessa otettuihin pintanäytteisiin (25). Ensimmäisen tutkimuksen aikana hoitohenkilökuntaa informoitiin tehokkaamman hygienian merkityksestä epidemioiden synnyssä. Uudemmassa tutkimuksessa ilmeni, että osastojen pintojen kontaminaatioaste oli selvästi vähentynyt. Tilanne parani kuitenkin selvästi enemmän niiden pintojen osalta, joiden kanssa hoitajat olivat kosketuksissa, verrattuna pintoihin, joiden kanssa myös potilaiden vanhemmat olivat tekemisissä. Omaisten informoinnilla on siis myös tärkeä rooli epidemian rajoittamisessa ja osastojen kontaminaatioasteen vähentämisessä. Kaunialan sairaalassa suositellaan epidemian aikana käsien pesua vedellä ja saippualla, sekä vielä huolellisen kuivauksen jälkeen käsien desinfiointia (liite 1). Sairaalan osastoilla käytetään käsidesinfektioon kahta erilaista ainetta, jotka sisältävät alkoholia 73,5 sekä 70 paino %. Etanolipohjaisten desinfektioaineiden tehosta norovirukseen ei ole selvää näyttöä, ja aiheesta on olemassa ristiriitaisia tutkimustuloksia. Esimerkiksi Malik ym. (2006) mukaan isopropanoli olisi kissan kalikiviruksen eliminoimisessa tehokkaampaa kuin etanoli, mutta kummallakaan aineella ei pystytty tappamaan yli 99,9 % viruksista (26). Toisaalta eräiden muiden tutkimusten perusteella näyttäisi siltä, että etanoli olisi selvästi tehokkaampaa kuin isopropanoli (27). Kaikkein tehokkaimmasta alkoholipitoisuudesta ei olla päästy yksimielisyyteen, mutta parhaat tulokset on saatu yli 50 % vahvuisilla aineilla (26). Kansanterveyslaitoksen vuodelta 2007 olevan suosituksen mukaan etanolipohjaisia käsidesinfektioaineita tulisi käyttää käsienpesun lisäksi sairaan- ja vanhustenhoitolaitoksissa, joissa hoidetaan vatsatautipotilaita (28). Potilaalla, jonka huoneesta norovirusta löytyi, oli ollut epidemian aikana kaksi vatsatautijaksoa, mutta huonetoverilla ei yhtään. Kummallakaan kerralla potilaasta ei otettu ulostenäytteitä eikä siis tiedetä, olivatko vatsataudit noroviruksen aiheuttamia.

Norovirukset pinnoilla ja niiden leviäminen elintarvikkeita käsiteltäessä

Norovirukset pinnoilla ja niiden leviäminen elintarvikkeita käsiteltäessä Norovirukset pinnoilla ja niiden leviäminen elintarvikkeita käsiteltäessä Viruskontaminaatioiden hallinta elintarviketuotannossa seminaari Maria Rönnqvist Helsingin yliopisto Maria Rönnqvist 23.4.2013


Norovirus ja Clostridium difficile sairaalassa. Hygieniahoitaja Ella Mauranen Kuopion yliopistollinen sairaala Infektioyksikkö 4620 28.5.

Norovirus ja Clostridium difficile sairaalassa. Hygieniahoitaja Ella Mauranen Kuopion yliopistollinen sairaala Infektioyksikkö 4620 28.5. Norovirus ja Clostridium difficile sairaalassa Hygieniahoitaja Ella Mauranen Kuopion yliopistollinen sairaala Infektioyksikkö 4620 28.5.2008 1 Tavanomaiset varotoimet Tavanomaiset varotoimet Noudatetaan


Virusten esiintyminen ravintolatilojen pinnoilla. Leena Maunula, Elintarvikehygienian ja ympäristöterveyden osasto, ELTDK, HY 25. 4.

Virusten esiintyminen ravintolatilojen pinnoilla. Leena Maunula, Elintarvikehygienian ja ympäristöterveyden osasto, ELTDK, HY 25. 4. Virusten esiintyminen ravintolatilojen pinnoilla Leena Maunula, Elintarvikehygienian ja ympäristöterveyden osasto, ELTDK, HY 25. 4. 2013 Eläinlääketieteellinen tiedekunta / Leena Maunula 6.5.2013 1 Pintanäytetutkimukset


Virukset luonnonvesissä. Dos. Leena Maunula, Elintarvikehygienian ja ympäristöterveyden osasto, ELTDK, HY 25. 04. 2013

Virukset luonnonvesissä. Dos. Leena Maunula, Elintarvikehygienian ja ympäristöterveyden osasto, ELTDK, HY 25. 04. 2013 Virukset luonnonvesissä Dos. Leena Maunula, Elintarvikehygienian ja ympäristöterveyden osasto, ELTDK, HY 25. 04. 2013 Eläinlääketieteellinen tiedekunta / Leena Maunula 6.5.2013 1 Virukset vesi- ja elintarvikevälitteisten


Norovirustartunnat ja niiden estäminen

Norovirustartunnat ja niiden estäminen Norovirustartunnat ja niiden estäminen Hoitoon liittyvät infektiot ja sairaalahygienia ilman rajoja, Evira/Helsingin yliopisto Esityksen aiheita Noroviruksen esiintyminen pintanäytteissä Noroviruksen siirtymiskokeet


Noroviruksen epidemiologia maailmalla ja Suomessa

Noroviruksen epidemiologia maailmalla ja Suomessa Noroviruksen epidemiologia maailmalla ja Suomessa Haider Al-Hello Erikoistutkija, INFO/INVI 15.11.2016 1 Ripulitauteja aiheuttavat virukset Norovirukset Rotavirukset Adenovirukset (serotyypit 40 ja 41)


Virusriskin vähentäminen elintarviketuotannossa

Virusriskin vähentäminen elintarviketuotannossa Virusriskin vähentäminen elintarviketuotannossa Satu Salo, VTT Expert Services Oy Marjaana Rättö, Irina Tsitko ja Hanna Miettinen, VTT 2 Viruskontaminaation riskinhallintakeinojen kehittäminen ja arvioiminen


Siivous ja desinfektio. Laitoshuoltopäällikkö Tanja Salomaa 16.11.2009

Siivous ja desinfektio. Laitoshuoltopäällikkö Tanja Salomaa 16.11.2009 Siivous ja desinfektio Laitoshuoltopäällikkö Tanja Salomaa 16.11.2009 Sairaalasiivous siivouksen tavoitteena on luoda edellytykset tilan varsinaiselle toiminnalle huomioiden: hygieenisyys viihtyisyys edustettavuus


Vuorelan vesiepidemia 2012. Sirpa Hakkarainen Terveystarkastaja Siilinjärven ympäristöterveyspalvelut

Vuorelan vesiepidemia 2012. Sirpa Hakkarainen Terveystarkastaja Siilinjärven ympäristöterveyspalvelut Vuorelan vesiepidemia 2012 Sirpa Hakkarainen Terveystarkastaja Siilinjärven ympäristöterveyspalvelut Epidemiaepäily Tavanomaista enemmän vatsatautiin sairastuneiden yhteydenottoja Vuorelan terveysasemalle


Katsaus elintarvikevälitteisiin epidemioihin Shp-SIRO-FiRe-päivät 30.9.-1.10.2013

Katsaus elintarvikevälitteisiin epidemioihin Shp-SIRO-FiRe-päivät 30.9.-1.10.2013 Katsaus elintarvikevälitteisiin epidemioihin Shp-SIRO-FiRe-päivät 30.9.-1.10.2013 Sari Huusko TH, TtM Tartuntatautien torjuntayksikkö Katsaus elintarvikevälitteisiin epidemioihin Kryptosporidioosiepidemiat


Uimavesiepidemia Tampereella 2014. Sirpa Räsänen ( ) Epidemiologi, tartuntatautivastuulääkäri Tre / PSHP

Uimavesiepidemia Tampereella 2014. Sirpa Räsänen ( ) Epidemiologi, tartuntatautivastuulääkäri Tre / PSHP Uimavesiepidemia Tampereella 2014 Sirpa Räsänen ( ) Epidemiologi, tartuntatautivastuulääkäri Tre / PSHP Tampere 146 järveä (!) 50 yli 10 ha järveä Näsijärvi ja Pyhäjärvi suurimmat 33 uimarantaa


Markku Kuusi Mari Kanerva Outi Lyytikäinen. Toimenpideohje norovirus-tartuntojen ehkäisemiseksi

Markku Kuusi Mari Kanerva Outi Lyytikäinen. Toimenpideohje norovirus-tartuntojen ehkäisemiseksi Markku Kuusi Mari Kanerva Outi Lyytikäinen Toimenpideohje norovirus-tartuntojen ehkäisemiseksi Kansanterveyslaitoksen julkaisuja C 5/2007 Työryhmä Markku Kuusi, Mari Kanerva, Outi Lyytikäinen, Kansanterveyslaitos,


Hoitoympäristö epidemioiden lähteenä. Valtakunnalliset Sairaalahygieniapäivät 25.-26.3.2014 Jaana Vatanen HUS, HYKS Peijas

Hoitoympäristö epidemioiden lähteenä. Valtakunnalliset Sairaalahygieniapäivät 25.-26.3.2014 Jaana Vatanen HUS, HYKS Peijas Hoitoympäristö epidemioiden lähteenä Valtakunnalliset Sairaalahygieniapäivät 25.-26.3.2014 Jaana Vatanen HUS, HYKS Peijas 1 Hoitoympäristö Sairaalaympäristö tiloja, pintoja, huonekaluja, välineitä Ympäristö


Välinehuollon pintojen puhtaus. Tiina Kurvinen Hygieniahoitaja, Oh, TtM VSSHP/Sairaalahygienia ja infektiontorjunta 2015

Välinehuollon pintojen puhtaus. Tiina Kurvinen Hygieniahoitaja, Oh, TtM VSSHP/Sairaalahygienia ja infektiontorjunta 2015 Välinehuollon pintojen puhtaus Tiina Kurvinen Hygieniahoitaja, Oh, TtM VSSHP/Sairaalahygienia ja infektiontorjunta 2015 Ylläpitosiivous Henkilöhygienia, käsihygienia, tavanomaiset varotoimet Työskentelypintojen


Eristyksen kesto. Sairauden kesto. Sairauden kesto. Oireiden kesto. Oireiden kesto

Eristyksen kesto. Sairauden kesto. Sairauden kesto. Oireiden kesto. Oireiden kesto 1 KOSKETUSERISTYS Käytetään potilailla, joilla tiedetään tai epäillään olevan helposti suoran tai epäsuoran kosketuksen välityksellä leviävä infektio. Kosketuseristyksen tarkoituksena on katkaista kosketustartuntatie.


C.Difficilen säilyminen potilaassa ja leviäminen. ympäristöön 24.2.2011 1

C.Difficilen säilyminen potilaassa ja leviäminen. ympäristöön 24.2.2011 1 C.Difficilen säilyminen potilaassa ja leviäminen 24.2.2011 1 C. Difficilen säilyminen potilaassa ja leviäminen Klostridien patogeneesistä ja leviämisestä Leviämisen ehkäisy /


Koht dialogia? Organisaation toimintaympäristön teemojen hallinta dynaamisessa julkisuudessa tarkastelussa toiminta sosiaalisessa mediassa

Koht dialogia? Organisaation toimintaympäristön teemojen hallinta dynaamisessa julkisuudessa tarkastelussa toiminta sosiaalisessa mediassa Kohtdialogia? Organisaationtoimintaympäristönteemojenhallinta dynaamisessajulkisuudessatarkastelussatoiminta sosiaalisessamediassa SatuMariaPusa Helsinginyliopisto Valtiotieteellinentiedekunta Sosiaalitieteidenlaitos


Ebola tietoisku. Veli-Jukka Anttila osastonylilääkäri HYKS/Tulehduskeskus/infektiosairaudet Infektioidentorjuntayksikkö

Ebola tietoisku. Veli-Jukka Anttila osastonylilääkäri HYKS/Tulehduskeskus/infektiosairaudet Infektioidentorjuntayksikkö Ebola tietoisku Veli-Jukka Anttila osastonylilääkäri HYKS/Tulehduskeskus/infektiosairaudet Infektioidentorjuntayksikkö Perusasioita Ebola viruksesta Kuuluu filovirusten sukuun Ainakin 5 eri Ebola viruslajia


Hepatiitti E -viruksen esiintyminen ihmisissä ja eläimissä Suomessa

Hepatiitti E -viruksen esiintyminen ihmisissä ja eläimissä Suomessa Hepatiitti E -viruksen esiintyminen ihmisissä ja eläimissä Suomessa Tuija Kantala ELL, yliopisto-opettaja, jatkotutkinto-opiskelija Elintarvikehygienian ja ympäristöterveyden osasto Eläinlääketieteellinen



POTILAAN HYGIENIAOPAS POTILAAN HYGIENIAOPAS Erikoissairaanhoito Hatanpään sairaala Sisältö SISÄLLYSLUETTELO Hygienia sairaalassa. 2 Käsihygienia.. 3 Käsien pesu 4 Käsien desinfektio... 5 Yskimishygienia.. 6 Henkilökohtainen


Kausi-influenssa lähestyy, miten suojaat potilaasi ja itsesi? Hannu Syrjälä

Kausi-influenssa lähestyy, miten suojaat potilaasi ja itsesi? Hannu Syrjälä Kausi-influenssa lähestyy, miten suojaat potilaasi ja itsesi? Hannu Syrjälä 30.9.2016 Kausi-influenssalöydökset PPSHP:ssä 2014-16 (Nordlab) 140 120 116 100 86 94 80 75 2014 60 40 20 16 18 27 42 36 39 29


Mitä moniresistentin mikrobin kantajuus tarkoittaa? Eristääkö vai ei?

Mitä moniresistentin mikrobin kantajuus tarkoittaa? Eristääkö vai ei? Mitä moniresistentin mikrobin kantajuus tarkoittaa? Eristääkö vai ei? Infektioiden torjunnalla turvaa ja laatua hoitolaitoksiin Alueellinen koulutuspäivä 29.11.2016 Hygieniahoitaja, Anu Harttio-Nohteri/VSSHP


Keskuslaskimokanyyliin liittyvien infektioiden torjunta

Keskuslaskimokanyyliin liittyvien infektioiden torjunta Keskuslaskimokanyyliin liittyvien infektioiden torjunta Kuvallisten ohjeiden kehittäminen Kehittämistyö, Arcada, Hygieniahoitajan opinnot Maarit Juti Sisältö Miksi nämä ohjeet? Verinäytteenotto CVK:sta



OLLI RUOHO TERVEYDENHUOLTOELÄINLÄÄKÄRI. ETT ry OLLI RUOHO TERVEYDENHUOLTOELÄINLÄÄKÄRI ETT ry VIRUSRIPULIT, HENGITYSTIETULEHDUKSET Ajoittain esiintyviä, erittäin helposti leviäviä V. 2012 tarttuvaa, voimakasoireista koronavirusripulia (?)





Influenssaepidemia laitoksessa, miten tunnistan, miten hoidan

Influenssaepidemia laitoksessa, miten tunnistan, miten hoidan Influenssaepidemia laitoksessa, miten tunnistan, miten hoidan 25.11.2014 Katariina Kainulainen Dos, sisätautien ja infektiosairauksien erikoislääkäri HUS, infektioklinikka Influenssaepidemia vanhainkodissa


Yhdyshenkilöiden kokemuksia opitun soveltamisesta käytäntöön. HUS / HYKS Jorvin sairaala sh Eeva Roivas

Yhdyshenkilöiden kokemuksia opitun soveltamisesta käytäntöön. HUS / HYKS Jorvin sairaala sh Eeva Roivas Yhdyshenkilöiden kokemuksia opitun soveltamisesta käytäntöön HUS / HYKS Jorvin sairaala sh Eeva Roivas Hygieniayhdyshenkilönä osastolla NE3 Neurologian vuodeosasto, potilaspaikkoja 22-24 (2 ylipaikkaa)


Aika/Datum Month and year Kesäkuu 2012

Aika/Datum Month and year Kesäkuu 2012 Tiedekunta/Osasto Fakultet/Sektion Faculty Laitos/Institution Department Filosofian, historian, kulttuurin ja taiteiden tutkimuksen laitos Humanistinen tiedekunta Tekijä/Författare Author Veera Lahtinen


Sivu 1 / 3. Ohje on tarkoitettu hygieniavastuuhenkilöiden käyttöön laitoksen omien toimintaohjeiden pohjaksi.

Sivu 1 / 3. Ohje on tarkoitettu hygieniavastuuhenkilöiden käyttöön laitoksen omien toimintaohjeiden pohjaksi. Sivu 1 / 3 HOITO-OHJE HUS Mobiiliyksikkö ESBL Torjuntaohjeita pitkäaikaishoitolaitoksiin Ohje on tarkoitettu hygieniavastuuhenkilöiden käyttöön laitoksen omien toimintaohjeiden pohjaksi. ESBL-kantaja


Influenssa A(H1N1) -toimintaohjeita

Influenssa A(H1N1) -toimintaohjeita 1 (5) Influenssa A(H1N1) -toimintaohjeita 1. KUINKA TOIMIT, JOS EPÄILET SAIRASTUNEESI H1N1-INFLUENSSAAN? Jos epäilet sairastuneesi A(H1N1)-influenssaan, ÄLÄ MENE SAIRAANA TYÖHÖN, älä mene suoraan työterveyshuollon/


Työperäinen tuberkuloosi epidemia. V-J Anttila 26.3.2011 dos, osastonylilääkäri HYKS/Infektioepidemiologinen yksikkö/sairaalahygieniayksikkö

Työperäinen tuberkuloosi epidemia. V-J Anttila 26.3.2011 dos, osastonylilääkäri HYKS/Infektioepidemiologinen yksikkö/sairaalahygieniayksikkö Työperäinen tuberkuloosi epidemia V-J Anttila 26.3.2011 dos, osastonylilääkäri HYKS/Infektioepidemiologinen yksikkö/sairaalahygieniayksikkö Tuberkuloosi ja terveydenhuoltohenkilöstö Suomessa terveydenhuoltohenkilökunnan


Infektioiden torjunta sädehoitopotilaalla

Infektioiden torjunta sädehoitopotilaalla Infektioiden torjunta sädehoitopotilaalla hygieniahoitaja 18.4.2013 Yleistä Syöpäpotilas on itse riskipotilas ca, hoidot, immuunipuutos, ab, oper. Hän voi olla myös tartuttava Resistentit mikrobit, ripulitaudit,


Avohoidon A-streptokokki-infektion torjunta, miten epidemia katkaistaan? Eeva Ruotsalainen Tartuntatautikurssi 15.4.2015

Avohoidon A-streptokokki-infektion torjunta, miten epidemia katkaistaan? Eeva Ruotsalainen Tartuntatautikurssi 15.4.2015 Avohoidon A-streptokokki-infektion torjunta, miten epidemia katkaistaan? Eeva Ruotsalainen Tartuntatautikurssi 15.4.2015 Perusasiaa Tartuntatapa Esiintyy iholla ja nielussa Pisara- ja kosketustartunta


Elintarvikkeet ja tartuntariskit. Markku Kuusi THL, Infektiotautien torjuntayksikkö VSSHP, 28.10.2015

Elintarvikkeet ja tartuntariskit. Markku Kuusi THL, Infektiotautien torjuntayksikkö VSSHP, 28.10.2015 Elintarvikkeet ja tartuntariskit Markku Kuusi THL, Infektiotautien torjuntayksikkö VSSHP, 28.10.2015 Luennon sisältö Gastroenteriittien ja ruokamyrkytysten esiintymisestä Suomen elintavikevälitteisistä


PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


Perhepäivähoidon hygieniaohjeet

Perhepäivähoidon hygieniaohjeet Perhepäivähoidon hygieniaohjeet Hygienia ja puhtaus Hygienia on aikuisen ja lasten henkilökohtaista hygieniaa sekä työympäristön-, lelujen ja elintarvikkeiden puhtautta. Hygienian tehostaminen päivähoidossa


Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö

Ituepidemia ja VTEC -tutkimukset elintarvikkeista. Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ituepidemia ja VTEC -tutkimukset elintarvikkeista Saija Hallanvuo Mikrobiologian tutkimusyksikkö Ajankohtaista laboratoriorintamalla / 12.10.2011 EHEC-ITUEPIDEMIAN VAIHEITA: Vahva signaali epidemiasta


15.4.2015 Tartuntatautitapauksia ja niiden ratkaisuja/ Katrine Pesola

15.4.2015 Tartuntatautitapauksia ja niiden ratkaisuja/ Katrine Pesola Tartuntatautitapauksia ja niiden ratkaisuja Katrine Pesola, THL 15.4.2015 Tartuntatautitapauksia ja niiden ratkaisuja/ Katrine Pesola 1 Salmonellakysymyksiä (1) Todettu Salmonella Infantis potilaalla,


Asiaa moniresistenteistä mikrobeista päivitettyjä ohjeita. Tarja Kaija hygieniahoitaja p

Asiaa moniresistenteistä mikrobeista päivitettyjä ohjeita. Tarja Kaija hygieniahoitaja p Asiaa moniresistenteistä mikrobeista päivitettyjä ohjeita Tarja Kaija hygieniahoitaja p. 3152574 Moniresistentit mikrobit Bakteeriviljelynäyte haavalta MRSA VRE losteviljelynäyte ESBL


Hoitoympäristön puhdistaminen. 3.11.2014 Sirpa Pekkala Sairaalahuoltopäällikkö PPSHP

Hoitoympäristön puhdistaminen. 3.11.2014 Sirpa Pekkala Sairaalahuoltopäällikkö PPSHP Hoitoympäristön puhdistaminen 3.11.2014 Sirpa Pekkala Sairaalahuoltopäällikkö PPSHP SISÄLTÖ Puhdistamisen tavoite Puhtaustasovaatimukset Siivousmenetelmät Puhdistusaineet Tartuntojen torjunta PUHDISTAMISEN



NOROVIRUSTEN MATKAT. C-H v. BONSDORFF NOROVIRUSTEN MATKAT C-H v. BONSDORFF 4.11.25 Suomen norovirusepidemiat 1998-22 Tapahtumapaikka Epidemiat (lkm) NV-positiiviset (%) Ravintolat, catering Laitokset, koulut Sairaalat, hoitokodit 13 53 37


Eristyssiivousohje. Pintojen puhdistaminen ja desinfektio. Eritetahradesinfektio: Klorilli 1000 ppm tai Erisan Oxy+ 2 % ja kertakäyttöpyyhe

Eristyssiivousohje. Pintojen puhdistaminen ja desinfektio. Eritetahradesinfektio: Klorilli 1000 ppm tai Erisan Oxy+ 2 % ja kertakäyttöpyyhe 1 (9) siivousohje: potilashuoneeseen, toimenpidehuoneeseen ja leikkaussaliin. Tätä ohjetta noudatetaan välisiivouksessa, päivittäisessä siivouksessa ja loppusiivouksessa. Pääsääntöisesti käytetään mikrokuituista


Katsaus elintarvikevälitteisiin epidemioihin ja yhteistyöhön Euroopan tautikeskuksen kanssa

Katsaus elintarvikevälitteisiin epidemioihin ja yhteistyöhön Euroopan tautikeskuksen kanssa Katsaus elintarvikevälitteisiin epidemioihin ja yhteistyöhön Euroopan tautikeskuksen kanssa Laboratorion näkökulma Susanna Lukinmaa-Åberg 2.10.2013 SHP tartuntatautiseurannan neuvottelupäivät 1 Zoonoottiset,


Laitosten ripuliepidemiat ja niiden hallinta sekä torjunta. Hygieniahoitaja Paula Niemi

Laitosten ripuliepidemiat ja niiden hallinta sekä torjunta. Hygieniahoitaja Paula Niemi Laitosten ripuliepidemiat ja niiden hallinta sekä torjunta Hygieniahoitaja Paula Niemi 25.11.2016 Käsiteltävät asiat Mikä on epidemia? Tavallisimmat ripuliepidemia aiheuttajat Mitkä ovat torjuntatoimet


TaLO-tapaukset Virusoppi. Vastuuhenkilöt: Tapaus 1: Matti Varis Tapaus 2: Veijo Hukkanen Tapaus 3: Sisko Tauriainen Tapaus 4: Ilkka Julkunen

TaLO-tapaukset Virusoppi. Vastuuhenkilöt: Tapaus 1: Matti Varis Tapaus 2: Veijo Hukkanen Tapaus 3: Sisko Tauriainen Tapaus 4: Ilkka Julkunen TaLO-tapaukset Virusoppi Vastuuhenkilöt: Tapaus 1: Matti Varis Tapaus 2: Veijo Hukkanen Tapaus 3: Sisko Tauriainen Tapaus 4: Ilkka Julkunen TaLO-tapaus 1 Uusi uhkaava respiratorinen virusinfektio Tapaus


Suojaa työpaikkasi sikainfluenssalta. (H1N1-virus)

Suojaa työpaikkasi sikainfluenssalta. (H1N1-virus) Suojaa työpaikkasi sikainfluenssalta (H1N1-virus) Sikainfluenssa on hengitysteiden sairaus, jota tavataan usein sioilla. Aiheuttajana on A-tyypin influenssavirus. On erittäin harvinaista, että ihminen


Tarttuvista taudeista

Tarttuvista taudeista OHJELMA Hippos kiittää tuesta seuraavia yhteistyökumppaneita: Intervet Oy Pharmaxim AB Scanvet Eläinlääkkeet Oy Vermon Ravirata Vetcare Oy 18.00 18.30 Tarttuvien tautien ennaltaehkäisy / ell. Katja Hautala


α-amylaasi α-amylaasin eristäminen syljestä ja spesifisen aktiivisuuden määritys. Johdanto Tärkkelys Oligosakkaridit Maltoosi + glukoosi

α-amylaasi α-amylaasin eristäminen syljestä ja spesifisen aktiivisuuden määritys. Johdanto Tärkkelys Oligosakkaridit Maltoosi + glukoosi n eristäminen syljestä ja spesifisen aktiivisuuden määritys. Johdanto Työssä eristetään ja puhdistetaan merkittävä ja laajalti käytetty teollisuusentsyymi syljestä. pilkkoo tärkkelystä ensin oligosakkarideiksi



PINTAPUHTAUDEN MITTAAMINEN PINTAPUHTAUDEN MITTAAMINEN Alueellinen sairaalahygieniapäivä HYSA 23.4.2015 Katja Koukkari HUS, Hyvinkään sairaala Taustatietoa testaukselle Hoitoympäristön merkityksestä hoitoon liittyvien infektioiden


Moniresistenttien mikrobien kantajien/altistuneiden hoito ja viljelynäytteet akuuttisairaanhoidon osastoilla ja poliklinikoilla

Moniresistenttien mikrobien kantajien/altistuneiden hoito ja viljelynäytteet akuuttisairaanhoidon osastoilla ja poliklinikoilla 1(5) Moniresistenttien mikrobien kantajien/altistuneiden hoito ja viljelynäytteet akuuttisairaanhoidon osastoilla ja poliklinikoilla Yleistä Sairaalaympäristössä mikrobien keskeisin tartuntareitti on kosketustartunta.


Uimarannat asetusmuutokset ja kesän 2014 epidemiat. Erikoissuunnittelija Outi Zacheus, THL, Vesi ja terveys -yksikkö

Uimarannat asetusmuutokset ja kesän 2014 epidemiat. Erikoissuunnittelija Outi Zacheus, THL, Vesi ja terveys -yksikkö Uimarannat asetusmuutokset ja kesän 2014 epidemiat Erikoissuunnittelija Outi Zacheus, THL, Vesi ja terveys -yksikkö 6.5.2015 Outi Zacheus, THL 1 STM:n asetusten (177/2008 ja 354/2008) muutosten taustat


Suojainten käyttö. Käytä eristyssiivouksessa eristyssiivousohjeistuksen mukaisia suojaimia. Suojaimet puetaan seuraavassa järjestyksessä.

Suojainten käyttö. Käytä eristyssiivouksessa eristyssiivousohjeistuksen mukaisia suojaimia. Suojaimet puetaan seuraavassa järjestyksessä. 1 Suojainten käyttö Käytä eristyssiivouksessa eristyssiivousohjeistuksen mukaisia suojaimia. Suojaimet puetaan seuraavassa järjestyksessä. Suojainten pukeminen Suusuojus à Suojalasit à Suojatakki à Suojakäsineet


Influenssarokotus miksi ja kenelle? Esa Rintala, ylilääkäri Sairaalahygienia- ja infektiontorjuntayksikkö VSSHP 2016

Influenssarokotus miksi ja kenelle? Esa Rintala, ylilääkäri Sairaalahygienia- ja infektiontorjuntayksikkö VSSHP 2016 Influenssarokotus miksi ja kenelle? Esa Rintala, ylilääkäri Sairaalahygienia- ja infektiontorjuntayksikkö VSSHP 2016 Influenssa Lisää väestön sairastuvuutta 5 15 % aikuisista ja 20 30 % lapsista sairastuu


Moniresistenttien mikrobien näytteenotto

Moniresistenttien mikrobien näytteenotto Moniresistenttien mikrobien näytteenotto Mika Paldanius Osastonhoitaja TtM, FT Mikrobiologian laboratorio Moniresistenttien mikrobien näytteenotto Mikrobit ovat erittäin muuntautumiskykyisiä Antibioottihoidoista


ROVANIEMEN KAUPUNKI. Hyvinvoiva lapsi. Hygienia ja infektioiden torjunta perhepäivähoidossa

ROVANIEMEN KAUPUNKI. Hyvinvoiva lapsi. Hygienia ja infektioiden torjunta perhepäivähoidossa ROVANIEMEN KAUPUNKI Hyvinvoiva lapsi Hygienia ja infektioiden torjunta perhepäivähoidossa Varhaiskasvatuspalvelut 2015 Työryhmä: Ahlsved Matias, tartuntataudeista vastaava hoitaja, Rovaniemen kaupunki


Influenssapotilaiden. pandemian aikana PPSHP:ssä. Hannu Syrjälä (H.S.) 13.5.09

Influenssapotilaiden. pandemian aikana PPSHP:ssä. Hannu Syrjälä (H.S.) 13.5.09 Influenssapotilaiden hoito pandemian aikana PPSHP:ssä Hannu Syrjälä (H.S.) 13.5.09 Influenssapandemiat Ainakin 31 (32) pandemiaa v. 1580 alkaen Espanjantauti ollut pahin (H1N1): vuosina 1918 1919 kolmena


PIKAOHJEET Käytettäväksi vain Sofia-analysaattorin kanssa.

PIKAOHJEET Käytettäväksi vain Sofia-analysaattorin kanssa. Analysaattori ja FIA PIKAOHJEET Käytettäväksi vain Sofia-analysaattorin kanssa. Testausmenetelmä Tutki pakkausseloste ja käyttöohje huolellisesti ennen pikaohjeiden käyttöä. Tämä ei ole täydellinen pakkausseloste.


Helsingin kaupunki Pöytäkirja 2/2012 1 (5) Sosiaalilautakunta Sosj/9 07.02.2012

Helsingin kaupunki Pöytäkirja 2/2012 1 (5) Sosiaalilautakunta Sosj/9 07.02.2012 Helsingin kaupunki Pöytäkirja 2/2012 1 (5) 28 Sosiaalilautakunnan lausunto kaupunginhallitukselle valtuutettu Essi Kuikan valtuustoaloitteesta koskien siirtymistä kuparisiin kosketuspintoihin HEL 2011-007800


Puhtauspalvelun laatu ja tehokkuus sairaalan näkökulmasta

Puhtauspalvelun laatu ja tehokkuus sairaalan näkökulmasta Puhtauspalvelun laatu ja tehokkuus sairaalan näkökulmasta V-J Anttila osastonylilääkäri, infektiolääkäri, dos HUS/Medisiininen tulosyksikkö Infektiosairauksienklinikka 26.10.2011 26.10.2011 1 Sairaalan


Ohjeistuksen ovat laatineet yhteistyössä päivähoidon kanssa: Terveystarkastaja Tiina Päätalo p. 681 4391 Hygieniahoitaja Susanna Tella p.

Ohjeistuksen ovat laatineet yhteistyössä päivähoidon kanssa: Terveystarkastaja Tiina Päätalo p. 681 4391 Hygieniahoitaja Susanna Tella p. HYGIENIA JA TARTUNTOJEN TORJUNTA PÄIVÄKODEISSA 2004 Ohjeistuksen ovat laatineet yhteistyössä päivähoidon kanssa: Terveystarkastaja Tiina Päätalo p. 681 4391 Hygieniahoitaja Susanna Tella p. 681 3233 Tämä


11.2.2015 Hoitoon liittyvät infektiot/o Lyytikäinen

11.2.2015 Hoitoon liittyvät infektiot/o Lyytikäinen Hoitoon liittyvät infektiot - aiheuttajamikrobit ja niiden tartuntatiet Outi Lyytikäinen, tutkimusprofessori Sairaalainfektio-ohjelma (SIRO) Infektiotautien torjuntayksikkö (INTA), Infektiotaudit - osasto


Varhaisvaiheen puhdistusleikkauksen tulokset lonkan ja polven tekonivelinfektion hoidossa - retrospektiivinen seurantatutkimus

Varhaisvaiheen puhdistusleikkauksen tulokset lonkan ja polven tekonivelinfektion hoidossa - retrospektiivinen seurantatutkimus Varhaisvaiheen puhdistusleikkauksen tulokset lonkan ja polven tekonivelinfektion hoidossa - retrospektiivinen seurantatutkimus Markku Vuorinen, Kaisa Huotari, Ville Remes Lääketieteellinen tiedekunta,


Työ- ja suojavaatteet sekä suojainten käyttö

Työ- ja suojavaatteet sekä suojainten käyttö Ohje henkilökunnalle 1 Työ- ja suojavaatteet sekä suojainten käyttö Infektioiden torjunta perustuu tartuntareittien katkaisuun. Infektioiden torjunta edellyttää hyvää käsihygieniaa ja aseptisia työtapoja.


Veren välityksellä tarttuvat taudit. Ajankohtaista infektioiden torjunnasta 7.10.2011 OYS, infektiolääkäri Lotta Simola

Veren välityksellä tarttuvat taudit. Ajankohtaista infektioiden torjunnasta 7.10.2011 OYS, infektiolääkäri Lotta Simola Veren välityksellä tarttuvat taudit Ajankohtaista infektioiden torjunnasta 7.10.2011 OYS, infektiolääkäri Lotta Simola Veren välityksellä tarttuvat taudit merkittävä tartunnanvaara taudeissa, joissa mikrobia


Torjuntatoimet hepatiitti A -tapauksen ja -epidemian yhteydessä Toimenpideohje

Torjuntatoimet hepatiitti A -tapauksen ja -epidemian yhteydessä Toimenpideohje SUOSITUS -tapauksen ja -epidemian yhteydessä Toimenpideohje Terveyden ja hyvinvoinnin laitos PL 30 (Mannerheimintie 116) 00271 Helsinki Puhelin: 029 524 6000 3 2012 Suositus 3/2012 -tapauksen


Entä jos laivalla epäillään tarttuvaa tautia - toimintaohjeita ja informaation kulku

Entä jos laivalla epäillään tarttuvaa tautia - toimintaohjeita ja informaation kulku Entä jos laivalla epäillään tarttuvaa tautia - toimintaohjeita ja informaation kulku Outi Lyytikäinen, tutkimusprofessori Infektiotautien torjuntayksikkö 9.3.2015 Laivatarkastuskoulutus / O Lyytikäinen


Tietojärjestelmien tuottamien hälytysten käyttö infektiopotilaiden hoitopäätöksissä

Tietojärjestelmien tuottamien hälytysten käyttö infektiopotilaiden hoitopäätöksissä Tietojärjestelmien tuottamien hälytysten käyttö infektiopotilaiden hoitopäätöksissä Infektiolääkäri Sakari Vuorinen Terveydenhuollon ATK-päivät 30.05.2006 klo 10-10.30 Terveydenhuollossa 3 erilaista infektioista


Elintarvike- ja vesiväliteiset epidemiat

Elintarvike- ja vesiväliteiset epidemiat Elintarvike- ja vesiväliteiset epidemiat Tartuntatautikurssi 2016 Sari Huusko, Infektiotautien torjuntayksikkö, THL Mikä on epidemia? Epidemia: tiettyjä tautitapauksia todetaan tavanomaista enemmän jonakin


Resistentin mikrobin kantaja tai tartunnanvaarallinen potilas päivystyksessä miten toimia?

Resistentin mikrobin kantaja tai tartunnanvaarallinen potilas päivystyksessä miten toimia? Resistentin mikrobin kantaja tai tartunnanvaarallinen potilas päivystyksessä miten toimia? Infektiolääkäri Pertti Arvola, TAYS Vaikeiden infektioiden alkuhoito symposium Helsinki 5.5.2011 Sisältö Leviävätkö


26.vuosikerta numero 2/2008. teemana ripulitaudit. Vain parasta jo vuodesta 1883

26.vuosikerta numero 2/2008. teemana ripulitaudit. Vain parasta jo vuodesta 1883 26.vuosikerta numero 2/2008 teemana ripulitaudit Vain parasta jo vuodesta 1883 Suomen Sairaalahygieniayhdistyksen hallitus 2007 Veli-Jukka Anttila HYKS /Medisiininen tulosyksikkö/infektiosairaudet, PL


Pintadesinfektion merkitys ja valmisliinojen käyttökelpoisuus VSSHP hygieniakoulutus , Turku

Pintadesinfektion merkitys ja valmisliinojen käyttökelpoisuus VSSHP hygieniakoulutus , Turku Pintadesinfektion merkitys ja valmisliinojen käyttökelpoisuus VSSHP hygieniakoulutus 17.5.2015, Turku Pintojen puhtauden merkitys terveydenhuollossa onko väliä? 1940-50 luvuilla MSSA ja A-ryhmän streptokokin


Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa

Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa Tämä esitys käsittelee siivouksen arviointia peruskouluissa Yhdysvalloissa tehdyn tutkimuksen valossa 1 Sisältö - Sisäympäristön laatu kouluissa - Tutkimuksen taustaa - Siivouksen arviointiin liittyvien


Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa

Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Kvantitatiivisen PCR:n käyttö mikrobivaurion toteamisessa Maria Valkonen, Kaisa Jalkanen, Martin Täubel, Anne Hyvärinen 31.3.2014 Sisäilmastoseminaari 2014 1 Tausta Asumisterveysoppaan mukaiset sisäympäristön


Yersinioiden epidemiologiaa. Markku Kuusi KTL Infektioepidemiologian osasto 04.11.2005

Yersinioiden epidemiologiaa. Markku Kuusi KTL Infektioepidemiologian osasto 04.11.2005 Yersinioiden epidemiologiaa Markku Kuusi KTL Infektioepidemiologian osasto 04.11.2005 Yersinia enterocolitica Suomessa ja kansainvälisesti yleisin yersinialaji meillä ilmaantuvuus korkea verrattuna muihin



INFEKTIO. TIEDOTE AJANKOHTAISISTA INFEKTIOASIOISTA No 4 /2008 14.10.2008 INFEKTIO TIEDOTE AJANKOHTAISISTA INFEKTIOASIOISTA No 4 /2008 14.10.2008 Jakelu: Tartuntatautivastuulääkärit ja -terveydenhoitajat Pirkanmaalla, PSHP ja Coxa Oy ENSIMMÄINEN Clostridium difficile (CD) 027-RIBOTYYPIN


Helsingin kaupunki Pöytäkirja 2/ (6) Terveyslautakunta Tja/

Helsingin kaupunki Pöytäkirja 2/ (6) Terveyslautakunta Tja/ Helsingin kaupunki Pöytäkirja 2/2012 1 (6) 18 Lausunto kuparisia kosketuspintoja ja infektioita koskevasta valtuustoaloitteesta HEL 2011-007800 T 00 00 03 Päätös päätti antaa kaupunginhallitukselle seuraavan


Täältä löytyy kaksi viime yön sairastanutta. Alkoi kuin salama kirkkaalta taivaalta, kesti koko yön ja jätti heikon olon.

Täältä löytyy kaksi viime yön sairastanutta. Alkoi kuin salama kirkkaalta taivaalta, kesti koko yön ja jätti heikon olon. Talvipäiviltä vatsatautia? Lähettäjä pantse - 09.03.09 14:03 Sovittiin tuossa toimihenkilöiden kesken, että aloitan tällaisen ketjun, kun saatiin talvipäivien jälkeen sairastuneiden pääluku jo kymmeneen.


Influenssavirusinfektioiden seuranta Suomessa

Influenssavirusinfektioiden seuranta Suomessa Influenssavirusinfektioiden seuranta Suomessa Niina Ikonen Tartuntatautikurssi, Helsinki 15.4.2015 14.4.2015 Influenssavirusinfektioiden seuranta/niina Ikonen 1 Influenssa vuosittaisia epidemioita ja ajoittain


Hankeraportti 2011: Salmonella kasviksissa

Hankeraportti 2011: Salmonella kasviksissa Hankeraportti 2011: Salmonella kasviksissa Syyskuu 2012 Sosiaali- ja terveysvirasto Terveysvalvontatoimisto Laatinut vt. terveystarkastaja Emma Bäck SISÄLTÖ 1. JOHDANTO...1 1.1. SALMONELLA...1 2. NÄYTTEENOTTO...2





Siivouskäytännöt - tekniikat ja menetelmät

Siivouskäytännöt - tekniikat ja menetelmät Siivouskäytännöt - tekniikat ja menetelmät Uimahallit, kylpylät ja kosteat tilat Sisältö Siivoushenkilöstön ammattitaitovaatimukset Henkilökohtainen hygienia Aseptiikka Siivouksen ajankohta Siivousmenetelmät,


MILLOIN HOITOON?! Sitä vastoin muille päiväkodin tai koulun lapsille ei suositella ennalta ehkäisevää hoitoa.

MILLOIN HOITOON?! Sitä vastoin muille päiväkodin tai koulun lapsille ei suositella ennalta ehkäisevää hoitoa. MILLOIN HOITOON?! Aivokalvontulehdus Tarttuva aivokalvontulehdus (meningokokkibakteeri) tarttuu ilmasta. Bakteeri leviää ilmaan yskittäessä ja niistettäessä. Monilla lapsilla on meningokokkeja nenässä


Hygieniavaatimukset kauneushoitoloissa ja ihon läpäisevissä toimenpiteissä

Hygieniavaatimukset kauneushoitoloissa ja ihon läpäisevissä toimenpiteissä Hygieniavaatimukset kauneushoitoloissa ja ihon läpäisevissä toimenpiteissä Ympäristöterveydenhuollon alueelliset koulutuspäivät 09.09.2014 Oulu Päivi Aalto Esityksen sisältö Taudinaiheuttajat ja tartuntariskit


Geenimonistus -ongelmia

Geenimonistus -ongelmia Geenimonistus -etuja nopeus spesifisyys herkkyys ei tarvitse elävää virusta tunnistetaan viruksia, joita ei voida viljellä hitaasti kasvavien virusten tunnistus nopeutuu kvantitaatio, genotyypitys Geenimonistus


Case Ebola ja opit viimeisestä pandemiasta. Mika Mäkinen 26.5.2015

Case Ebola ja opit viimeisestä pandemiasta. Mika Mäkinen 26.5.2015 Case Ebola ja opit viimeisestä pandemiasta Mika Mäkinen 26.5.2015 Bank of America and Merill Lynch (2014): A severe pandemic could kill 360mn and hit global GDP by 5% Pandemian määritelmä Uusi taudin aiheuttaja


Mitä resistentin mikrobin kantajuus merkitsee? Reetta Huttunen LT, infektiolääkäri, apulaisylilääkäri, TAYS, infektioyksikkö

Mitä resistentin mikrobin kantajuus merkitsee? Reetta Huttunen LT, infektiolääkäri, apulaisylilääkäri, TAYS, infektioyksikkö Mitä resistentin mikrobin kantajuus merkitsee? Reetta Huttunen LT, infektiolääkäri, apulaisylilääkäri, TAYS, infektioyksikkö Asia on kyllä tärkeä mutta älkää olko huolissanne? Terveydenhuollon laitoksessa


C.difficile alueellisena haasteena

C.difficile alueellisena haasteena C.difficile alueellisena haasteena V-J Anttila osastonylilääkäri, infektiolääkäri HYKS/Tulehduskeskus/Infektiosairaudet Infektioidentorjuntayksikkö 15.11.2016 C.difficile alueellisena haasteena C.diffcile



KÄSIHYGIENIAOHJE LÄNSI-POHJAN SAIRAANHOITOPIIRIN. KÄSIHYGIENIAOHJE KUNTAYHTYMÄ Infektio- ja sairaalahygieniayksikkö 28.11.2012 MITÄ KÄSIHYGIENIALLA TARKOITETAAN? Käsihygienialla tarkoitetaan käsiin kohdistuvia toimenpiteitä, joilla pyritään vähentämään infektioiden ja niitä aiheuttavien mikrobien siirtymistä käsien välityksellä.



KANSILEHDEN MALLISIVU Teknisiä ohjeita pro gradu -tutkielmalle Teologian osasto 12.11.2013 Tässä annettavat ohjeet ovat suosituksia. Viime kädessä seurataan tutkielman ohjaajan antamia ohjeita! Tutkielman kansilehdelle asetellaan





Alueellinen sairaalahygienia iltapäivä 19.4.2012 Päivi Näykki, sh aoh

Alueellinen sairaalahygienia iltapäivä 19.4.2012 Päivi Näykki, sh aoh Alueellinen sairaalahygienia iltapäivä 19.4.2012 Päivi Näykki, sh aoh Lähtökohtana Clostridium difficile 027 löydökset. Epidemia Hysa:lla v 2007 2011. Taudin luonteesta johtuva tarve torjua tautia. Kehiteltiin


NaturaPura Ibérica Elokuu 10, 2009 Rua das Australias, No. 1 4705-322 Braga Portugali

NaturaPura Ibérica Elokuu 10, 2009 Rua das Australias, No. 1 4705-322 Braga Portugali NaturaPura Ibérica Elokuu 10, 2009 Rua das Australias, No. 1 4705-322 Braga Portugali VIITATEN: IN VITRO IHOÄRSYTTÄVYYSTESTAUSRAPORTTI Oheisena NaturaPuran toimittaman 100% puuvillakangasmateriaalin in


Ajankohtaista infektioiden torjunnasta. Pekka Ylipalosaari Infektiolääkäri /OYS Infektioiden torjuntayksikkö 261015

Ajankohtaista infektioiden torjunnasta. Pekka Ylipalosaari Infektiolääkäri /OYS Infektioiden torjuntayksikkö 261015 Ajankohtaista infektioiden torjunnasta Pekka Ylipalosaari Infektiolääkäri /OYS Infektioiden torjuntayksikkö 261015 Mikä on runsaasti kosketeltujen pintojen merkitys influenssan leviämisessä? 49 näytettä


MCF julkisivun korjausmenetelmä. Microbe Control Finland Oy TaloTerveys Lajunen Oy

MCF julkisivun korjausmenetelmä. Microbe Control Finland Oy TaloTerveys Lajunen Oy Microbe Control Finland Oy TaloTerveys Lajunen Oy MCF Julkisivun korjausmenetelmä on tarkoitettu kosteusvaurioituneiden julkisivujen lämpötaloudelliseen kunnostukseen sekä kosteusperäisten terveyshaittojen


Hygienia päivähoidossa 2015 Projektiyhteenveto

Hygienia päivähoidossa 2015 Projektiyhteenveto Hygienia päivähoidossa 2015 Projektiyhteenveto Kesäkuu 2015 Sosiaali- ja terveysvirasto Terveysvalvonta Terveystarkastajat Liisa Haavisto, Susanne Jankens, Mia Hautala 1. Tausta Projekti Infektioriskien


Tarttuvien eläintautien huomioiminen luonnonlintuja käsiteltäessä

Tarttuvien eläintautien huomioiminen luonnonlintuja käsiteltäessä WWF Koulutus: Öljyyntyneiden lintujen käsittely, pesu ja hoito, Tarttuvien eläintautien huomioiminen luonnonlintuja käsiteltäessä Laila Rossow Tarttuvien tautien Erikoiseläinlääkäri Tarttuva eläintauti?


Tuberkuloosi ja raskaus. Esa Rintala, ylilääkäri Sairaalahygienia- ja infektiontorjuntayksikkö VSSHP 16.4.2015

Tuberkuloosi ja raskaus. Esa Rintala, ylilääkäri Sairaalahygienia- ja infektiontorjuntayksikkö VSSHP 16.4.2015 Tuberkuloosi ja raskaus Esa Rintala, ylilääkäri Sairaalahygienia- ja infektiontorjuntayksikkö VSSHP 16.4.2015 Tuberkuloosi Suomessa 500 450 400 350 Tapauksia 300 250 200 Keuhkotbc Muu tbc 150 100 50


EBOLAviruksesta Hanna Tuokko Nordlab, Oulu mikrobiologia. Ebolasta/ HT/Bionanalyytikkopäivät140215 1

EBOLAviruksesta Hanna Tuokko Nordlab, Oulu mikrobiologia. Ebolasta/ HT/Bionanalyytikkopäivät140215 1 EBOLAviruksesta Hanna Tuokko Nordlab, Oulu mikrobiologia Ebolasta/ HT/Bionanalyytikkopäivät140215 1 Todettuja Filovirusepidemioita v. 1979-2014 Ebolasta/ HT/Bionanalyytikkopäivät140215 2 Ebolatartuntoja


Sisältö Etiologia. Oireet. Erotusdiagnostiikka. Hälytysmerkit. Esitiedot. Kliininen arvio. Nestetarve & kuivuman korjaus

Sisältö Etiologia. Oireet. Erotusdiagnostiikka. Hälytysmerkit. Esitiedot. Kliininen arvio. Nestetarve & kuivuman korjaus Sisältö Etiologia Oireet Erotusdiagnostiikka Hälytysmerkit Esitiedot Kliininen arvio Nestetarve & kuivuman korjaus Hoitopaikan valinta Yhteenveto 1 Etiologia Yleisiä Valtaosa virustauteja Adeno, noro,


Tuhkarokko- ja sikotautiepidemoita Euroopassa

Tuhkarokko- ja sikotautiepidemoita Euroopassa Tuhkarokko- ja sikotautiepidemoita Euroopassa Labqualityn neuvottelukokous 17.10.2008 Irja Davidkin Tuhkarokko ja sikotauti virusten aiheuttamia lastentauteja, jotka ennen rokotuksia esiintyivät epidemioina
