III Perinnöllisyystieteen perusteita

Koko: px
Aloita esitys sivulta:

Download "III Perinnöllisyystieteen perusteita"

Transkriptio

1 Perinnöllisyystieteen perusteita III Perinnöllisyystieteen perusteita

2 12. Ominaisuuksien periytymistä tutkitaan risteytyksillä 1. Avainsanat 2. Geenit ja alleelit 3. Mendelin herneet 4. Monohybridiristeytys 5. Välimuotoinen periytyminen 6. Yhteisvallitseva periytyminen 7. Letaalialleelit 8. Tehtävät 9. Kuvat

3 Avainsanat: Samaperintäinen eli homotsygoottinen Eriperintäinen eli heterotsygoottinen Vallitseva eli dominoiva ominaisuus Peittyvä eli resessiivinen ominaisuus Alleelit Multippelit alleelit Mendelin kokeet Monohybridiristeytys Testiristeytys Välimuotoinen periytyminen Yhteisvallitseva periytyminen Letaalialleelit

4 Geenit ovat kromosomeissa Geenit siirtyvät sukusoluissa kromosomien mukana seuraavalla sukupolvelle. Jokaista geeniä on kaksi kappaletta ja ne vaikuttavat yhdessä ominaisuuteen. Mutaatioiden seurauksena saman lokuksen geeneistä on kehittynyt eri muotoja eli alleeleita. lokus lokus I A I B alleeli alleeli isältä peritty äidiltä peritty

5

6

7 Geenit ja alleelit Alleelit: geenin eri muodot Jokaisen geenin alleelien suhteen yksilö voi olla: Homotsygoottinen (AA tai aa). Heterotsygoottinen (Aa). Dominoivat (hallitsevat) alleelit: AA eli dominoiva homotsygootti Aa eli dominoiva heterotsygootti Resessiiviset (peittyvät) alleelit aa eli resessiivinen homotsygootti Multippelit alleelit (enemmän kuin kaksi alleelia)

8

9 Geno- ja fenotyyppi Hedelmöityksessä yksilö saa puolet geeneistään isältä ja puolet äidiltä ja yhdessä nämä muodostavat yksilön genotyypin. Genotyypin lisäksi ympäristötekijät vaikuttavat yksilön ominaisuuksiin. Puhutaan yksilön ilmiasusta eli fenotyypistä. Fenotyyppi voi muuttua yksilön elinaikana > puhutaan muovautumismuuntelusta.

10 Eliöiden ominaisuudet ovat geenien ja ympäristötekijöiden yhteisvaikutuksen tulosta Genotyyppi eli perimä tarkoittaa yksilön vanhemmiltaan perimiä geenejä GENOTYYPPI YMPÄRISTÖ FENOTYYPPI Fenotyyppi eli ilmiasu tarkoittaa sitä, miten ominaisuudet ilmenevät jälkeläisessä (havaittava ominaisuus) Ominaisuudet voivat liittyä rakenteeseen, elintoimintoihin tai käyttäytymiseen

11

12 Tehtävä 1 Selvitä kuka oli Gregor Mendel ja miksi häntä pidetään perinnöllisyysti eteen isänä?

13 Mendelin hernekokeet Mendel valitsi kokeisiinsa seitsemän erilaista herneen ominaisuutta ja teki laajoja, risteytyskokeita, jotka jatkuivat monen sukupolven ajan. Näiden kokeiden perusteella hän päätteli, että tietyt herneen ominaisuudet ovat periytyviä ja niiden taustalla olevat, sukupolvesta toiseen kulkeutuvat perintötekijät (geenit) voivat olla vallitsevia (dominantteja) tai peittyviä (resessiivisiä).

14 Mendelin herneet Gregor Mendel ( ) Ominaisuuksien periytyminen herneillä Mendelin herneet: Kun risteytetään kaksi puhdasta linjaa (AA ja aa), kaikki F 1 -polven jälkeläiset ilmentävät dominoivaa ominaisuutta (Aa). Kun kaksi F 1 -polven yksilöä (Aa) risteytetään, F 2 -polven jälkeläisistä 75 % ilmentää dominoivaa ominaisuutta ja 25 % resessiivistä ominaisuutta (AA, Aa, aa).

15 Dominoiva vs. resessiivinen Mendel käytti kokeissaan kukanväriltään valkoisia ja violetteja kukkia, jotka olivat ns. puhdaslinjaisia. Hän risteytti valkoisen ja violetin kukan ja havaitsi, että kaikki jälkeläiset (F1-polvi) olivat violettikukkaisia. Kun hän ristetty F1-polven yksilöitä keskenään, olivat jälkeläisitä ¾ violettikukkaisia ja ¼ valkokukkaisia. > samasta geenistä on olemassa useita eri muotoja eri alleeleja > violettikukkaisuutta periytyvä alleeli dominoi valkokukkaisuuden geeniä >eriperintäiset eli heterotsygootit yksilöt ilmentävät dominoivaa alleelia >väistyvää eli resessiivistä ominaisuutta ilmentääkseen yksilön oltava homotsygootti eli samanperintäinen tämän alleelin suhteen

16 Tehtävä 1 Marsuilla musta turkinväri (V) on dominoiva ominaisuus ja valkoinen (v) on resessiivinen. Risteytetään musta homotsygootti koirasmarsu ja valkoinen naarasmarsu. Merkitse a) P-polven genotyypit ja sukusolut. b) F1-polven jälkeläisten geno- ja fenotyypit

17 Tehtävä 2 Minkälaisia lapsia korvan nipukallisuuden suhteen saavat vanhemmat, joilla isällä on nipukalliset korvat (homotsygootti AA) ja äiti, jolla on nipukattomat korvat (aa)? Tee risteytys ja esitä sekä geno- että fenotyypit.

18 Monohybridiristeytys Yhden geenin periytyminen Homotsygoottisen yksilön AA sukusolut ovat tyyppiä A (ja aa a). Heterotsygoottisen yksilön Aa sukusolut ovat joko tyyppiä A tai a. Sukusolut yhdistyvät vapaasti erilaisia yhdistelmiä Testi- eli takaisinristeytys

19 Mendelin 2. sääntö Erkanemissääntö Sukusolujen muodostuessa ominaisuuteen vaikuttavan alleeliparin alleelit erkanevat toisistaan, minkä seurauksena kuhunkin sukusoluun tulee vain toinen näistä alleeleista. Kun risteytetään kaksi F1-sukupolven heterotsygoottia yksilöä, saadaan fenotyypiltään kahdenlaisia jälkeläisiä lukusuhteessa 3:1. Genotyypiltään lukusuhde on 1:2:1 3 violettikukkaista: 1 valkoinen VV (1):Vv (2): vv (1)

20

21 Tehtävä 3 Risteytetään keskenään kaksi F1-polven heterotsygoottia mustaa (Vv) marsua. Merkitse: A) risteytettävien yksilöiden genotyypit ja sukusolut B) F2-polven jälkeläisten geno- ja fenotyypit

22 Testiristeytys Testiristeytyksellä voidaan selvittää onko dominoivaa ominaisuuttaa ilmentävä yksilö ominaisuuden suhteen homo- vai heterotsygootti. Testiristeytyksessä risteytetään tutkittava yksilö resessiivistä ominaisuutta ilmentävän yksilön kanssa. Esim. Marsuesimerkki: musta marsu, jonka genotyyppiä ei tiedetä risteytetään valkoisen marsun kanssa. Isä: V? Äiti: vv Jos poikaset ovat mustia ja valkoisia suhteessa 1:1, on isämarsu heterotsygootti ominaisuuden suhteen, jos kaikki poikaset ovat mustia, isä on homotsygootti. Vv x vv > Vv, Vv, vv, vv > puolet valkoisia, puolet mustia VV x vv > Vv, Vv, Vv, Vv > kaikki mustia

23 Tehtävä 4: testiristeytys Tehtävän 2 pojista (Aa) yksi menee naimisiin naisen kanssa, jolla on nipukattomat korvat (aa). Minkälaisia lapsia korvannipukan suhteen pariskunta saa?

24 Samasta geenistä voi olla monta eri muotoa Vaikka yhdellä yksilöllä (2n) voi olla yhdestä geenistä vain kaksi muotoa, voi koko populaatiossa olla useita eri muotoja > multippelit alleelit Uudet alleelit muodostuvat mutaatioiden kautta ja vaikutus fenotyyppiin vaihtelee. Esim. gerbiilin turkin väri: villimuoto on agouti eli kellanruskea (C), c b tuottaa burma-värin (tummat korva ja häntä) ja c h tuottaa himalaja-värin (väriä vain hännässä). C> c b > c h

25

26 Välimuotoinen periytyminen Mendelin työtä jatkaneet perinnöllisyystieteilijä huomasivat, että aina geenit eivät ole resessiivisiä tai dominoivia, vaan tuottavat ominaisuuksiltaan välimuotoisia yksilöitä. Esim. leijonankita; kun ristetyttään punainen ja valkoinen kukka, jälkeläiset ovat välimuotoisia eli vaaleanpunaisia. F2-polvessa yksilöitä on suhteessa 1:2.1. Esim. hevonen; punarautias (V p V p ) x tuplavoikko (cremello, V k V k ) > voikko (V k V p )

27

28

29 Välimuotoinen periytyminen Intermediaarinen periytyminen: ominaisuusparin alleelit ilmentyvät yhdessä yhtä voimakkaina. Heterotsygootin kumpikin alleeli ilmenee yksilössä alleelien välimuoto

30 Tehtävä 5: rautias ja voikko Rautias tamma (V P V P ) astutetaan tuplavoikolla (V K V K ) orilla. Kirjoita varsojen geno- ja fenotyypit.

31 Yhteisvallitseva periytyminen Tasavahvat alleelit ilmenevät kumpikin erillisinä heterotsygootissa Heterotsygootilla on kaksi dominoivaa alleelia, jotka kumpikin tuottavat omaa geenituotettaan yksilöön

32 Yhteisvallitseva periytyminen Ihmisen ABO-veriryhmä perityy yhteisvallitsevasti I A (A-veriryhmä) ja I B (B-veriryhmä) ovat dominoivia ja ii resessiivinen (O-veriryhmä). Jos yksilöllä on sekä. I A ja I B alleelit, on hänen veriryhmänsä AB. https://www.youtube.com/watch?v=hpgo5k0lmwq

33

34

35 Letaalialleelit Voivat samaperintäisinä aiheuttaa yksilölle niin vakavia häiriöitä, että se menehtyy jo sikiönä. Elävät yksilöt ovat aina heterotsygootteja letaalialleelin suhteen.

36 Jotkin alleelit ovat kaksinkertaisina tappavia Letaalialleelit ovat luonnossa melko yleisiä. Kasveilla lehtivihreättömiä laikkuja aiheuttava geeni on samaperintäisenä letaali, koska jälkeläiset eivät voi yhteyttää. Ihmisellä sirppisoluanemia samaperintäisenä aiheuttaa sirppisoluanemian, joka voi johtaa kuolemaan; eriperintäisenä se antaa suojan malariaa vastaan > geeni pysyy perimässä. https://www.youtube.com/watch?v=q0gbqdigrf4

37

38

39 YHDEN ALLEELIPARIN PERIYTYMISTAVAT Dominoiva ja resessiivinen periytyminen Välimuotoinen periytyminen Yhteisvallitseva periytyminen Letaalinen periytyminen

40

41 Tehtävät 1. Kielen saaminen torvelle 2. Hiusrajan perinnöllisyys 3. Herneenpalkojen väri 4. Marsujen jälkeläiset 5. Kissojen väri 6. Ihmekukan väri 7. Vaaleankeltaiset samettikukat (YO-tehtävä S-01) 8. Perheen veriryhmät 9. Veriryhmän periytyminen 10. Hännättömät kissat (YO-tehtävä S-98) 11. Pikakertaus

42 1. Kielen saaminen torvelle Kielen saaminen torvelle on dominoiva ominaisuus (T). Millä todennäköisyydellä seuraaville pariskunnille syntyy lapsia, jotka osaavat laittaa kielensä torvelle? Kirjoita kullekin risteytykselle täydellinen risteytyskaavio. a) TT tt b) Tt Tt c) Tt tt d) tt TT

43 2. Hiusrajan perinnöllisyys Leenalla ja hänen isällään on kärjellinen hiusraja, kun Leenan äidillä ja puolisolla taas on suora hiusraja. Suora raja on resessiivinen ominaisuus. Minkä muotoisia Leenan ja hänen miehensä lasten hiusrajat voivat olla?

44 3. Herneenpalkojen väri Herneenpalot voivat olla vihreitä (dominoiva ominaisuus) tai keltaisia (resessiivinen ominaisuus). Minkä värisiä palkoja voidaan saada ja missä lukusuhteissa, kun vihreä ja keltapalkoinen herne lisääntyvät keskenään?

45 4. Marsujen jälkeläiset Kahdelle mustalle marsulle syntyy vuosien mittaan 11 jälkeläistä, joista 6 on mustia ja 5 valkoisia. a) Kumpi väri on dominoiva ominaisuus? Perustele. b) Päättele, mitkä ovat vanhempien genotyypit. Perustele risteytyskaavion avulla. c) Vastaavatko jälkeläisten lukusuhteet risteytyksestä odotettuja lukusuhteita?

46 5. Kissojen väri Musta väri on kissoilla dominoiva ominaisuus ruskean värin suhteen. Kasvattaja haluaa varmistaa, sopiiko hänen musta kollinsa tuottamaan pelkkiä mustia jälkeläisiä. Miten hän voi selvittää asian risteytyksen avulla?

47 6. Ihmekukan väri Ihmekukan väri periytyy välimuotoisesti. Väristä on olemassa kaksi alleelia, punaisen värin Vp ja valkoisen värin Vv. Minkä värisiä jälkeläisiä ja missä lukusuhteissa syntyy seuraavista risteytyksistä: a) kaksi vaaleanpunaista b) punainen ja vaaleanpunainen?

48 7. Vaaleankeltaiset samettikukat (YO-tehtävä S-01) Kasvinjalostaja tuotti samettikukasta (Tagetes patula, yksivuotinen koristekasvi) uuden lajikkeen, jonka kukat olivat vaaleankeltaisia. Vanhemmista toinen oli homotsygoottinen valkokukkainen (AVAV) ja toinen homotsygoottinen voimakkaan keltakukkainen (AKAK) lajike. AV ja AK ovat saman geenin alleeleja. Uutta lajiketta mainostettiin erinomaisena F1-hybridinä. a) Selitä risteytyskaavion avulla, kuinka lajike tuotettiin. b) Mitä hankaluuksia aiheutuu puutarhurille, joka haluaa itse tuottaa tämän lajikkeen siemeniä seuraavaa kasvukautta varten? c) Kuinka puutarhuri voisi itse tuottaa uusia taimia, joissa kaikissa on vaaleankeltaiset kukat?

49 8. Perheen veriryhmät Perheen molemmat vanhemmat ovat veriryhmältään AB. a) Mihin veriryhmiin heidän lapsensa voivat kuulua ja millä todennäköisyydellä? b) Jos ensimmäinen lapsi on veriryhmältään A, millä todennäköisyydellä seuraavakin lapsi kuuluu samaan veriryhmään?

50 9. Veriryhmän periytyminen Yhdistä vanhemmat ja lapset veriryhmien avulla. Perustele vastauksesi päättelemällä jokaisen yksilön genotyyppi. vanhemmat: lapset: a) AB ja B 1) A, O ja A b) O ja A 2) O, AB, A c) A ja B 3) A ja B

51 10. Hännättömät kissat (YO-tehtävä S-98) Laadi seuraavasta risteytyksestä kaavio ja perustele tulokset. Kissan hännällisyyden tai hännättömyyden määrää autosomaalinen alleelipari. Kahden hännättömän kissan pennuista on hännällisiä ja hännättömiä keskimäärin suhteessa 1:2.

52 11. Pikakertaus (1-4) 1. Yksilö on eriperintäinen geenin suhteen. Mikä seuraavista voi olla yksilön perimä? a. AB b. AA c. Aa d. aa 2. Yksilön genotyyppi on Aa. Minkälaisia sukusoluja se tuottaa? a. A b. a c. A ja a 3. Vanhempien genotyypit ovat Aa ja Aa. Mikä tai mitkä väitteet pitävät paikkansa jälkeläistön suhteen? a. Fenotyyppien lukusuhteet ovat 3:1. b. Genotyyppejä on kaksi, AA ja Aa. c. Kaikki ovat genotyypiltään samanlaisia kuin vanhempansa. d. Osa on fenotyypiltään erilaisia kuin vanhempansa.

53 11. Pikakertaus (1-4) 4. Jälkeläisten perimät ovat Aa, aa, aa ja aa. Mitkä voivat olla vanhempien genotyypit? a. AA ja aa b. Aa ja Aa c. Aa ja aa d. aa ja aa

Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi

Lisätiedot

Symbioosi 2 TEHTÄVÄT

Symbioosi 2 TEHTÄVÄT Luku 13 Symbioosi 2 TEHTÄVÄT 1. Yhdistä kaavioon oikealle paikalle a. P-polvi b. F 1 -polvi c. F 2 -polvi d. sukusolut e. genotyyppi 2. Miten seuraavat käsitteet eroavat toisistaan? a. Fenotyyppi ja genotyyppi

Lisätiedot

SÄTEILYN GENEETTISET VAIKUTUKSET

SÄTEILYN GENEETTISET VAIKUTUKSET 8 SÄTEILYN GENEETTISET VAIKUTUKSET Sisko Salomaa SISÄLLYSLUETTELO 8.1 Ihmisen perinnölliset sairaudet... 122 8.2 Perinnöllisten sairauksien taustailmaantuvuus... 125 8.3 Perinnöllisen riskin arviointi...

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

Kanarialinnun perintötekijät Spalt = Saksankielinen sana ja tarkoittaa perityvä mutta ei näkyvä ominaisuus

Kanarialinnun perintötekijät Spalt = Saksankielinen sana ja tarkoittaa perityvä mutta ei näkyvä ominaisuus Kanarialinnun perintötekijät Spalt = Saksankielinen sana ja tarkoittaa perityvä mutta ei näkyvä ominaisuus Koodit eli kansain väliset tunnukset muuttuvat koko ajan, mutta ovat euroopassa laajasti käytössä,

Lisätiedot

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 12 X-kromosominen periytyminen TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 FOLKHÄLSANS GENETISKA KLINIK PB 211, (Topeliusgatan 20) 00251 Helsingfors tel (09)

Lisätiedot

Geneettinen umpikuja: Mitä saat, EI ole välttämättä mitä näet kuusiosaisen artikkelisarjan 2. osa

Geneettinen umpikuja: Mitä saat, EI ole välttämättä mitä näet kuusiosaisen artikkelisarjan 2. osa Geneettinen umpikuja: Mitä saat, EI ole välttämättä mitä näet kuusiosaisen artikkelisarjan 2. osa Susan Thorpe-Vargas, Caroline Coile, John Cargill Käännös Inkeri Kangasvuo Oletko koskaan ihmetellyt sitä

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Geenitesteistä apua koiranjalostukseen kaikkia ongelmia ne eivät kuitenkaan ratkaise

Geenitesteistä apua koiranjalostukseen kaikkia ongelmia ne eivät kuitenkaan ratkaise Geenitesteistä apua koiranjalostukseen kaikkia ongelmia ne eivät kuitenkaan ratkaise Katariina Mäki 1.3.2007 Koirilla tunnetaan noin 450 periytyvää tai osittain periytyvää sairautta. Lisää sairauksia löydetään

Lisätiedot

I MENDEL JA MENDELISMI

I MENDEL JA MENDELISMI Veikko Sorsa: PERINNÖLLISYYSTIETEEN HISTORIAA 1 I MENDEL JA MENDELISMI A Käsityksiä perinnöllisyydestä ennen Mendelin kokeita -Valinnan käyttö vuosituhansien ajan hyötyeläinten ja -kasvien kasvatuksessa

Lisätiedot

Oppitunti 4 Värit 2. vaaleanvihreä - Tämä on vaaleanvihreä väri. vaaleanvihreä sammakko - Tämä sammakko on vaaleanvihreä.

Oppitunti 4 Värit 2. vaaleanvihreä - Tämä on vaaleanvihreä väri. vaaleanvihreä sammakko - Tämä sammakko on vaaleanvihreä. Oppitunti 4 Värit 2 musta - Tämä on musta väri. musta salkku - Tämä salkku on musta. musta sähköpistoke - Tämä sähköpistoke on musta. musta kissa - Tämä kissa on musta. Käännä omalle kielellesi. 1 vaaleanvihreä

Lisätiedot

Evoluutiopuu. Aluksi. Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot. Luokkataso: 6.-9. luokka, lukio

Evoluutiopuu. Aluksi. Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot. Luokkataso: 6.-9. luokka, lukio Evoluutiopuu Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot Luokkataso: 6.-9. luokka, lukio Välineet: loogiset palat, paperia, kyniä Kuvaus: Tehtävässä tutkitaan bakteerien evoluutiota.

Lisätiedot

Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta

Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Genetiikan tutkijat Englannin Kennel Clubin ja AHT:n kanssa yhteistyössä ovat laatineet seuraavanlaisen artikkelin Episodic Fallingista

Lisätiedot

Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa

Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Geneettinen umpikuja: Koira uhanalaisena lajina kuusiosaisen artikkelisarjan 1. osa Susan Thorpe-Vargas Ph.D., John Cargill MA, MBA, MS, D. Caroline Coile, Ph.D. Käännös Inkeri Kangasvuo Koskaan ei ehkä

Lisätiedot

Aleksi Jokinen, Timo Viljanen & Lassi 81: 1 &82: 4 Ti 3.3.

Aleksi Jokinen, Timo Viljanen & Lassi 81: 1 &82: 4 Ti 3.3. Biologian kurssi 4: Ihmisen biologia Laadi monisteen tehtäviä apuna käyttäen selkeä suullinen esitelmä ihmisen elimistä, niiden rakenteista, toiminnan säätelystä ja yleisimmistä toimintahäiriöistä. Aihe:

Lisätiedot

Oppitunti 3 Värit 1 tumma ja vaalea

Oppitunti 3 Värit 1 tumma ja vaalea Oppitunti 3 Värit 1 tumma ja vaalea 1 valkoinen - Tämä on valkoinen väri. valkoinen luistin - Tämä luistin on valkoinen. valkoinen luuranko - Tämä luuranko on valkoinen. valkoinen kukko - Tämä kukko on

Lisätiedot

DESIGN MARIAN TUOTE- KUVASTO

DESIGN MARIAN TUOTE- KUVASTO DESIGN MARIAN TUOTE- KUVASTO Muut tuotteet MUUT TUOTTEET Tämä katalogi pitää sisällään kaikkea mahdollista kodin koriste-esineistä asusteisiin. Järjestyksessään tästä luettelosta löydät - Käsin maalatuttuja

Lisätiedot

GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus

GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus GENOMINEN VALINTA HEVOSJALOSTUKSESSA Markku Saastamoinen MTT Hevostutkimus Genominen valinta genomisessa valinnassa eläimen jalostusarvo selvitetään DNA:n sisältämän perintöaineksen tiedon avulla Genomi

Lisätiedot

Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen

Lisätiedot

monta vanupuikkoa vetoketju kaksi vetoketjua kolme vetoketjua Sanasto paristo kaukosäädin lokki savuke tupakka pyykkipoika pingviini vanupuikko

monta vanupuikkoa vetoketju kaksi vetoketjua kolme vetoketjua Sanasto paristo kaukosäädin lokki savuke tupakka pyykkipoika pingviini vanupuikko Oppitunti 5 - numerot yhdestä kymmeneen, monta yksi, kaksi, kolme, neljä, viisi, kuusi, seitsemän, kahdeksan, yhdeksän, kymmenen monta vanupuikkoa vetoketju kaksi vetoketjua kolme vetoketjua 1 pilvi kaksi

Lisätiedot

Terveyteen liittyvät geenitestit

Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Jokaisella meistä on vanhemmiltamme perittynä oma yksilöllinen geenivalikoimamme. Tämä geneettinen rakenteemme yhdessä erilaisten ympäristön

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Vastustettu jalostuksella jo 25 vuotta - väheneekö lonkkavika?

Vastustettu jalostuksella jo 25 vuotta - väheneekö lonkkavika? 1 / 8 Vastustettu jalostuksella jo 25 vuotta - väheneekö lonkkavika? Katariina Mäki Ensimmäinen koirien lonkkanivelen kasvuhäiriön, lonkkavian, vähentämiseksi tarkoitettu vastustamisohjelma on ollut Suomessa

Lisätiedot

4.1 Samirin uusi puhelin

4.1 Samirin uusi puhelin 4. kappale (neljäs kappale) VÄRI T JA VAATTEET 4.1 Samirin uusi puhelin Samir: Tänään on minun syntymäpäivä. Katso, minun lahja on uusi kännykkä. Se on sedän vanha. Mohamed: Se on hieno. Sinun valkoinen

Lisätiedot

Suuria eroja eri rotujen tehollisessa populaatiokoossa

Suuria eroja eri rotujen tehollisessa populaatiokoossa 1 / 7 Suuria eroja eri rotujen tehollisessa populaatiokoossa Elina Paakala Koirarotujen perinnöllinen monimuotoisuus on ajankohtainen puheenaihe. Koiramme-lehdessä on aiheesta juttuja jokseenkin joka numerossa.

Lisätiedot

Y L E I S E N L U V A N O R I L I S E N S S I H A K E M U S 2 0 1 5

Y L E I S E N L U V A N O R I L I S E N S S I H A K E M U S 2 0 1 5 Y L E I S E N L U V A N O R I L I S E N S S I H A K E M U S 2 0 1 5 SUOMEN HIPPOS RY 2015 Lisenssihakemus oriille, jolla on voimassa oleva jalostukseenkäyttöoikeus jalostusluokassa I. Valitse alta hakemustyyppi:

Lisätiedot

Lääketieteellisten tiedekuntien pääsykokeen vastausanalyysi 2015. Biologia Petri Ojala, FM Lahden lyseo

Lääketieteellisten tiedekuntien pääsykokeen vastausanalyysi 2015. Biologia Petri Ojala, FM Lahden lyseo Lääketieteellisten tiedekuntien pääsykokeen vastausanalyysi 2015 Biologia Petri Ojala, FM Lahden lyseo Tehtävä 1. a) Elektronimikroskooppikuva soluelimistä - Kuvassa on mitokondrio 1. Rakenteessa 1. tapahtuu

Lisätiedot

PIIRUSTUS JA SUUNNITTELUKOE ARKKITEHTUURIN JA MAISEMA ARKKITEHTUURIN HAKUKOHTEET MAANANTAI 3.6.2013

PIIRUSTUS JA SUUNNITTELUKOE ARKKITEHTUURIN JA MAISEMA ARKKITEHTUURIN HAKUKOHTEET MAANANTAI 3.6.2013 PIIRUSTUS JA SUUNNITTELUKOE ARKKITEHTUURIN JA MAISEMA ARKKITEHTUURIN HAKUKOHTEET MAANANTAI 3.6.2013 1 TULEVAISUUDEN TONNIN SETELI Suunni ele neliön muotoinen 1000 euron seteli. Kuva-aiheena voit käy ää

Lisätiedot

Luento 13: Geneettiset Algoritmit

Luento 13: Geneettiset Algoritmit Luento 13: Geneettiset Algoritmit Geneettiset algoritmit ovat luonnon evoluutiomekanismeja imitoivia heuristisia optimointimenetelmiä. Ne soveltuvat tehtäviin, joissa ratkaisuavaruus on hyvin suuri (esim.

Lisätiedot

LASTEN JA NUORTEN AIVOJEN YLEINEN HYVINVOINTI. Tiina Walldén 13.11.1009

LASTEN JA NUORTEN AIVOJEN YLEINEN HYVINVOINTI. Tiina Walldén 13.11.1009 LASTEN JA NUORTEN AIVOJEN YLEINEN HYVINVOINTI Tiina Walldén 13.11.1009 1 LÄHTÖKOHTA paljon oppimisvaikeus/ tarkkaavaisuus/ päänsärky / käyttäytymisen säätely / kontaktiongelmaisia lapsia miten ympäristö

Lisätiedot

,.'.n:r:r: :r,.,:.**ry!'..:*4':{i

,.'.n:r:r: :r,.,:.**ry!'..:*4':{i ,.'.n:r:r: :r,.,:.**ry!'..:*4':{i Geenelhln kirjoltettu? Perimä. Geenien vai kutus sai rastu misriski i n on paljon moni mutkaisempi kuin usein ajatellaan. Terveys on ehkä alustavasti kirjoitettu geeneihin,

Lisätiedot

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa

Lisätiedot

PYYHEKUTSUT Pyyheliinat jokaiseen kotiin Tuotekuvasto talvi 2015

PYYHEKUTSUT Pyyheliinat jokaiseen kotiin Tuotekuvasto talvi 2015 PYYHEKUTSUT Pyyheliinat jokaiseen kotiin Tuotekuvasto talvi 2015 Sinistä unelmaa, puuteri vaaleansininen Pilvi ja Denimin sininen Pioni. 1. 1. vaaleansininen Pilvi 2. valkoinen Pumpuli Sileä neulos 500g/m²

Lisätiedot

Lemmikkilinnut. Kaijuli ry 1

Lemmikkilinnut. Kaijuli ry 1 KAIJUTIN 2013 Lemmikkilinnut Kaijuli ry 1 Kaijutin 2013 Päätoimittaja & taitto: Jarmo Tuutti Kielentarkistus: Hanna Miettinen Kaijutin-logo: Essi Laavainen Nuorisotiimin logo: Ida-Emilia Kaukonen Paino:

Lisätiedot

2.1 Tunnus. TUNNUKSEN KÄYTÖN RAJOITUKSET Käytä kuhunkin käyttötarpeeseen suunniteltuja originaaleja logoversioita www-sivujen logopankista

2.1 Tunnus. TUNNUKSEN KÄYTÖN RAJOITUKSET Käytä kuhunkin käyttötarpeeseen suunniteltuja originaaleja logoversioita www-sivujen logopankista 2.1 Tunnus LAHDEN AMMATTIKORKEAKOULU GRAAFINEN OHJEISTO 7 Lahden ammattikorkeakoulun merkki perustuu vahvaan, tunnistettavaan kirjainmuotoiluun, joka on linjassa ilmeessä käytettävän muun typografian kanssa.

Lisätiedot

13/05/14. Emolehmien kestävyysominaisuudet. Tässä esityksessä. Mistä kestävyys? Emolehmäseminaari 2014 Ikaalinen 04.02.

13/05/14. Emolehmien kestävyysominaisuudet. Tässä esityksessä. Mistä kestävyys? Emolehmäseminaari 2014 Ikaalinen 04.02. Emolehmien kestävyysominaisuudet Emolehmäseminaari 2014 Ikaalinen 04.02.2014 Maiju Pesonen Tässä esityksessä Kestävyyden anatomia Kolme kotimaista aineistoa: ü Poiston syyt ü Poikimahelppous/ poikimavaikeus

Lisätiedot

Tulikivi tuo uudet tulisijat ja kiukaat Tampereen Asta-messuille

Tulikivi tuo uudet tulisijat ja kiukaat Tampereen Asta-messuille Tiedotusvälineille Tampereen Asta messut 8.-10.2.2013 Tulikiven osasto A 428 Tulikivi tuo uudet tulisijat ja kiukaat Tampereen Asta-messuille Tulikivi on mukana Tampereen Asta messuilla 8.-10.2.2013. Tulikiven

Lisätiedot

Pride in being different KRABAT AS telefon: Pilot fax: www.krabat.com

Pride in being different KRABAT AS telefon: Pilot fax: www.krabat.com Pilot Krabat Pilot C KONTTAUS Krabat Pilot Palkinnot Krabat Pilot on innovatiivinen ja erilaista tyyppiä edustava konttaustuki. Perinteiset konttaustuet eivät tarjoa riittävästi dynaamista tukea lantion

Lisätiedot

Uusia koristepuulajikkeita kuusesta joko niitä saa lisäykseen?

Uusia koristepuulajikkeita kuusesta joko niitä saa lisäykseen? Uusia koristepuulajikkeita kuusesta joko niitä saa lisäykseen? Teijo Nikkanen Kasvullinen lisäys kohti tulevaisuuden taimituotantoa Seminaari Lustossa klo 12-16 Kestäviä, kotimaisia koristepuita viherrakentamiseen

Lisätiedot

A `St. Michel (Mikkeli) `Haaga`

A `St. Michel (Mikkeli)  `Haaga` A `St. Michel (Mikkeli) Kukka on nuppuasteella vaaleanpunainen, auetessaan lähes valkoinen, vaaleanvihreä pilkkuinen. Lajike on kotimaisista alppiruusuista talvenkestävin ja se kukkii kotimaista alppiruusuista

Lisätiedot

VÄRITÄ ITSESI HYVINVOIVAKSI

VÄRITÄ ITSESI HYVINVOIVAKSI VÄRITÄ ITSESI HYVINVOIVAKSI VÄRITÄ ITSESI HYVINVOIVAKSI ESITTELYN YLEISKATSAUS Carl Rehnborg ja NUTRIWAYn tarina Tasapainoisen ruokavalion haasteet Lisää väriä ruokavalioosi Tasapainoinen ruokavalio. Tasapainoinen

Lisätiedot

Hampaiden kovakudoksen perinnöllinen sairaus bordercollieilla

Hampaiden kovakudoksen perinnöllinen sairaus bordercollieilla Helsingin yliopisto Eläinlääketieteellinen tiedekunta Katri Kinnunen Hampaiden kovakudoksen perinnöllinen sairaus bordercollieilla Eläinlääketieteen lisensiaatin tutkielma 11.2.2015 Työn ohjaajat: Pekka

Lisätiedot

Biologian harjoitustehtäviä kurssit1 5 ilari niemi

Biologian harjoitustehtäviä kurssit1 5 ilari niemi B iolgai o Biologian harjoitustehtäviä kurssit1 5 ilari niemi 1 Turun kristillisen opiston oppimateriaaleja Biologia ja integroivat tehtävät: Ilari Niemi 2014. Taitto ja kuvitus: Ulriikka Lipasti, Turun

Lisätiedot

Ihmisten erilaisuuden geneettinen perusta

Ihmisten erilaisuuden geneettinen perusta hmisten erilaisuuden geneettinen perusta etter ortin hmisen genomin tutkimus on astunut uuteen vaiheeseen kun on alettu tutkia ihmisen geneettisen monimuotoisuuden määrää ja laatua. seita tätä tutkimushanketta

Lisätiedot

Klassisen ja geometrisen todennäköisyyden harjoituksia

Klassisen ja geometrisen todennäköisyyden harjoituksia MAB5: Todennäköisyyden lähtökohdat Harjoitustehtävät Klassisen ja geometrisen todennäköisyyden harjoituksia 3.1 Heität tavallista noppaa. Millä todennäköisyydellä a) saat kuutosen? b) saat ykkösen? c)

Lisätiedot

LUONTO SUOJAA SUKUSIITOKSELTA (NATURENS SKYDD AV ÄRFTLIG VARIATION)

LUONTO SUOJAA SUKUSIITOKSELTA (NATURENS SKYDD AV ÄRFTLIG VARIATION) LUONTO SUOJAA SUKUSIITOKSELTA (NATURENS SKYDD AV ÄRFTLIG VARIATION) Terveysjalostusohjelmat ja rotukohtaiset jalostusstrategiat ovat viime vuosina puhuttaneet paljon. Mihin näitä ohjelmia tarvitaan? Millaisia

Lisätiedot

Jackrussellinterrieri FCI numero 345 rotukohtainen jalostuksen tavoiteohjelma 2013-2017

Jackrussellinterrieri FCI numero 345 rotukohtainen jalostuksen tavoiteohjelma 2013-2017 Jackrussellinterrieri FCI numero 345 rotukohtainen jalostuksen tavoiteohjelma 2013-2017 Hyväksytty rotua harrastavan yhdistyksen yleiskokouksessa 17.9.2011 Hyväksytty rotujärjestön yleiskokouksessa 26.4.2012

Lisätiedot

FAMILYTREEPAINTER. FamilyTreePainter Käyttöohje

FAMILYTREEPAINTER. FamilyTreePainter Käyttöohje FAMILYTREEPAINTER FamilyTreePainter Käyttöohje i F A M I L Y T R E E P A I N T E R FamilyTreePainter Käyttöohje Copyright 2006-2013 Timo Vaara Email: timo@vaara.org ii Table of contents 1 YLESIATÄ... 1

Lisätiedot

Kasvatus- ja rekisteröintisäännöt FIFe / SK 01.10.2015

Kasvatus- ja rekisteröintisäännöt FIFe / SK 01.10.2015 Kasvatus- ja rekisteröintisäännöt FIFe / SK 01.10.2015 FIFe Breeding & Registration Rules 01.10.2015 (käännös) ja Suomen Kissaliitto ry:n kansalliset säännöt 28.03.2015 (13.3, 14.3, liitteet SK 1, 2 ja

Lisätiedot

4023 Korkeus: 150 cm Leveys: 40 cm Teho: 1 x E27 max60w

4023 Korkeus: 150 cm Leveys: 40 cm Teho: 1 x E27 max60w 4020 teho: 1 x E27 max60w 4023 Korkeus: 150 cm 4022 4018 4025 Leveys: 24,5 cm 4030 Leveys: 32 cm 4028 Leveys: 32 cm 4031 Leveys: 22,5 cm 4027 Leveys: 22,5 cm 4026 Leveys: 32 cm 4016 Leveys: 36 cm 4015

Lisätiedot

Maatilalla. Opettajan ohjeet: Kysymyksiä tokaluokkalaisille: Bingo:

Maatilalla. Opettajan ohjeet: Kysymyksiä tokaluokkalaisille: Bingo: Maatilalla Opettajan ohjeet: Yhteystiedot: Tilastokeskus tilastokoulu@tilastokeskus.fi Luokka-aste: 1. 2. lk. Oppiaine: matematiikka Tarvikkeet: lyijykynä, värikynät, tehtäväpaperit monistettuna. Oppitunnin

Lisätiedot

Seulontavaihtoehdot ja riskit

Seulontavaihtoehdot ja riskit Seulontavaihtoehdot ja riskit Hannele Laivuori HUSLAB Perinnöllisyyslääketieteen yksikkö Jaakko Ignatius TYKS, Perinnöllisyyslääketiede Finohta / Sikiöseulontojen yhtenäistäminen / Hannele Laivuori ja

Lisätiedot

Ylioppilastutkintolautakunta S t u d e n t e x a m e n s n ä m n d e n

Ylioppilastutkintolautakunta S t u d e n t e x a m e n s n ä m n d e n Ylioppilastutkintolautakunta S t u d e n t e x a m e n s n ä m n d e n BIOLOGIAN KOE 21.3.2014 HYVÄN VASTAUKSEN PIIRTEITÄ Alla oleva vastausten piirteiden ja sisältöjen luonnehdinta ei sido ylioppilastutkintolautakunnan

Lisätiedot

Värisauvojen käyttö matematiikan opetuksessa

Värisauvojen käyttö matematiikan opetuksessa Sándor Pálfy: Värisauvojen käyttö matematiikan opetuksessa A színesrúd-készlet felhasználása a matematikatanításban; Továbbképzési anyag matematikából 1. A munkaeszközökr l Szerk.: C. Neményi Eszter, Radnainé

Lisätiedot

SUOMALAISEN RATSUPONIN JALOSTUSOHJESÄÄNTÖ

SUOMALAISEN RATSUPONIN JALOSTUSOHJESÄÄNTÖ Suomen Hippos ry Evira vahvistanut 11.08.2015 SUOMALAISEN RATSUPONIN JALOSTUSOHJESÄÄNTÖ 1. Suomalainen ratsuponi (SRP) Suomalainen ratsuponi on SRP kantakirjaan ensirekisteröity ratsuponi, joka polveutuu

Lisätiedot

Odpowiedzi do ćwiczeń

Odpowiedzi do ćwiczeń Odpowiedzi do ćwiczeń Lekcja 1 1. c 2. b 3. d 4. a 5. c Lekcja 2 1. ruotsia 2. Norja 3. tanskalainen 4. venäjää 5. virolainen 6. englantia 7. Saksa 8. kiina 9. espanjaa 10. Suomi 11. puolalainen 12. englanti

Lisätiedot

Potilasopas. 2 PL 24, 90029 OYS puh (08) 315 3218 faksi (08) 315 3105

Potilasopas. 2 PL 24, 90029 OYS puh (08) 315 3218 faksi (08) 315 3105 2 PL 24, 90029 OYS puh (08) 315 3218 faksi (08) 315 3105 Perinnöllisten Syöpien Ennakoivat Geenitutkimukset TAYS Kliinisen genetiikan yksikkö PL 2000, 33521 Tampere Perinnöllisyyspoliklinikka puh (03)

Lisätiedot

The acquisition of science competencies using ICT real time experiments COMBLAB. Kasvihuoneongelma. Valon ja aineen vuorovaikutus. Liian tavallinen!

The acquisition of science competencies using ICT real time experiments COMBLAB. Kasvihuoneongelma. Valon ja aineen vuorovaikutus. Liian tavallinen! Kasvihuoneongelma Valon ja aineen vuorovaikutus Herra Brown päätti rakentaa puutarhaansa uuden kasvihuoneen. Liian tavallinen! Hänen vaimonsa oli innostunut ideasta. Hän halusi uuden kasvihuoneen olevan

Lisätiedot

Ihmisen elämänkaari. Syntymä

Ihmisen elämänkaari. Syntymä Ihmisen elämänkaari Jokainen meistä on saanut alkunsa, kun miehen siittiö on hedelmöittänyt naisen munasolun. Siitä on saanut alkunsa uusi elämä, uusi elämän tarina. Vaikka jokaisella on oma tarinansa,

Lisätiedot

Tilauskalenterit 2008

Tilauskalenterit 2008 Tilauskalenterit 2008 Time/system tilauskalenterit Hyvin suunniteltuna ja toteutettuna saat kalenterista pitkäaikaisen viestintävälineen sidosryhmillesi (asiakkaat, henkilöstö ym). Saaja arvostaa korkealaatuista

Lisätiedot

PERHEINTERVENTIOIDEN SOVELTAMINEN LASTEN JA NUORTEN VASTAANOTOLLA

PERHEINTERVENTIOIDEN SOVELTAMINEN LASTEN JA NUORTEN VASTAANOTOLLA PERHEINTERVENTIOIDEN SOVELTAMINEN LASTEN JA NUORTEN VASTAANOTOLLA Mielenterveyskeskus Lasten ja nuorten vastaanotto 0-20 v. lasten ja nuorten tunne-el elämään, käyttäytymiseen ytymiseen ja kehitykseen

Lisätiedot

Tunnuksen käyttö 28.4. 2014

Tunnuksen käyttö 28.4. 2014 Tunnuksen käyttö 28.4. 2014 Sisältö Saatteeksi Tässä ohjeistossa määritellään Lähienergiatunnuksen käyttöä, linjataan ehdot sen käyttöoikeudelle ja kerrotaan valvonnasta. Ohjeiston tarkoituksena on selkeyttää

Lisätiedot

Arkkulaite 1. Kuvan laite 225

Arkkulaite 1. Kuvan laite 225 Arkkulaite 1 Kuvan laite 225 Valkolilja 5 10 Valkoinen neilikka 10 20 Sininen iiris 10 20 Vaalean lila freesia 10 10 Valkoinen tulppaani 10 10 TAI valkoinen eustoma 5 5 155 225 Arkkulaite 2 Kuvan laite

Lisätiedot

Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa

Lisätiedot

Ylioppilastutkintolautakunta S tudentexamensnämnden

Ylioppilastutkintolautakunta S tudentexamensnämnden Ylioppilastutkintolautakunta S tudenteamensnämnden BIOLOGIAN KOE 13.3.2013 HYVÄN VASTAUKSEN PIIRTEITÄ Alla oleva vastausten piirteiden ja sisältöjen luonnehdinta ei sido ylioppilastutkintolautakunnan arvostelua.

Lisätiedot

Sisällysluettelo. 1 Johdanto 3

Sisällysluettelo. 1 Johdanto 3 GRAAFINEN OHJEISTO Sisällysluettelo 1 Johdanto 3 2 Logon/liikemerkin rakenne 3 2.1 Logon/liikemerkin rakenne 4 markkinointiviestinnässä 2.2 Suoja-alue 4 2.3 Värit ja esitystavat 5 2.4 Värit markkinointiviestinnässä

Lisätiedot

sanat nimet kätensä toimia toistaa ymmärtänyt

sanat nimet kätensä toimia toistaa ymmärtänyt AISTIVÄLINEET Aistivaikutelmat, joita lapsi saa, ja joita hän on jo koko olemassaolonsa aikana varastoinut, eivät pelkästään riitä, kun lapsi on rakentamassa älyään. Ne ovat tiedostamattomia, eikä lapsi

Lisätiedot

GRAAFINEN OHJEISTUS OSA 1

GRAAFINEN OHJEISTUS OSA 1 GRAAFINEN OHJEISTUS OSA 1 Kaikki asiakkaidemme tarpeet liittyvät oman näkemyksen välittämiseen toiselle ihmiselle. Vain siitä on kyse, ja vain se on tärkeää. Olipa näkemys tarkoitettu sähköasentajalle,

Lisätiedot

Klassisen ja geometrisen todennäköisyyden harjoituksia

Klassisen ja geometrisen todennäköisyyden harjoituksia MAB5: Todennäköisyyden lähtökohdat Klassisen ja geometrisen todennäköisyyden harjoituksia 3.1 Heität tavallista noppaa. Millä todennäköisyydellä a) saat kuutosen? b) saat ykkösen? c) saat parittoman pisteluvun?

Lisätiedot

YRITTÄJÄN. paketointitarvikkeet

YRITTÄJÄN. paketointitarvikkeet YRITTÄJÄN paketointitarvikkeet 2015 LAHJANARUT 01 valkoinen 02 keltainen 05 v.punainen 06 v.sininen 07 punainen 08 sininen 09 petrooli 10 ruohonvihreä 11 vaaleanvihreä 12 oranssi 13 aniliini 14 ruskea

Lisätiedot

Aleksanterinkadun Appro. Tunnusohjeisto 25.2.2015

Aleksanterinkadun Appro. Tunnusohjeisto 25.2.2015 Tunnusohjeisto 25.2.2015 sisällys tunnus 3 1 tunnus tekstillä 4 2 tekstitön tunnus 5 tunnuksen väriversiot 6 tunnus kuvan päällä 7 tunnus 1 n tunnus eli visuaalinen tunniste viittaa muotokieleltään Lahden

Lisätiedot

Ureakierron häiriöt ja rgaanishappovirtsaisuudet Lapsille

Ureakierron häiriöt ja rgaanishappovirtsaisuudet Lapsille Ureakierron häiriöt ja rgaanishappovirtsaisuudet Lapsille www.e-imd.org Mikä on ureakierron häiriö/orgaanishappovirtsaisuus? Kehomme hajottaa syömämme ruoan tuhansien kemiallisten reaktioiden avulla ja

Lisätiedot

KESÄKALUSTE- KUVASTO 2015 KOTI-SIILISTÄ SUURIN KESÄKALUSTEVALIKOIMA

KESÄKALUSTE- KUVASTO 2015 KOTI-SIILISTÄ SUURIN KESÄKALUSTEVALIKOIMA KESÄKALUSTE- KUVASTO 2015 KOTI-SIILISTÄ SUURIN KESÄKALUSTEVALIKOIMA ALE -30% VÄHINTÄÄN Ei koske kotimaisia keinuja SÄÄNKESTÄVÄ SICILIA sohvaryhmäsetti - Sohva Leveys 184 cm / Tuoli 75 cm / Pöytä 150x70

Lisätiedot

LET S GO! 4 KOEALUE 7-9 Nähnyt:

LET S GO! 4 KOEALUE 7-9 Nähnyt: 1 LET S GO! 4 KOEALUE 7-9 Nähnyt: On jälleen tullut aika testata osaamisesi. Koekappaleina ovat kappaleet 7-9. Muista LUKEA KAPPALEITA ÄÄNEEN useaan otteeseen ja opetella erityisen hyvin KUVASANASTOT ja

Lisätiedot

Piirrä kuvasi tauluun.

Piirrä kuvasi tauluun. Linus ja Ismenia haluaisivat tutustua sinuun. Piirrä kuvasi tauluun. Artikla 7. Jokaisella lapsella on oikeus nimeen ja kansalaisuuteen. Mikä on sinun nimesi ja kansalaisuutesi? On hauska tutustua uusiin

Lisätiedot

Marjojen lajikesuositukset Pohjois-Suomeen, Herukka

Marjojen lajikesuositukset Pohjois-Suomeen, Herukka Marjojen lajikesuositukset Pohjois-Suomeen, Herukka Tutkija Kati Hoppula Vanhempi tutkija Kalle Hoppula Maa- ja elintarviketalouden tutkimuskeskus, MTT Marjanviljelystä vahva elinkeino Pohjois- Suomeen

Lisätiedot

5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin

Lisätiedot

YLEISTÄ. Testamentin teko-ohjeet. Miksi on syytä tehdä testamentti?

YLEISTÄ. Testamentin teko-ohjeet. Miksi on syytä tehdä testamentti? Testamentin teko-ohjeet YLEISTÄ Miksi on syytä tehdä testamentti? Sukulaisten perintöoikeus on rajoitettu omiin jälkeläisiin, vanhempiin, sisaruksiin, sisarusten lapsiin, isovanhempiin ja heidän lapsiinsa

Lisätiedot

Väritystehtävä VESILINTUJA Kesä tulee muuttolinnun siivin

Väritystehtävä VESILINTUJA Kesä tulee muuttolinnun siivin Väritystehtävä VESILINTUJA Kesä tulee muuttolinnun siivin Suurin osa Lapin linnuista on muuttolintuja. Kaukaisimmat muuttolinnut viettävät talvensa tuhansien kilometrien päässä, Afrikassa tai Intiassa

Lisätiedot

Graafinen ohjeistus. Taustaa. Logon elementit. Mittasuhtet. Suoja-alue. Värimääritykset. Logon sijoittelu. Kirjasintyypit eli typografia

Graafinen ohjeistus. Taustaa. Logon elementit. Mittasuhtet. Suoja-alue. Värimääritykset. Logon sijoittelu. Kirjasintyypit eli typografia Graafinen ohjeistus Taustaa Logon elementit Mittasuhtet Suoja-alue Värimääritykset Logon sijoittelu Kirjasintyypit eli typografia Taustaa Nuorten Kotkien alkuperäinen logo on vaakunamalliseen kehyksen

Lisätiedot

Opetusmateriaalin visuaalinen suunnittelu. Kirsi Nousiainen 27.5.2005

Opetusmateriaalin visuaalinen suunnittelu. Kirsi Nousiainen 27.5.2005 Opetusmateriaalin visuaalinen suunnittelu Kirsi Nousiainen 27.5.2005 Visuaalinen suunnittelu Ei ole koristelua Visuaalinen ilme vaikuttaa vastaanottokykyyn rauhallista jaksaa katsoa pitempään ja keskittyä

Lisätiedot

Uuden sukupolven hella- & keittiötaso

Uuden sukupolven hella- & keittiötaso Juho Koivumäki & Arleena Kapanen Uuden sukupolven hella- & keittiötaso Metropolia Ammattikorkeakoulu Insinööri (AMK) Hybridimediatekniikka TV00AA49-3001 Harjoitusraportti 4.4.2014 Sisällys Lyhenteet 1

Lisätiedot

SMART Board harjoituksia 09 - Notebook 10 Notebookin perustyökalujen käyttäminen 2 Yritä tehdä tehtävät sivulta 1 ilman että katsot vastauksia.

SMART Board harjoituksia 09 - Notebook 10 Notebookin perustyökalujen käyttäminen 2 Yritä tehdä tehtävät sivulta 1 ilman että katsot vastauksia. SMART Board harjoituksia 09 - Notebookin perustyökalujen käyttäminen 2 Yritä tehdä tehtävät sivulta 1 ilman että katsot vastauksia. http://www.kouluon.fi/ Harjoitus 1-09: Taikakynä Avaa edellisessä harjoituksessa

Lisätiedot

Tallilehti Kavionkopse nro. 1

Tallilehti Kavionkopse nro. 1 Tallilehti Kavionkopse nro. 1 Sisällys: A osa Tallin säännöt. B osa Haluatko hoitajaksi? Kuvia tallin hevosista. C osa Hevosaiheisia tehtäviä ja kysymyksiä (hoitajille ja henkilökunnan jäsenille). D osa

Lisätiedot

Ennakoivat Geenitutkimukset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Ennakoivat Geenitutkimukset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com Ennakoivat Geenitutkimukset Tämän potilasoppaan on kehittänyt The Genetic Interest Group. Kääntänyt Tiina Lund-Aho. Toukokuussa 2009 Tätä työtä tuki EuroGentest, joka on Euroopan yhteisön tutkimuksen kuudennen

Lisätiedot

Tämä on Hallituksen esitys hyväksyttäväksi Jalostuksen tavoiteohjelmaksi.(jto) JTO käsitellään Vuosikokouksessa 21.3.2010.

Tämä on Hallituksen esitys hyväksyttäväksi Jalostuksen tavoiteohjelmaksi.(jto) JTO käsitellään Vuosikokouksessa 21.3.2010. Tämä on Hallituksen esitys hyväksyttäväksi Jalostuksen tavoiteohjelmaksi.(jto) JTO käsitellään Vuosikokouksessa 21.3.2010. Hallitus edellyttää kaikkien tutustuvan ja lukevan esityksen. Mikäli siitä löytää

Lisätiedot

Shiba ja hokkaido. Rotumääritelmävertailua

Shiba ja hokkaido. Rotumääritelmävertailua ja hokkaido Rotumääritelmävertailua Käyttötarkoitus Seurakoira Metsästys Linnut, pieneläimet Seurakoira Metsästys Yleisvaikutelma Pienikokoinen Tasapainoinen Hyväluustoinen Hyvät lihakset Voimakas Liikunta

Lisätiedot

Geenit ja ympäristötekijät koulutustason ja alkoholiongelmien taustalla

Geenit ja ympäristötekijät koulutustason ja alkoholiongelmien taustalla Geenit ja ympäristötekijät koulutustason ja alkoholiongelmien taustalla Antti Latvala Helsingin yliopisto, Kansanterveystieteen osasto THL, Mielenterveys ja päihdepalvelut osasto antti.latvala@helsinki.fi

Lisätiedot

Nukkuminen on kultaa.

Nukkuminen on kultaa. 26 Nukkuminen on kultaa. Tietysti on välillä ihanaa nousta aikaisin ja nauttia aamun hiljaisesta sarastuksesta, mutta yksi lomapäivien parhaista asioista on se, kun saa nukkua juuri niin pitkään kuin huvittaa.

Lisätiedot

FORSA SUIHKUT SUIHKU TOIVEITTESI MUKAISESTI

FORSA SUIHKUT SUIHKU TOIVEITTESI MUKAISESTI FORS SUIHKUT SUIHKU TOIVEITTESI MUKISESTI FORS ERITYISRTKISU 1 Nyt voit saada suihkuseinät täysin mittojen ja toiveittesi mukaisesti. Saatavilla on leveydet 20-100 cm, korkeudet 50-198 cm. Lasi voidaan

Lisätiedot

Suomen kromfohrländer ry. Kromfohrländerin rotukohtainen jalostuksen tavoiteohjelma 2014-2018

Suomen kromfohrländer ry. Kromfohrländerin rotukohtainen jalostuksen tavoiteohjelma 2014-2018 Suomen kromfohrländer ry Kromfohrländerin rotukohtainen jalostuksen tavoiteohjelma 2014-2018 SKL:n jalostustieteellinen toimikunta hyväksynyt 14.10.2014 Sisällysluettelo 1. YHTEENVETO...3 2. RODUN TAUSTA...4

Lisätiedot

Tulokset - Rodussa tunnetut perinnölliset sairaudet

Tulokset - Rodussa tunnetut perinnölliset sairaudet Rekisterinimi: Occhilupo Sandro Blu Sambuco Lempinimi: Blu Rekisterinro: FI43756/11 Mikrosirunro: 968000004399840 Rotu: Siperianhusky Sukupuoli: Uros Omistaja: Minna Räsänen Maa: Suomi Testaus suoritettu:

Lisätiedot

Onko meillä sohvaperunoilla tulevaisuutta? Risto Kuronen Koulutusylilääkäri Päijät-Hämeen Perusterveydenhuollon yksikkö

Onko meillä sohvaperunoilla tulevaisuutta? Risto Kuronen Koulutusylilääkäri Päijät-Hämeen Perusterveydenhuollon yksikkö Onko meillä sohvaperunoilla tulevaisuutta? Risto Kuronen Koulutusylilääkäri Päijät-Hämeen Perusterveydenhuollon yksikkö Näyttö liikunnan (istumisen vähentämisen?) hyödyllisyydestä sairauksien ehkäisyssä

Lisätiedot

Itsekkäät geenit sosiaalisissa yhteisöissä

Itsekkäät geenit sosiaalisissa yhteisöissä Itsekkäät geenit sosiaalisissa yhteisöissä Pekka Pamilo Uusi genomitutkimus tuottaa tietoa mekanismeista, jotka säätelevät hyönteisyhteiskuntien kehitystä. Tämä tieto on läheisesti kytköksissä sukulaisvalinnan

Lisätiedot

Tuulivoiman linnustovaikutukset ja vaikutusten vähentäminen. BirdLife Suomi ry

Tuulivoiman linnustovaikutukset ja vaikutusten vähentäminen. BirdLife Suomi ry Tuulivoiman linnustovaikutukset ja vaikutusten vähentäminen BirdLife Suomi ry Tuulivoimalat jauhavat linnut kuoliaiksi... Roottorit tekevät linnuista jauhelihaa... Ei lintusilppureita Siipyyhyn Ihmisen

Lisätiedot

Krokotiili & sen poikanen

Krokotiili & sen poikanen Virkkuuohjeet Krokotiili & sen poikanen Krokotiili ja sen poikanen Virkkausohjeissani käytetään pääosin kiinteitä silmukoita. Ohjenuorana japanilaistyyliseen amigurumien ja tawashien virkkaamiseen on,

Lisätiedot

Vastasyntyneen veriryhmämääritys ja sopivuuskoeongelmat

Vastasyntyneen veriryhmämääritys ja sopivuuskoeongelmat Vastasyntyneen veriryhmämääritys ja sopivuuskoeongelmat Laboratoriolääketiede ja näyttely 2014 Susanna Sainio,SPR Veripalvelu 1 1 1 2 2 2 Vastasyntyneen veriryhmämääritys ABO A ja B antigeenien määrä punasolujen

Lisätiedot

www.staffansberg.fi WWW.SAFETY-SYSTEM.COM SAFETY SYSTEM Hinta ja tuotelista The modern concept Turvalliset & kevyet 3 vuoden takuu!

www.staffansberg.fi WWW.SAFETY-SYSTEM.COM SAFETY SYSTEM Hinta ja tuotelista The modern concept Turvalliset & kevyet 3 vuoden takuu! SAFETY SYSTEM The modern concept Hinta ja tuotelista 2008 Turvalliset & kevyet Muunneltavissa 3 vuoden takuu! Huoltovapaat www.staffansberg.fi WWW.SAFETY-SYSTEM.COM 1 SAFETY SYSTEM TÄYDELLINEN ESTEKOKONAISUUS

Lisätiedot

Kenguru 2010, Benjamin, ratkaisut sivu 1 / 9

Kenguru 2010, Benjamin, ratkaisut sivu 1 / 9 Kenguru 2010, Benjamin, ratkaisut sivu 1 / 9 3 pistettä 1. Kun tiedetään, että + + 6 = + + +, mikä luku voidaan sijoittaa kolmion paikalle? A) 2 B) 3 C) 4 D) 5 E) 6 Ratkaisu: Kun poistetaan kummaltakin

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot