Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy
|
|
- Jarmo Pakarinen
- 6 vuotta sitten
- Katselukertoja:
Transkriptio
1 Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy OVERVIEW- Method updated and written by Sarah Louie (6/19/08) Initially conceptualized by Hajime Ogino (6/23/07) Laboratory of Robert Grainger Department of Biology University of Virginia 1. Extract genomic sequences of interest from genome assembly data. 2. Build accompanying text files. 3. Generate a multiple genomic sequence alignment. 4. Perform a local realignment of ECR sequences. 5. Identify conserved putative transcription factor binding sites.
2 ECR browser: identify ECRs using premade alignments Pax6 coding region ECRs Slide 1
3 ECR browser misses some ECRs; the Pax6CE1 as an example Pax6CE1 Slide 2
4 Comparison of MultiPipMaker results versusecr Browser and Vista Browser in the detection of the Pax6CE1 enhancer Slide 3
5 Phylogenetic analysis using MultiPipMaker as a more sensitive genome alignment tool for the identification of ECRs OVERVIEW 1) Extract genomic sequences of interest from genome assembly data using the UCSC genome browser. 2) Build accompanying exon, repeat and underlay files using PipHelper and Repeatmasker. 3) Generate a global genomic sequence alignment with high sensitivity using Multipipmaker tools. 4) Identify short evolutionarily conserved regions (ECRs) and perform a local realignment of ECR sequences with ClustalW. 5) Scan for putative transcription factor binding sites using rvista. Slide 4
6 Phylogenetic analysis using MultiPipMaker as a more sensitive genome alignment tool for the identification of ECRs OVERVIEW 1) Extract genomic sequences of interest from genome assembly data using the UCSC genome browser. 2) Build accompanying exon, repeat and underlay files using PipHelper and Repeatmasker. 3) Generate a multiple genomic sequence alignment with high sensitivity using Multipipmaker tools. 4) Perform a local realignment of ECR sequences with ClustalW. 5) Scan for putative transcription factor binding sites using TRANSFAC or user-defined motifs. Slide 5
7 1) Extract genomic sequences of interest from genome assembly data using the UCSC genome browser. >Go to Slide 6
8 >Go to the genome and position of interest Slide 7
9 >Get orthologous sequences from multiple genomes Get sequence from 1st genome Get orthologous regions in other genomes Slide 8
10 >Get the genomic DNA sequence from the first genome Slide 9
11 >Save the genomic DNA sequence as simple text file >xentro2_dna range=scaffold_399: 'pad=0 3'pad=0 strand=+ repeatmasking=none ATATATATATATATATATATATATATATATATATATATATATATACATGA GAATAGATTTCTATGCGAAGTAATATAATAGATTTCTATACTAAGAATAT ATATATATATATATATATATATGTACATTACATGCAATTCATAACAATCA TCACAACAATAACCTTAAATCCCATTACAGTTCAATTACCCAGAACAATA TTTCCCAAGGTAACTCATCTTTTTATGTGTTATTTTTTCCCCCATTACAT TTTAGTCGAATATATGTATATATTTTGTATTTCTATTTTTTTTGCAAATT GATACAAAGCATATGATAAACAATCACCATAGTTACCAGGGTCCTTAGTG CTAATGAGGTCCCCAGTTGCAGCTCAGTAAATTGAAACTATTTACTGCAT AGAAATGTTTTTTTTTCCCGTTTTCTATTTTTCTCCAAAGCTTGTTTACA CCCCTTATTTTTTTTTTTGTGTGTTATTTGGGCTGTGCTGTACACTGACA CTAGTGCTGGCAGGAGGGGGCTGCTGTAGTTCAAGCTACTGAATGTAGAT AATAGTTTCTCCCCCCCCTCTCTCTGTATTCACTTTAAACCATGAACACA AATAGTCGCTTCCACTTGGACTTTTTTTTAATTTATTTTATATTACAGTT TTAAACTTAACCAAGGGCCACAATAAAGGGCCAGGGAACATGTATAATTC ACGGTTTGTTATGCTATTACTTTTCATTCTTCACAAAAAAAAAAAATAGC AAAAACCCCCTTTCTTGTTATAAATTTCTGGAGGTAATTTTGTTACTGGT GTGAGTTGTTAGGGGTTGTAAAACTACACAACAGCTCGGCAGGGGGCTCA ATTGGAAAGAGACAATTACAATAGTGAAAGCATTGAAGAGAGTTGGTTAA AAAGAAAGAAGGGGTAAAATAATGTAATGGCCTGAAATTTCTCTCCAAAA TGCCCTTTCTGTCTCTTTTATGGCAGCAATGAATATCAAGGCTCTATCGA Slide 10
12 >Convert the genomic DNA sequence to orthologous locations in other genomes of interest (human, mouse, chicken, zebrafish, etc) Slide 11
13 Phylogenetic analysis using MultiPipMaker as a more sensitive genome alignment tool for the identification of ECRs OVERVIEW 1) Extract genomic sequences of interest from genome assembly data using the UCSC genome browser. 2) Build accompanying exon, repeat and underlay files using PipHelper and Repeatmasker. 3) Generate a multiple genomic sequence alignment with high sensitivity using Multipipmaker tools. 4) Perform a local realignment of ECR sequences with ClustalW. 5) Scan for putative transcription factor binding sites using TRANSFAC or user-defined motifs. Slide 12
14 >Retrieve the exon and underlay files needed for Multipipmaker from PipHelper Slide 13
15 >Download the exon and underlay files Slide 14
16 >Save the exon file as a simple text file Example file for Pax6CE1_Xt containing just the 5 end of coding region : > CE1 > pax exon1 Example file for Pax6CE1_Xt containing all of the Pax6 coding region : < pax UTR exon exon exon exon exon exon exon exon UTR Slide 15
17 >Save the Pax6CE1_Xt underlay file as a simple text file LightCyan Pax6CE LightCyan LightBlue Pax6cds LightBlue LightYellow Pax6intron LightYellow Slide 16
18 >Get the repeat file from RepeatMasker at the ISB Slide 17
19 >Go to Slide 18
20 >Download the repeat text file Slide 19
21 >Save the repeat masker file in simple text Slide 20
22 Phylogenetic analysis using MultiPipMaker as a more sensitive genome alignment tool for the identification of ECRs OVERVIEW 1) Extract genomic sequences of interest from genome assembly data using the UCSC genome browser. 2) Build accompanying exon, repeat and underlay files using PipHelper and Repeatmasker. 3) Generate a multiple genomic sequence alignment with high sensitivity using MultiPipMaker tools. 4) Perform a local realignment of ECR sequences with ClustalW. 5) Scan for putative transcription factor binding sites using TRANSFAC or user-defined motifs. Slide 21
23 >Go to Slide 22
24 >Input the number of sequences to be aligned 5 Slide 23
25 >Input the sequence, exon, underlay and repeat files for the base sequence, and just the sequence files from the other genomes Slide 24
26 >Go to the resulting pip.pdf file for the plot: Pax6CE1 Slide 25
27 >Go to the resulting alignment in the acgt.pdf file: Slide 26
28 Example of pip plot for 80 kb surrounding the Pax6 locus with base genome and annotation from the mouse genome: Slide 27
29 -Ogino, unpubl. Slide 28
30 Phylogenetic analysis using MultiPipMaker as a more sensitive genome alignment tool for the identification of ECRs OVERVIEW 1) Extract genomic sequences of interest from genome assembly data using the UCSC genome browser. 2) Build accompanying exon, repeat and underlay files using PipHelper and Repeatmasker. 3) Generate a global genomic sequence alignment with high sensitivity using Multipipmaker tools. 4) Perform a local realignment of ECR sequences with ClustalW. 5) Scan for putative transcription factor binding sites using TRANSFAC or user-defined motifs. Slide 29
31 >Perform a local realignment of ECR sequences with ClustalW Use VectorNTI or other basic sequence analysis program or SDSC website for the following tasks: 1. Create sequence files 2. Align (with ClustalW at SDSC website) 3. Shade (with BOXSHADE at SDSCwebsite) Slide 30
32 >Go to Slide 31
33 >Add genes to your SDSC Biology Workbench account Slide 32
34 >Perform local alignment with ClustalW, then perform BOXSHADE on the resulting ClustalW alignment Slide 33
35 >Save the BOXSHADE results for phylogenetic footprinting Of Transcription Factor Binding Motif (TFBM) analysis Slide 34
36 Phylogenetic analysis using MultiPipMaker as a more sensitive genome alignment tool for the identification of ECRs OVERVIEW 1) Extract genomic sequences of interest from genome assembly data using the UCSC genome browser. 2) Build accompanying exon, repeat and underlay files using PipHelper and Repeatmasker. 3) Generate a global genomic sequence alignment with high sensitivity using Multipipmaker tools. 4) Perform a local realignment of ECR sequences with ClustalW. 5) Scan for putative transcription factor binding sites using TRANSFAC or user-defined motifs. Slide 35
37 Scanning for putative transcription factor binding sites- A. Employ the TRANSFAC database ( OR B. Employ user-defined motifs ( Slide 36
38 >Predict TFBMs with the TRANSFAC database at the Gene-regulation website Slide 37
39 >Transfac search results from P-Match Slide 38
40 >Check Position weight matrix and references for TRANSFAC database Slide 39
41 >Enter your own TFBM list and sequences using DNApattern at the RSA tools website Slide 40
42 >Results of user-defined search using DNA-pattern PatID Strand Pattern SeqID Start End matching_seq Score SEQ_START DR - Pax6CE1_Xt_227bp SEQ_END DR - Pax6CE1_Xt_227bp OTX/PITX D Taakcy Pax6CE1_Xt_227bp gtactaatcccaac 1.00 MSX2 D Waatkr Pax6CE1_Xt_227bp attaaaatgacgtc 1.00 MSX2 D Waatkr Pax6CE1_Xt_227bp ttgctaattgagac 1.00 MSX2 R Waatkr Pax6CE1_Xt_227bp attttaatggagag 1.00 TCF/LEF R ctttgww Pax6CE1_Xt_227bp tgggctttgtacacc 1.00 RX D ctaattg Pax6CE1_Xt_227bp gttgctaattgagac 1.00 CRE DR gacgtc Pax6CE1_Xt_227bp aaatgacgtcagct 1.00 SEQ_START DR - pax6ce1_hs_241rev SEQ_END DR - pax6ce1_hs_241rev OTX/PITX D Taakcy pax6ce1_hs_241rev gtgctaatccactc 1.00 OTX/PITX R Taakcy pax6ce1_hs_241rev gccgtaatcttgtt 1.00 OTX/PITX R Taakcy pax6ce1_hs_241rev ttcttaagctttgc 1.00 MSX2 D Waatkr pax6ce1_hs_241rev tcgctaattgagag 1.00 SOX D Wwttgww pax6ce1_hs_241rev gattttttgttaaaa 1.00 PROSPERO D caynnct pax6ce1_hs_241rev cattcactcctcgct 1.00 PROSPERO R caynnct pax6ce1_hs_241rev ctcccacccctccaa 1.00 ETS R mggaw pax6ce1_hs_241rev gcctcggaaagaa 1.00 TCF/LEF R ctttgww pax6ce1_hs_241rev ggctctttgaatcag 1.00 SU(H) D rtgrgar pax6ce1_hs_241rev aggggtgggagaagg 1.00 SIP1 R cacct pax6ce1_hs_241rev ttagcaccttctt 1.00 RX D ctaattg pax6ce1_hs_241rev gtcgctaattgagag 1.00 CRE DR gacgtc pax6ce1_hs_241rev caatgacgtcagtg 1.00 SEQ_START DR - Pax6CE1_Mm_240bp SEQ_END DR - Pax6CE1_Mm_240bp OTX/PITX D Taakcy Pax6CE1_Mm_240bp gtgctaatccactg 1.00 OTX/PITX R Taakcy Pax6CE1_Mm_240bp gccataatcttgtt 1.00 OTX/PITX R Taakcy Pax6CE1_Mm_240bp ctcttaagctttgc 1.00 MSX2 D Waatkr Pax6CE1_Mm_240bp ttgctaattgagag 1.00 SOX D Wwttgww Pax6CE1_Mm_240bp atttttttgttaaaa 1.00 SU(H) D rtgrgar Pax6CE1_Mm_240bp gtgggtgggagaagg 1.00 SIP1 R cacct Pax6CE1_Mm_240bp atctcacctcaga 1.00 RX D ctaattg Pax6CE1_Mm_240bp gttgctaattgagag 1.00 CRE DR gacgtc Pax6CE1_Mm_240bp caatgacgtcagcg Slide 41
43 >Use the Feature Map for visual comparison of predicted TFBMs in each sequence Slide 42
44 Overlay TFBM search results on ECR alignment to identify predicted binding sites that are also conserved in Xenopus Pax6CE1 Hs Pax6CE1 Mm Pax6CE1 Xt CRE (1) CGGAGCCCCCTTCCCCACCC------AATGACGTCAGTGGCATTCACTCC (1) CGAAGCCCCCATCCCCACCC------AATGACGTCAGCGGCATTCATGCC (1) CGCAGCCCCCCCCCCCTCTCCATTAAAATGACGTCAGCTGTATACA-TCA Pax6CE1 Hs (45) TCGCTCCTTGCCTTTTCTGATTTTTTG-TTAAAACTTTTCTCCGCAGCGA Pax6CE1 Mm (45) AGGCTCCTAGCTTCTTCTGATTTTTTTGTTAAAACTTTTCTCTGAGGTGA Pax6CE1 Xt (50) T--CTCCCTCCCCCTTATGATTTTTTT-TTT----TTTTCTCTAAAACTT Pax6CE1 Hs (94) GATGGGGGTTGGAGGGGTGGGAGAAGGAGCTGATTCAAAGAGC-CAGTGC Pax6CE1 Mm (95) GATGGGGGTTGT--GGGTGGGAGAAGGGGCTGATTGAAAGAGC-CAGTGC Pax6CE1 Xt (93) TTTTT--TTTTGTCGGGAGGGTGTA CAAAGCCCACTCTGC Pax6CE1 Hs (143) CCTGGGGGGAAATAGCAACAAGATTACGGCTGCTTCTTTCCGAGGCAAAG Pax6CE1 Mm (142) CCTGGGGGGAAATAGCAACAAGATTATGGCTGCCTCTTTCTTAGGCAAAG Pax6CE1 Xt (131) CCTAGGGAGAAATAGCAACATGATTAGAGCTTCT-----CGGAGCAAAGG OTX/PITX Rx/MSX Pax6CE1 Hs (193) CTTAAGAAGGTGCTAATCCACTCGGTCGCTAATTGAGA---GGTTGTAAA Pax6CE1 Mm (192) CTTAAGAGGGTGCTAATCCACTGGGTTGCTAATTGAGA---GGTTGTAAA Pax6CE1 Xt (176) CATTATTTCGTACTAATCCCAACAGTTGCTAATTGAGACTTGCTTGGAAA Pax6CE1 Hs (240) AA Pax6CE1 Mm (239) AA Pax6CE1 Xt (226) AA Slide 43
45 References Ivan Ovcharenko, Marcelo Nobrega, Gabriela Loots, Lisa Stubbs. ECR Browser: a Tool for Visualizing and Accessing Data from Comparisons of Multiple Vertebrate Genomes. Nucleic Acids Research (2004) 32: W280-W286. Ivan Ovcharenko, Gabriela Loots, Ross Hardison, Webb Miller, Lisa Stubbs. zpicture: Dynamic Alignment and Visualization Tool for Analyzing Conservation Profiles. Genome Research (2004) 14: Kleinjan DA, van Heyningen V. Long-range control of gene expression: emerging mechanisms and disruption in disease. Am J Hum Genet Jan;76(1):8-32. Epub 2004 Nov 17. Lettice LA, Hill AE, Devenney PS, Hill RE. Point mutations in a distant sonic hedgehog cis-regulator generate a variable regulatory output responsible for preaxial polydactyly. Hum Mol Genet Apr 1;17(7): Epub 2007 Dec 21. Ogino H, Fisher M, Grainger RM. Convergence of a head-field selector Otx2 and Notch signaling: a mechanism for lens specification. Development Jan;135(2): Scott Schwartz, Zheng Zhang, Kelly A. Frazer, Arian Smit, Cathy Riemer, John Bouck, Richard Gibbs, Ross Hardison, and Webb Miller. PipMaker---A Web Server for Aligning Two Genomic DNA Sequences. Genome Research (2000) Vol. 10, Issue 4; Scott Schwartz, Laura Elnitski, Mei Li, Matt Weirauch, Cathy Riemer, Arian Smit, Eric Green, Ross Hardison, NISC Comparative Sequencing program, Webb Miller. MultiPipMaker and Supporting Tools: Alignments and Analysis of Multiple Genomic DNA sequences. Nucleic Acids Research (2003) 31: Scott Schwartz, W. James Kent, Arian Smit, Zheng Zhang, Robert Baertsch, Ross C. Hardison, David Haussler, and Webb Miller. Human-Mouse Alignments with BLASTZ. (2003) 13: ; originally published online Dec 30, 2002; Genome Res.
State of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
Eukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
Functional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
Chapter 7. Motif finding (week 11) Chapter 8. Sequence binning (week 11)
Course organization Introduction ( Week 1) Part I: Algorithms for Sequence Analysis (Week 1-11) Chapter 1-3, Models and theories» Probability theory and Statistics (Week 2)» Algorithm complexity analysis
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Python Libraries 1 / 14
Python Libraries 1 / 14 Gzip, CSV https://docs.python.org/3/library/gzip.html https://docs.python.org/3/library/csv.html https://daler.github.io/pybedtools/ - PyBed tools http://biopython.org/wiki/gff_parsing
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
Genome 373: Genomic Informatics. Professors Elhanan Borenstein and Jay Shendure
Genome 373: Genomic Informatics Professors Elhanan Borenstein and Jay Shendure Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis
Bioinformatics. Sequence Analysis: Part III. Pattern Searching and Gene Finding. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Sequence Analysis: Part III. Pattern Searching and Gene Finding Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18
Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site
Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site Note! Before starting download and install a fresh version of OfficeProfessionalPlus_x64_en-us. The instructions are in the beginning of the exercise.
You can check above like this: Start->Control Panel->Programs->find if Microsoft Lync or Microsoft Lync Attendeed is listed
Online Meeting Guest Online Meeting for Guest Participant Lync Attendee Installation Online kokous vierailevalle osallistujalle Lync Attendee Asennus www.ruukki.com Overview Before you can join to Ruukki
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
FinFamily Installation and importing data (11.1.2016) FinFamily Asennus / Installation
FinFamily Asennus / Installation 1 Sisällys / Contents FinFamily Asennus / Installation... 1 1. Asennus ja tietojen tuonti / Installation and importing data... 4 1.1. Asenna Java / Install Java... 4 1.2.
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks. David R. Kelley
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks David R. Kelley DNA codes for complex life. How? Kundaje et al. Integrative analysis of 111 reference
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
Chapter 9 Motif finding. Chaochun Wei Spring 2019
1896 1920 1987 2006 Chapter 9 Motif finding Chaochun Wei Spring 2019 Contents 1. Reading materials 2. Sequence structure modeling Motif finding Regulatory module finding 2 Reading materials Tompa et al
Smart access control.
Smart access control. www.topkodas.lt zivile@topkodas.lt UPC: 99989897969062 Door control with Wiegand keypad, ibutton key. Door control during specified time interval. Remote control via mobile phone,
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
Computational personal genomics: selection, regulation, epigenomics, disease
Computational personal genomics: selection, regulation, epigenomics, disease Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory TATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA
11/17/11. Gene Regulation. Gene Regulation. Gene Regulation. Finding Regulatory Motifs in DNA Sequences. Regulatory Proteins
Gene Regulation Finding Regulatory Motifs in DNA Sequences An experiment shows that when X is knocked out, 20 other s are not expressed How can one have such drastic effects? Regulatory Proteins Gene X
Land-Use Model for the Helsinki Metropolitan Area
Land-Use Model for the Helsinki Metropolitan Area Paavo Moilanen Introduction & Background Metropolitan Area Council asked 2005: What is good land use for the transport systems plan? At first a literature
I. Principles of Pointer Year Analysis
I. Principles of Pointer Year Analysis Fig 1. Maximum (red) and minimum (blue) pointer years. 1 Fig 2. Principle of pointer year calculation. Fig 3. Skeleton plot graph created by Kinsys/Kigraph programme.
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
Microsoft Lync 2010 Attendee
VYVI MEETING Lync Attendee 2010 Instruction 1 (15) Microsoft Lync 2010 Attendee Online meeting VYVI MEETING Lync Attendee 2010 Instruction 2 (15) Index 1 Microsoft LYNC 2010 Attendee... 3 2 Acquiring Lync
HARJOITUS- PAKETTI A
Logistiikka A35A00310 Tuotantotalouden perusteet HARJOITUS- PAKETTI A (6 pistettä) TUTA 19 Luento 3.Ennustaminen County General 1 piste The number of heart surgeries performed at County General Hospital
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto If you are searched for a book by Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice over LTE (VoLTE) in pdf form, then you have come
Supporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ
Puhe ja kieli, 27:4, 141 147 (2007) 3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ Soile Loukusa, Oulun yliopisto, suomen kielen, informaatiotutkimuksen ja logopedian laitos & University
Regulatory Sequence Analysis. Discovering phylogenetic footprints in bacterial promoters
Regulatory Sequence Analysis Discovering phylogenetic footprints in bacterial promoters DNA-protein binding interface Example of DNA-protein interface. LexA homodimer on the reca promoter. Note: this is
WP3 Decision Support Technologies
WP3 Decision Support Technologies 1 WP3 Decision Support Technologies WP Leader: Jarmo Laitinen Proposed budget: 185 000, VTT 100 000, TUT 85 000. WP3 focuses in utilizing decision support technologies
Helsinki, Turku and WMT
Helsinki, Turku and Uppsala @ WMT Jörg Tiedemann & Robert Östling, University of Helsinki Fabienne Cap & Sara Stymne, Uppsala University Filip Ginter & Jenna Kanerva, University of Turku Factored Phrase-Based
Capacity utilization
Mat-2.4142 Seminar on optimization Capacity utilization 12.12.2007 Contents Summary of chapter 14 Related DEA-solver models Illustrative examples Measure of technical capacity utilization Price-based measure
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
TW-LTE 4G/3G. USB-modeemi (USB 2.0)
TW-LTE 4G/3G USB-modeemi (USB 2.0) Tiedonsiirtonopeus: 100 Mbps/50 Mbps LTE: 1800/2100/2600 MHz GSM/GPRS/EDGE: 850/900/1800/1900 MHz UMTS: 900/2100 MHz Pikaohje (Finnish) CE Käyttöönotto- ohje SIM- kortin
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
Atostek. KanTa-konseptin tuotteistaminen ja vienti ulkomaille
Atostek KanTa-konseptin tuotteistaminen ja vienti ulkomaille 10.3.2017 Atostek CONFIDENTIAL Atostek - Company Facts Atostek Ltd. founded in 1999 56 employees mainly at Master level AAA credit rating since
toukokuu 2011: Lukion kokeiden kehittämistyöryhmien suunnittelukokous
Tuula Sutela toukokuu 2011: Lukion kokeiden kehittämistyöryhmien suunnittelukokous äidinkieli ja kirjallisuus, modersmål och litteratur, kemia, maantiede, matematiikka, englanti käsikirjoitukset vuoden
Mobility Tool. Demo 21.8.2013 CIMO
Mobility Tool Demo 21.8.2013 CIMO 1 Sisältö Korkeakoulukäyttäjä (Beneficiary User) Home Project details Partners Mobilities Working with CSV Import Mobilities Budget 2 Home Find your project Project menu
Enterprise Architecture TJTSE Yrityksen kokonaisarkkitehtuuri
Enterprise Architecture TJTSE25 2009 Yrityksen kokonaisarkkitehtuuri Jukka (Jups) Heikkilä Professor, IS (ebusiness) Faculty of Information Technology University of Jyväskylä e-mail: jups@cc.jyu.fi tel:
TIEKE Verkottaja Service Tools for electronic data interchange utilizers. Heikki Laaksamo
TIEKE Verkottaja Service Tools for electronic data interchange utilizers Heikki Laaksamo TIEKE Finnish Information Society Development Centre (TIEKE Tietoyhteiskunnan kehittämiskeskus ry) TIEKE is a neutral,
HY-käyttäjät HUS/HYKS käyttäjät
EndNote Pikaohje Peruskäytön vaiheet Kun EndNote on asennettu koneelle/koneille: 1. Perusta kirjasto (vastaa tiedostojenhallinnassa kahta tiedostoa.enl ja.data tiedostot) 2. Vie viitteet tietokannoista
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
CSC:n käyttäjätunnukset - myös opiskelijoille
CSC:n käyttäjätunnukset - myös opiskelijoille http://www.csc.fi/asiakkaaksi/korkeakoulut/kayttol upahakemukset/index_html Ohjaajan nimeksi Petri Törönen Perusteluiksi opiskelu ja luentokurssin nimi (Geneettisen
LANSEERAUS LÄHESTYY AIKATAULU OMINAISUUDET. Sähköinen jäsenkortti. Yksinkertainen tapa lähettää viestejä jäsenille
tiedote 2 / 9.3.2017 LANSEERAUS LÄHESTYY AIKATAULU 4.3. ebirdie-jäsenkortti esiteltiin Golfliiton 60-vuotisjuhlaseminaarissa 17.3. ebirdie tulee kaikkien ladattavaksi Golfmessuilla 17.3. klo 12:00 alkaen
Lampiran 1 Komposisi media pertumbuhan yang digunakan A. Media nutrien agar (NA) - Agar 1.5% - Nutrient broth 0.8%
LAMPIRAN 8 9 Lampiran 1 Komposisi media pertumbuhan yang digunakan A. Media nutrien agar (NA) - Agar 1.5% - Nutrient broth 0.8% B. Media King s B agar - Agar 1.5% - Pepton 2% - K 2 HPO 4 0.15% - MgSO 4.4H
Lab A1.FARM_Hyper-V.v3
Lab A1.FARM_Hyper-V Installing SharePoint Server 2013 SharePoint Server 2013 -asennus Scenario To install and configure SharePoint 2013 on a single server (Server 2012, AD and SQL Server), you will follow
1.3 Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 811122P (5 op.) 12.12.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
Opintomatkat PDF. ==>Download: Opintomatkat PDF ebook By Risto Antikainen
Opintomatkat PDF ==>Download: Opintomatkat PDF ebook By Risto Antikainen Opintomatkat PDF By Risto Antikainen - Are you searching for Opintomatkat pdf Books? Now, you will be happy that Opintomatkat PDF
amkbyod-tulostaminen Huittisten ja Kankaanpään kampuksilla / BYOD printing in Huittinen and Kankaanpää campuses
OHJE 1(5) amkbyod-tulostaminen Huittisten ja Kankaanpään kampuksilla / BYOD printing in Huittinen and Kankaanpää campuses 1. Kirjaudu omalta laitteeltasi osoitteeseen: http://webprint.samk.fi/. Open browser
Genomic and epigenomic signatures for interpreting complex disease
Genomic and epigenomic signatures for interpreting complex disease Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory TATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
WindPRO version joulu 2012 Printed/Page :42 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 13.6.2013 19:42 / 1 Minimum
Poraustyökierrot ja piirteiden tunnistus
Poraustyökierrot ja piirteiden tunnistus 2.5 to 5-Axis Drilling Operations Create a Spot Drilling Operation Create a Drilling Operation Create a Drilling Dwell Delay Operation Create a Drilling Deep Hole
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
NC-ohjelman tekeminen Catiassa
NC-ohjelman tekeminen Catiassa - Käynnistä Catia V5 R21 Koska mikroluokan TF331 koneissa ei ole Catian vaatimia postprosessoritiedostoja ja ohjelmia, tehdään postprosessoriajot Catian mukana tulleilla
Windows Phone. Module Descriptions. Opiframe Oy puh. +358 44 7220800 eero.huusko@opiframe.com. 02600 Espoo
Windows Phone Module Descriptions Mikä on RekryKoulutus? Harvassa ovat ne työnantajat, jotka löytävät juuri heidän alansa hallitsevat ammatti-ihmiset valmiina. Fiksuinta on tunnustaa tosiasiat ja hankkia
Järjestelmän syötteet ja tulosteet Kohahdus Helsinki Ohjelmistotuotantoprojekti HELSINGIN YLIOPISTO Tietojenkäsittelytieteen laitos
Järjestelmän syötteet ja tulosteet Kohahdus Helsinki 5.11.2006 Ohjelmistotuotantoprojekti HELSINGIN YLIOPISTO Tietojenkäsittelytieteen laitos Kurssi 581260 Ohjelmistotuotantoprojekti (6 ov) Projektiryhmä
( ,5 1 1,5 2 km
Tuulivoimala Rakennukset Asuinrakennus Liikerak. tai Julkinen rak. Lomarakennus Teollinen rakennus Kirkollinen rakennus Varjostus "real case" h/a 1 h/a 8 h/a 20 h/a 4 5 3 1 2 6 7 8 9 10 0 0,5 1 1,5 2 km
Telecommunication Software
Telecommunication Software Final exam 21.11.2006 COMPUTER ENGINEERING LABORATORY 521265A Vastaukset englanniksi tai suomeksi. / Answers in English or in Finnish. 1. (a) Määrittele sovellusviesti, PersonnelRecord,
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Calculation: N117 x 9 x HH141 Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 22.12.2014 11:33 / 1 Minimum
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Sisällysluettelo Table of contents
Sisällysluettelo Table of contents OTC:n Moodlen käyttöohje suomeksi... 1 Kirjautuminen Moodleen... 2 Ensimmäinen kirjautuminen Moodleen... 2 Salasanan vaihto... 2 Oma käyttäjäprofiili... 3 Työskentely
HIRLAM diagnostics for operations and experiments
HIRLAM diagnostics for operations and experiments HIRLAM-ALADIN-MF miniworkshop on mesoscale physics and diagnostic tools Met.No, 12-13 December 2005 Carl Fortelius, FMI 11.12.05 HIRLAM diagnostics Purpose
6.095/ Computational Biology: Genomes, Networks, Evolution. Sequence Alignment and Dynamic Programming
6.095/6.895 - Computational Biology: Genomes, Networks, Evolution Sequence lignment and Dynamic Programming Tue Sept 13, 2005 Challenges in Computational Biology 4 Genome ssembly 5 Regulatory motif discovery
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING
PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING Veijalainen O, Kares S, Kujala P, Vuento R, TirKkonen M, Kholová I, Osuala V, Mäenpää J University and University Hospital of Tampere, Finland,
Teknillinen tiedekunta, matematiikan jaos Numeeriset menetelmät
Numeeriset menetelmät 1. välikoe, 14.2.2009 1. Määrää matriisin 1 1 a 1 3 a a 4 a a 2 1 LU-hajotelma kaikille a R. Ratkaise LU-hajotelmaa käyttäen yhtälöryhmä Ax = b, missä b = [ 1 3 2a 2 a + 3] T. 2.
Supporting information
Supporting information Figure S1. Carotenoid biosynthesis pathway in papaya fruit which is adopted from Blas et al. (2010) (reference 4) and Nisar et al. (2015) (reference 5). Carotenoids are synthesized
21~--~--~r--1~~--~--~~r--1~
- K.Loberg FYSE420 DIGITAL ELECTRONICS 13.05.2011 1. Toteuta alla esitetyn sekvenssin tuottava asynkroninen pun. Anna heratefunktiot, siirtotaulukko ja kokonaistilataulukko ( exitation functions, transition
Suomen Talonpoikaiss Dyn Keskustelup Yt Kirjat, Issue 1... (Finnish Edition) Click here if your download doesn"t start automatically
Suomen Talonpoikaiss Dyn Keskustelup Yt Kirjat, Issue 1... (Finnish Edition) Click here if your download doesn"t start automatically Suomen Talonpoikaiss Dyn Keskustelup Yt Kirjat, Issue 1... (Finnish
Ajettavat luokat: SM: S1 (25 aika-ajon nopeinta)
SUPERMOTO SM 2013 OULU Lisämääräys ja ohje Oulun Moottorikerho ry ja Oulun Formula K-125ry toivottaa SuperMoto kuljettajat osallistumaan SuperMoto SM 2013 Oulu osakilpailuun. Kilpailu ajetaan karting radalla
Valuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
Exercise 3: Raster data analysis Course: Rakennetun ympäristön paikkatiedot RYM C2004 Date:
Exercise 3: Raster data analysis Course: Rakennetun ympäristön paikkatiedot RYM C2004 Date: 20.09.2016 Introduction In this exercise we will analyze SLICES raster dataset that contains data about land
Searching (Sub-)Strings. Ulf Leser
Searching (Sub-)Strings Ulf Leser This Lecture Exact substring search Naïve Boyer-Moore Searching with profiles Sequence profiles Ungapped approximate search Statistical evaluation of search results Ulf
,0 Yes ,0 120, ,8
SHADOW - Main Result Calculation: Alue 2 ( x 9 x HH120) TuuliSaimaa kaavaluonnos Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered
Strain or plasmid Description a Reference or source b. 168 trpc2 Laboratory. 1A780 trpc2 sigb::spc BGSC
TABLE S1 Bacterial strains and plasmids Strain or plasmid Description a Reference or source b B. subtilis 168 trpc2 Laboratory stock 1A780 trpc2 sigb::spc BGSC BM1010 trpc2 htpx::pgs1582; Em r BM1302 trpc2
Supplementary Material : Baker et al. 1
Supplementary Material : Baker et al. 1 Supplementary Material Title: Species identity and human consumption of beaked whales in the Gilbert Islands, Republic of Kiribati Authors: C. Scott Baker, Al Hutt,
VIIKKI BIOCENTER University of Helsinki
VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja
OP1. PreDP StudyPlan
OP1 PreDP StudyPlan PreDP The preparatory year classes are in accordance with the Finnish national curriculum, with the distinction that most of the compulsory courses are taught in English to familiarize
WAMS 2010,Ylivieska Monitoring service of energy efficiency in housing. 13.10.2010 Jan Nyman, jan.nyman@posintra.fi
WAMS 2010,Ylivieska Monitoring service of energy efficiency in housing 13.10.2010 Jan Nyman, jan.nyman@posintra.fi Background info STOK: development center for technology related to building automation
Mediamainonnan muutosmittari Marraskuu Mainonnan muutosmittari
Mediamainonnan muutosmittari Marraskuu 2015 Ajankohtaista Marraskuussa mainonnan määrä väheni 2,6 % vuoden 2014 marraskuuhun verrattuna. Radioille kuukausi oli erinomainen, kasvua peräti reilut 30 %. Kumulatiivisesti
7. Product-line architectures
7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software