Chapter 9 Motif finding. Chaochun Wei Spring 2019
|
|
- Tapani Väänänen
- 6 vuotta sitten
- Katselukertoja:
Transkriptio
1 Chapter 9 Motif finding Chaochun Wei Spring 2019
2 Contents 1. Reading materials 2. Sequence structure modeling Motif finding Regulatory module finding 2
3 Reading materials Tompa et al (2005), Assessing computational tools for the discovery of transcription factor binding sites, Nature Biotechnology, 23(2):
4 Sequence Motifs Motif: subsequence with some specific function May be in DNA, RNA, protein Function may be context dependent Ribosome binding site must be transcribed RNA, protein motifs may depend on structure May be gapped or ungapped Use model to search for (predict) new sites Models may be simple sequences (regular expressions) or probabilistic patterns Modeling approach depends on data available Quantitative/qualitative
5 Motifs: DNA binding sites Gene regulation often controlled by proteins (transcription factors) that bind to specific DNA sequences to activate or repress transcription Binding sites are usually short (6-30bp) and typically ungapped, probabilistic patterns Would like to have a quanitative model that predicts binding affinity and/or occupancy
6
7
8 Binding energy to all possible 4-long sites, and a simple additive model that gives the same energy predictions
9 Weight Matrix Model A: C: G: T:
10 Weight Matrix Model -24.A C T A T A A T G T A: C: G: T:
11 Weight Matrix Model 43.A C T A T A A T G T A: C: G: T:
12 Non-additivity in binding Non-specific binding sets lower limit on affinity Typically much higher than if all bases considered Non-additive contributions to specific binding Binding energy of a base may depend on context (neighboring bases) Can use more complex models
13 If simple additive model is inadequate, can use, di-nucleotide or higher-order models. Some form of a matrix model must be correct because binding the binding data itself is a matrix (vector) AA AC AG AT TT AAA AAC AAG AAT TTT
14 How to get optimal models Quantitative binding data Can do regression to get best fit Can test different models Must take into account that a more complex model can always give better fit, but is it useful? Qualitative binding data set of sites Log-odds methods, assume Boltzmann Can use minimum volume method (QP)
15 Key point: There are only 3L+1 independent parameters
16 Given some quantitative activity data, you can obtain the optimal solution using standard, multiple linear regression methods. Key point: If you assume the activity is related to affinity and model parameters are related to energy, need to regress vs log(affinity)...
17 You get the optimal model, and you can Assess how well that model fits the data.
18 Here is a different example, the context of induced mutations, where the simple additive model doesn t work well but a di-nucleotide model gives a much better fit.
19 Example binding sites Most often one has example binding sites without quantitative binding data Can find the model that maximizes the probability of observing those sites using a maximum likelihood approach Can use maximum a posterior instead, especially if one has small sample size
20 N(b,i) F(b,i) S(b,i) = log[f(b,i)/p(b)] I(i) = F(b,i)S(b,i) b
21 Likelihood Ratio Statistics Primer Given two probability distributions P i and Q I P i = Q i = 1 And some data, D i, which is number of times each type i is observed in N total observations The Likelihood Ratio of the data being from distribution Q i versus P i is: LR = (Q i /P i ) Di And the log-likelihood Ratio is LLR = D i ln (Q i /P i )
22 LLR = D i ln (Q i /P i ) Maximum likelihood distribution is Q i = D i /N So max LLR = N Q i ln (Q i /P i ) Q i ln (Q i /P i ) 0 Information Content Relative Entropy Kullbach-Liebler Distance Related to G-statistic and χ 2
23 A C G T
24 Motif Discovery Find significant motifs in long sequences Types of data Co-regulated promoters Segments bound to specific proteins Phylogenetically conserved segments Algorithm classes search space Pattern searches consensus motifs Alignment searches PWM motifs Objective Functions
25 Example (small) dataset CE1CG \TAATGTTTGTGCTGGTTTTTGTGGCATCGGGCGAGAATAGCGCGTGGTGTGAAAGACTGTTTTTTTGATCGTTTTCACAAAAATGGAAGTCCACAGTCTTGACAG\ ECOARABOP \GACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAG\ ECOBGLR1 \ACAAATCCCAATAACTTAATTATTGGGATTTGTTATATATAACTTTATAAATTCCTAAAATTACACAAAGTTAATAACTGTGAGCATGGTCATATTTTTATCAAT\ ECOCRP \CACAAAGCGAAAGCTATGCTAAAACAGTCAGGATGCTACAGTAATACATTGATGTACTGCATGTATGCAAAGGACGTCACATTACCGTGCAGTACAGTTGATAGC\ ECOCYA \ACGGTGCTACACTTGTATGTAGCGCATCTTTCTTTACGGTCAATCAGCAAGGTGTTAAATTGATCACGTTTTAGACCATTTTTTCGTCGTGAAACTAAAAAAACC\ ECODEOP2 \AGTGAATTATTTGAACCAGATCGCATTACAGTGATGCAAACTTGTAAGTAGATTTCCTTAATTGTGATGTGTATCGAAGTGTGTTGCGGAGTAGATGTTAGAATA\ ECOGALE \GCGCATAAAAAACGGCTAAATTCTTGTGTAAACGATTCCACTAATTTATTCCATGTCACACTTTTCGCATCTTTGTTATGCTATGGTTATTTCATACCATAAGCC\ ECOILVBPR \GCTCCGGCGGGGTTTTTTGTTATCTGCAATTCAGTACAAAACGTGATCAACCCCTCAATTTTCCCTTTGCTGAAAAATTTTCCATTGTCTCCCCTGTAAAGCTGT\ ECOLAC \AACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCAC\ ECOMALBA \ACATTACCGCCAATTCTGTAACAGAGATCACACAAAGCGACGGTGGGGCGTAGGGGCAAGGAGGATGGAAAGAGGTTGCCGTATAAAGAAACTAGAGTCCGTTTA\ ECOMALBA \GGAGGAGGCGGGAGGATGAGAACACGGCTTCTGTGAACTAAACCGAGGTCATGTAAGGAATTTCGTGATGTTGCTTGCAAAAATCGTGGCGATTTTATGTGCGCA\ ECOMALT \GATCAGCGTCGTTTTAGGTGAGTTGTTAATAAAGATTTGGAATTGTGACACAGTGCAAATTCAGACACATAAAAAAACGTCATCGCTTGCATTAGAAAGGTTTCT\ ECOOMPA \GCTGACAAAAAAGATTAAACATACCTTATACAAGACTTTTTTTTCATATGCCTGACGGAGTTCACACTTGTAAGTTTTCAACTACGTTGTAGACTTTACATCGCC\ ECOTNAA \TTTTTTAAACATTAAAATTCTTACGTAATTTATAATCTTTAAAAAAAGCATTTAATATTGCTCCCCGAACGATTGTGATTCGATTCACATTTAAACAATTTCAGA\ ECOUXU1 \CCCATGAGAGTGAAATTGTTGTGATGTGGTTAACCCAATTAGAATTCGGGATTGACATGTCTTACCAAAAGGTAGAACTTATACGCCATCTCATCCGATGCAAGC\ PBR322 \CTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTC\ TRN9CAT \CTGTGACGGAAGATCACTTCGCAGAATAAATAAATCCTGGTGTCCCTGTTGATACCGGGAAGCCCTGGGCCAACTTTTGGCGAAAATGAGACGTTGATCGGCACG\ TDC \GATTTTTATACTTTAACTTGTTGATATTTAAAGGTATTTAATTGTAATAACGATACTCTGGAAAGTATTGAAAGTTAATTTGTGAGTGGTCGCACATATCCTGTT\
26 Example Output
27 Example Output
28 Types of Motifs 1. Motif: Consensus Sequence pattern May include degenerate bases and allow for mismatches Search space is over possible patterns 2. Weight Matrix (PWM, Profile, PSSM) Might go to higher order models Search space is over possible alignments
29 Can use suffix tree for efficient search of patterns Pattern based algorithms Motif length l, mismatches m; N seqs, L long 4^l patterns, search for most common (or most significant) allowing up to m mismatches P-value from background distribution Can allow for m mismatches Can allow degenerate positions: 15^l patterns Can just search using existing l-mers
30 WEEDER program: good performance on benchmark tests. Suffix Trees All sequneces included in O(NL) time and space Each node can be labeled with N-bit string to indicate which sequences contain specific l-mer Can allow m mismatches: At each string keep track of number of mismatches to pattern being considered and continue down branches until that is exceeded. Can speed up by requiring the mismatches to be spaced; i.e. not all at beginning of string Each pattern can be searched for in linear time, can find all patterns that match criteria of occurring in at least k/n seqs Significance of each matching Pattern can be found from an Expectation based on background
31 Alignment (Profile) based methods Greedy algorithm (Consensus) Expectation Maximization (MEME) Gibbs Sampler Regression (MatrixReduce) Can use phylogenetic conservation
32 Greedy Algorithm (Consensus) Simple version: assume every sequence contains at least one true binding site Using each l-mer find best match to generate 2- seq alignments Using top K PWMs to search remaining sequences to include a new sequence Repeat until all seqs contribute Or objective function is maximized (IC, p-value)
33 Expectation Maximization (MEME) Initial PWM (at random or from average over all potential sites) Using current PWM determine probability of all positions being sites Re-estimate PWM based on those probabilities Continue until convergence always convergences Objective is LLR
34 Gibbs Sampling Similar to EM, but some important differences At each iteration pick one site on each seq, chosen by its probability, to update PWM Not guaranteed to converge, but tends to increase objective (IC) and plauteau Can escape local optima Other MCMC algorithms Metropolis Simulated annealing
35 From Lawrence et al, (1993) Science 1 262:
36 Sequence Motifs (II) Everything you learned about sequence motifs is wrong! But that is OK because:
37 Sequence Motifs (II) Everything you learned about sequence motifs is wrong! But that is OK because: All models are wrong. Some models are useful. George Box
38 Motifs: how are they wrong? Non-specific binding sets lower limit on affinity Non-additivity is an approximation; sometimes it is a good one, sometimes not Probabilistic models, such as log-odds PWMs, make an implicit assumption that sites come from a Boltzmann distribution
39 Log-Odds method assumes binding site probabilities from Boltzmann distribution: Z e S P S F i E i i / ) ( ) ( ) ( ) ( ln ln ' i i i i S P S F Z E E In Bayesian notation: P(S i bound) = P(bound S i ) P(S i )/P(bound)
40 Log-odds methods assumes sites are selected from a Boltzmann distribution where probability of binding is proportional to e -E
41 Problem: the simple probabilistic model doesn t model doesn t account for the protein concentration and saturation effects, or the biophysics of the interaction
42 Boltzmann is an approximation to the real (Fermi-Dirac) distribution: 1 P( S i bound) 1 e E i for Probabilities =.03,.33,.67,.99 for the consensus site with energy=0
43
44 True vs Predicted Binding Probabilities
45 Does it matter if we assume the wrong distribution? 1. Are binding sites often near saturation? 2. If so how accurate are the log-odds models? 3. How does it affect false-positive/falsenegative rates when predicting sites? 4. How can we get models using the correct distribution?
46 Djordjevic et al Genome Res :
47 Quadratic Programming finds solution with minimum number of predicted binding sites
48
49 Compare performance of: Log-odds (Red) QPMEME (Blue) MATCH (YELLOW) Simulated data with known Energy matrix T P rate FP rate Sample sites with assuming: Step function (top) Boltzmann (bottom) For all score cutoffs, Vertical axis = TP rate Horizontal axis = FP rate T P rate FP rate
50 Can we do better than either QP or Log-odds? Want to fit the whole distribution and estimate both the binding energy matrix and µ Sample sequences based on their probability, Estimate model from sampled sites
51 Binding Energy Estimates using Maximum Likelihood (BEEML)
52
53 High-throughput SELEX Components: Purified protein with GST-tag attached to beads Randomized synthetic library Method: 1. Illumina sequence library to ascertain any biases (to get P(S i )) 2. Extract DNA bound to protein, Illumina sequence (to get P(S i bound)) 3. (Repeat step 2 if desired) 4. BEEML analysis of sequences to get PWM
54
55
56 Protein Binding Microarray (PBM)Technology Berger et al. Nature Biotechnology, Vol. 24, pp (November 2006)
57 Accuracy of BEEML PWM from PBM data
58 UniProbe PWM
59 Conclusions Log-odds methods for estimating energy matrices and/or binding probabilities work fine in some cases, poorly in others Can take into account protein concentration and get fit to the whole distribution using a maximum likelihood method that gives good results under a wider variety of conditions Possible to take into account non-specific binding and multiple modes of binding too
60 Acknowledgement Most of the slides in this chapter were provided by Prof. Gary Stormo. 60
Chapter 7. Motif finding (week 11) Chapter 8. Sequence binning (week 11)
Course organization Introduction ( Week 1) Part I: Algorithms for Sequence Analysis (Week 1-11) Chapter 1-3, Models and theories» Probability theory and Statistics (Week 2)» Algorithm complexity analysis
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
Statistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
T Statistical Natural Language Processing Answers 6 Collocations Version 1.0
T-61.5020 Statistical Natural Language Processing Answers 6 Collocations Version 1.0 1. Let s start by calculating the results for pair valkoinen, talo manually: Frequency: Bigrams valkoinen, talo occurred
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
Valuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
Miksi Suomi on Suomi (Finnish Edition)
Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Click here if your download doesn"t start automatically Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Miksi Suomi on Suomi (Finnish Edition)
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL Ville Liljeström, Micha Matusewicz, Kari Pirkkalainen, Jussi-Petteri Suuronen and Ritva Serimaa 13.3.2012
Capacity utilization
Mat-2.4142 Seminar on optimization Capacity utilization 12.12.2007 Contents Summary of chapter 14 Related DEA-solver models Illustrative examples Measure of technical capacity utilization Price-based measure
Operatioanalyysi 2011, Harjoitus 4, viikko 40
Operatioanalyysi 2011, Harjoitus 4, viikko 40 H4t1, Exercise 4.2. H4t2, Exercise 4.3. H4t3, Exercise 4.4. H4t4, Exercise 4.5. H4t5, Exercise 4.6. (Exercise 4.2.) 1 4.2. Solve the LP max z = x 1 + 2x 2
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition)
Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition) Click here if your download doesn"t start automatically
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks. David R. Kelley
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks David R. Kelley DNA codes for complex life. How? Kundaje et al. Integrative analysis of 111 reference
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
11/17/11. Gene Regulation. Gene Regulation. Gene Regulation. Finding Regulatory Motifs in DNA Sequences. Regulatory Proteins
Gene Regulation Finding Regulatory Motifs in DNA Sequences An experiment shows that when X is knocked out, 20 other s are not expressed How can one have such drastic effects? Regulatory Proteins Gene X
HARJOITUS- PAKETTI A
Logistiikka A35A00310 Tuotantotalouden perusteet HARJOITUS- PAKETTI A (6 pistettä) TUTA 19 Luento 3.Ennustaminen County General 1 piste The number of heart surgeries performed at County General Hospital
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto If you are searched for a book by Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice over LTE (VoLTE) in pdf form, then you have come
1. Liikkuvat määreet
1. Liikkuvat määreet Väitelauseen perussanajärjestys: SPOTPA (subj. + pred. + obj. + tapa + paikka + aika) Suora sanajärjestys = subjekti on ennen predikaattia tekijä tekeminen Alasääntö 1: Liikkuvat määreet
The Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
Alueellinen yhteistoiminta
Alueellinen yhteistoiminta Kokemuksia alueellisesta toiminnasta Tavoitteet ja hyödyt Perusterveydenhuollon yksikön näkökulmasta Matti Rekiaro Ylilääkäri Perusterveydenhuollon ja terveyden edistämisen yksikkö
How to handle uncertainty in future projections?
How to handle uncertainty in future projections? Samu Mäntyniemi, Fisheries and Environmental Management group (FEM), University of Helsinki http://www.helsinki.fi/science/fem/ Biotieteellinen tiedekunta
Hankkeen toiminnot työsuunnitelman laatiminen
Hankkeen toiminnot työsuunnitelman laatiminen Hanketyöpaja LLP-ohjelman keskitettyjä hankkeita (Leonardo & Poikittaisohjelma) valmisteleville11.11.2011 Työsuunnitelma Vastaa kysymykseen mitä projektissa
Returns to Scale Chapters
Return to Scale Chapter 5.1-5.4 Saara Tuurala 26.9.2007 Index Introduction Baic Formulation of Retur to Scale Geometric Portrayal in DEA BCC Return to Scale CCR Return to Scale Summary Home Aignment Introduction
Land-Use Model for the Helsinki Metropolitan Area
Land-Use Model for the Helsinki Metropolitan Area Paavo Moilanen Introduction & Background Metropolitan Area Council asked 2005: What is good land use for the transport systems plan? At first a literature
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
Tietorakenteet ja algoritmit
Tietorakenteet ja algoritmit Taulukon edut Taulukon haitat Taulukon haittojen välttäminen Dynaamisesti linkattu lista Linkatun listan solmun määrittelytavat Lineaarisen listan toteutus dynaamisesti linkattuna
Eukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? 10.10.01 Tuomo Suortti Ohjelman päällikkö Riina Antikainen Ohjelman koordinaattori 10/11/01 Tilaisuuden teema Kansainvälistymiseen
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Uusi Ajatus Löytyy
7. Product-line architectures
7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software
Graph. COMPUTE x=rv.normal(0,0.04). COMPUTE y=rv.normal(0,0.04). execute.
COMPUTE x=rv.ormal(0,0.04). COMPUTE y=rv.ormal(0,0.04). execute. compute hplib_man_r = hplib_man + x. compute arvokons_man_r = arvokons_man + y. GRAPH /SCATTERPLOT(BIVAR)=hplib_man_r WITH arvokons_man_r
Oma sininen meresi (Finnish Edition)
Oma sininen meresi (Finnish Edition) Hannu Pirilä Click here if your download doesn"t start automatically Oma sininen meresi (Finnish Edition) Hannu Pirilä Oma sininen meresi (Finnish Edition) Hannu Pirilä
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?
Functional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site
Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site Note! Before starting download and install a fresh version of OfficeProfessionalPlus_x64_en-us. The instructions are in the beginning of the exercise.
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Calculation: N117 x 9 x HH141 Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG
LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet
LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50
The role of 3dr sector in rural -community based- tourism - potentials, challenges
The role of 3dr sector in rural -community based- tourism - potentials, challenges Lappeenranta, 5th September 2014 Contents of the presentation 1. SEPRA what is it and why does it exist? 2. Experiences
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
Kvanttilaskenta - 1. tehtävät
Kvanttilaskenta -. tehtävät Johannes Verwijnen January 9, 0 edx-tehtävät Vastauksissa on käytetty edx-kurssin materiaalia.. Problem False, sillä 0 0. Problem False, sillä 0 0 0 0. Problem A quantum state
Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä
M a t t i K a t t a i n e n O T M 1 1. 0 9. 2 0 1 9 Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä Ympäristöoikeustieteen
Metsälamminkankaan tuulivoimapuiston osayleiskaava
VAALAN KUNTA TUULISAIMAA OY Metsälamminkankaan tuulivoimapuiston osayleiskaava Liite 3. Varjostusmallinnus FCG SUUNNITTELU JA TEKNIIKKA OY 12.5.2015 P25370 SHADOW - Main Result Assumptions for shadow calculations
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät
Operatioanalyysi 2011, Harjoitus 2, viikko 38
Operatioanalyysi 2011, Harjoitus 2, viikko 38 H2t1, Exercise 1.1. H2t2, Exercise 1.2. H2t3, Exercise 2.3. H2t4, Exercise 2.4. H2t5, Exercise 2.5. (Exercise 1.1.) 1 1.1. Model the following problem mathematically:
Miehittämätön meriliikenne
Rolls-Royce & Unmanned Shipping Ecosystem Miehittämätön meriliikenne Digimurros 2020+ 17.11. 2016 September 2016 2016 Rolls-Royce plc The 2016 information Rolls-Royce in this plc document is the property
I. Principles of Pointer Year Analysis
I. Principles of Pointer Year Analysis Fig 1. Maximum (red) and minimum (blue) pointer years. 1 Fig 2. Principle of pointer year calculation. Fig 3. Skeleton plot graph created by Kinsys/Kigraph programme.
toukokuu 2011: Lukion kokeiden kehittämistyöryhmien suunnittelukokous
Tuula Sutela toukokuu 2011: Lukion kokeiden kehittämistyöryhmien suunnittelukokous äidinkieli ja kirjallisuus, modersmål och litteratur, kemia, maantiede, matematiikka, englanti käsikirjoitukset vuoden
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
Curriculum. Gym card
A new school year Curriculum Fast Track Final Grading Gym card TET A new school year Work Ethic Detention Own work Organisation and independence Wilma TMU Support Services Well-Being CURRICULUM FAST TRACK
Karkaavatko ylläpitokustannukset miten kustannukset ja tuotot johdetaan hallitusti?
For professional use only Not for public distribution Karkaavatko ylläpitokustannukset miten kustannukset ja tuotot johdetaan hallitusti? 08.02.2012 Jyrki Merjamaa, Head of Asset Management Aberdeen Asset
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
ELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period
1 ELEMET- MOCASTRO Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions Period 20.02-25.05.2012 Diaarinumero Rahoituspäätöksen numero 1114/31/2010 502/10
MEETING PEOPLE COMMUNICATIVE QUESTIONS
Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.
Searching (Sub-)Strings. Ulf Leser
Searching (Sub-)Strings Ulf Leser This Lecture Exact substring search Naïve Boyer-Moore Searching with profiles Sequence profiles Ungapped approximate search Statistical evaluation of search results Ulf
KMTK lentoestetyöpaja - Osa 2
KMTK lentoestetyöpaja - Osa 2 Veijo Pätynen 18.10.2016 Pasila YHTEISTYÖSSÄ: Ilmailun paikkatiedon hallintamalli Ilmailun paikkatiedon hallintamalli (v0.9 4.3.2016) 4.4 Maanmittauslaitoksen rooli ja vastuut...
Viral DNA as a model for coil to globule transition
Viral DNA as a model for coil to globule transition Marina Rossi Lab. of complex fluids and molecular biophysics LITA (Segrate) UNIVERSITA DEGLI STUDI DI MILANO - PhD Workshop October 14 th, 2013 Temperature
Travel Getting Around
- Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
FinFamily Installation and importing data (11.1.2016) FinFamily Asennus / Installation
FinFamily Asennus / Installation 1 Sisällys / Contents FinFamily Asennus / Installation... 1 1. Asennus ja tietojen tuonti / Installation and importing data... 4 1.1. Asenna Java / Install Java... 4 1.2.
Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a
, Tuulivoimahanke Layout 9 x N131 x HH145 Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 km 2 SHADOW - Main Result Assumptions for shadow calculations
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
HOITAJAN ROOLI TEKNOLOGIAVÄLITTEISESSÄ POTILASOHJAUKSESSA VÄITÖSKIRJATUTKIJA JENNI HUHTASALO
HOITAJAN ROOLI TEKNOLOGIAVÄLITTEISESSÄ POTILASOHJAUKSESSA VÄITÖSKIRJATUTKIJA JENNI HUHTASALO Tutkimusintressit Asiantuntijuus ja teknologia: Hoitajan rooli teknologiavälitteisessä potilasohjauksessa Opettajan
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel. Kalle Lehto, Aalto-yliopisto 5.5.
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel Kalle Lehto, Aalto-yliopisto 5.5.2011 Otaniemi ReFuel a three year research project (2009-2011) goal utilize the
Tork Paperipyyhe. etu. tuotteen ominaisuudet. kuvaus. Väri: Valkoinen Malli: Vetopyyhe
etu Monikäyttöpaperi hoitaa useimmat pyyhintätehtävät Sopiva lasipintojen pyyhintään Sopii käsien kuivaamiseen Elintarvikekäyttöön hyväksytty Tork Easy Handling, pakkaus, jota on helppo kantaa mukana,
Pojan Sydan: Loytoretki Isan Rakkauteen (Finnish Edition)
Pojan Sydan: Loytoretki Isan Rakkauteen (Finnish Edition) M. James Jordan Click here if your download doesn"t start automatically Pojan Sydan: Loytoretki Isan Rakkauteen (Finnish Edition) M. James Jordan
Toimintamallit happamuuden ennakoimiseksi ja riskien hallitsemiseksi turvetuotantoalueilla (Sulfa II)
Toimintamallit happamuuden ennakoimiseksi ja riskien hallitsemiseksi turvetuotantoalueilla (Sulfa II) Happamuuskuormituksen ennustaminen valuma-aluetasolla Marie Korppoo ja Markus Huttunen 13.5.2019 Päämäärä
Toppila/Kivistö 10.01.2013 Vastaa kaikkin neljään tehtävään, jotka kukin arvostellaan asteikolla 0-6 pistettä.
..23 Vastaa kaikkin neljään tehtävään, jotka kukin arvostellaan asteikolla -6 pistettä. Tehtävä Ovatko seuraavat väittämät oikein vai väärin? Perustele vastauksesi. (a) Lineaarisen kokonaislukutehtävän
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Mat Seminar on Optimization. Data Envelopment Analysis. Economies of Scope S ysteemianalyysin. Laboratorio. Teknillinen korkeakoulu
Mat-2.4142 Seminar on Optimization Data Envelopment Analysis Economies of Scope 21.11.2007 Economies of Scope Introduced 1982 by Panzar and Willing Support decisions like: Should a firm... Produce a variety
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145
OX2 9 x N131 x HH145 Rakennuskanta Asuinrakennus Lomarakennus Liike- tai julkinen rakennus Teollinen rakennus Kirkko tai kirkollinen rak. Muu rakennus Allas Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 2 km
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
Guidebook for Multicultural TUT Users
1 Guidebook for Multicultural TUT Users WORKPLACE PIRKANMAA-hankkeen KESKUSTELUTILAISUUS 16.12.2010 Hyvää käytäntöä kehittämässä - vuorovaikutusopas kansainvälisille opiskelijoille TTY Teknis-taloudellinen
Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen
Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen Who we are FIN-CLARIN University of Helsinki The Language Bank of Finland CSC - The Center for