Bioteknologian vallankumous

Koko: px
Aloita esitys sivulta:

Download "Bioteknologian vallankumous"

Transkriptio

1 Kääntänyt: Keskustelujatkumo 3: Bioteknologian vallankumous Esittely: Bioteknologian avulla näemme elävän olennon sisimpään, geeneihin, ja pystymme jopa muuttamaan niitä. Mutta missä määrin tutkijoiden pitäisi saada muuttaa ja luoda eläviä olentoja? Mitä rajoituksia pitäisi asettaa alkioiden seulonnalle ja istuttamiselle? Miten bioteknologia vaikuttaa kehittyviin maihin? Missä määrin meillä on oikeus tietää perinnöllisestä alttiudesta sairauksille? Kenen pitäisi maksaa kustannukset tämän geenitiedon hankkimisesta? Oppilaat keskustelevat 8-11hengen ryhmissä kustakin väittämästä ja päättävät, mihin kukin kortti sijoittuu vaihtoehtojen Samaa mieltä ja Eri mieltä välillä. Suuremmissa ryhmissä voidaan keskustella aiheesta vapaasti, tai voit pyytää heitä keskustelemaan muodollisemmissa puitteissa tai pienemmissä ryhmissä. Sisältö: Resurssi sisältää: SAMAA MIELTÄ - ja ERI MIELTÄ -kortit 11 keskustelukorttia, joissa on väittämiä bioteknologiasta ja tarvittaessa lisätietoa 7 infokorttia, joissa on lisätietoa keskustelukorteissa käsitellyistä aiheista

2 Pelin kulku: 1. Pelaajat muodostavat pieniä ryhmiä, korkeintaan 11 ryhmässä. Kullekin ryhmälle annetaan SAMAA MIELTÄ -kortti, ERI MIELTÄ -kortti ja 11 keskustelukorttia. 2. Kukin ryhmä asettaa SAMAA MIELTÄ -kortin ja ERI MIELTÄ -kortin pöydälle tai lattialle n. metrin päähän toisistaan. Ne edustavat jatkumon ääripäitä. Niiden väliin asetetaan pelin kuluessa keskustelukortit. 3. Ensimmäinen pelaaja lukee ensimmäisen keskustelukortin ääneen ryhmälle. Hänen tulee varmistaa, että kaikki ymmärtävät kortin sisällön ja käyttää tarvittaessa infokortteja. 4. Ensimmäinen pelaaja päättää, missä määrin on samaa mieltä ensimmäisen kortin kanssa. Hän asettaa kortin tekstipuoli ylöspäin keskutelujatkumoon, lähemmäksi joko SAMAA MIELTÄ -korttia tai ERI MIELTÄ -korttia. Päätöksen tekee vuorossa oleva pelaaja yksin eikä siitä keskustella ryhmässä. Pelaaja voi perustella päätöksensä jos haluaa. 5. Kukin pelaaja lukee vuorollaan kortin, varmistaa että kaikki ymmärtävät sen ja päättää, mihin kohtaan jatkumoa asettaa sen. 6. Kun kaikki kortit on luettu, ymmärretty ja asetettu jatkumoon, keskustelu alkaa. Tarkoituksena on asettaa kortit jatkumoon järjestyksessä, josta suurin osa pelaajista on samaa mieltä. Kortti kerrallaan valitaan ja keskustellaan siitä, pitäisikö sitä siirtää ja mihin suuntaan. 7. Keskustelun päätteeksi kullakin ryhmällä tulisi olla jatkumo, josta he ovat suurimmaksi osaksi samaa mieltä. 8. Jos ryhmiä on useita, ohjaaja voi vertailla niiden tuloksia. Kunkin ryhmän edustaja voi kertoa, miksi tietyt kortit ovat siinä missä ovat. Keskustelujatkumon laati Ecsite yhdessä Barcelonan tiedepuiston kanssa Xplore Health -projektin yhteydessä. Kiitokset At-Bristolille keskustelujatkumon konseptin kehittämisestä: Käännöksen toimitti Scientix (www.scientix.eu)

3 Samaa mieltä

4 Eri mieltä

5 Keskustelukortit Isompi teksti on väittämä, josta pelaajan tulee olla samaa tai eri mieltä. Kursivoitu teksti on lisätietoa. Infokorteista saadaan vielä tarkempaa tietoa. Uutta teknologiaa ei pitäisi käyttää tai edes kehittää, ennen kuin ollaan sataprosenttisen varmoja, ettei se ole vaaraksi ihmisen terveydelle. Katso infokortti E, varovaisuusperiaate Perheenjäsenilläni on perinnöllinen sairaus, johon ei ole parannuskeinoa. Saatan olla tämän sairauden kantaja, mutta minulla on mielestäni oikeus olla käymättä testissä, koska en halua tietää. Testaamalla on mahdollista saada selville, millaisille sairauksille ihmiset ovat perinnöllisesti alttiita. Asunto- ja muita lainoja myöntävien tahojen tulisi saada nähdä tiedot ihmisten perimästä ne eivät halua myöntää lainaa ihmiselle, joka saattaa sairastua tai kuolla. Testaamalla on mahdollista saada selville, millaisille sairauksille ihmiset ovat perinnöllisesti alttiita.

6 Rahoitusta tulisi vähentää tutkimusprojekteilta, joissa keskitytään länsimaita vaivaaviin sairauksiin (esim. diabetes) ja lisätä projekteille, joissa keskitytään köyhiä maita vaivaaviin sairauksiin (esim. vitamiinipuutokset). Bioteknologiaprojekteja kehitysmaille: kultainen riisi ja malariarokote. Katso infokortti F, distributiivinen oikeudenmukaisuus. It s ethically wrong to breed genetically modified animals to use their organs for human transplantation. The process of introducing a new gene into a living thing to change its properties and those of its offspring is called transgenesis. Transgenesis in pigs, for example, can produce organs to be transplanted to humans. See Info Card C, Xenotransplantation. Ihmisen ja simpanssien tai muiden ihmisapinoiden geenien yhdistämisen tulisi olla laitonta, koska se on askel kohti apinan ja ihmisen risteytymän luomista, mikä on täysin epäeettistä. Katso infokortti C, ksenotransplantaatio

7 Kun hedelmöityshoitoa varten valitaan alkioita, on moraalitonta valita vain täydellisiä alkioita. Näiden alkioiden alttiutta ei-tappaville sairauksille ei tulisi testata, vaan jättää asia luonnon hoidettavaksi. Katso infokortti B, alkioseulonta Jos lapsella on parantumaton sairaus eikä sopivaa solunluovuttajaa ole tarjolla, vanhempien tulisi voida valita alkio, joka kehityttyään voi luovuttaa soluja sisarukselleen. Nk. pelastajasisarus on lapsi, joka syntyy luovuttaakseen elimen tai soluja vanhemmalle sisarukselle, jolla on hengenvaarallinen sairaus, johon paras hoito on kantasolusiirto - esim. syöpä tai Fanconin anemia. Vanhempien ei pitäisi koskaan voida valita, syntyykö heille poika vai tyttö. Katso infokortti B, alkioseulonta.

8 On täysin eettistä tuottaa ihmisen kantasoluja sairauksien hoitoon nk. terapeuttisen kloonauksen avulla. Tämä tutkimustyö voi olla avuksi sairauksien hoitamisessa ja estämisessä, ja sitä tulisi tukea voimakkaasti. See Info Card D: Cloning. Lääkärien tulee kunnioittaa potilaiden yksityisyyttä. Jos jollakulla todetaan perinnöllinen alttius tiettyyn sairauteen, hänellä on oikeus olla kertomatta siitä perheelleen. Bioteknologian avulla ihmisten perimästä voidaan todeta alttiuksia tiettyihin sairauksiin. Koska alttius on perinnöllinen, potilaan lähimmillä perheenjäsenillä on suuri todennäköisyys kantaa samaa alttiutta. Jos pystyttäisiin varmasti toteamaan sen olevan turvallista, tutkijat saisivat luoda kokonaan uuden lajin rakentamalla sen perimän laboratoriossa. Synteettinen biologia on kokonaan uusien biologisten toimintojen ja järjestelmien suunnittelemista ja rakentamista. Katso infokortti G, synteettinen biologia.

9 Infokortti A: Kantasolututkimus Mitä ovat kantasolut? Kantasolut ovat soluja, jotka voivat kehittyä erilaisiksi kehon soluiksi, esim. iho-, lihas- tai verisoluiksi. Ne ovat kehon luontainen soluvaranto ja ovat ainutlaatuisia, koska ne pystyvät uusiutumaan, tuottamaan uusia kantasoluja, ja myös tuottamaan muita, erikoistuneita soluja. Kantasoluja on kahdenlaisia: aikuisten kantasoluja (esim. ihon kantasoluja, jotka tuottavat uusia ihosoluja vanhojen ja vaurioituneiden tilalle) ja alkion kantasoluja. Alkion kantasoluja on viiden päivän ikäisessä alkiossa, joka on noin sadasta solusta koostuva pieni solupallo. Niitä on suuria määriä myös kehittyvässä sikiössä ja napaveressä syntymän hetkellä. Vuonna 2007 tutkijat löysivät tavan, jolla tiettyjä erikoistuneita aikuisen soluja voidaan uudelleenohjelmoida kantasolumaisiksi. Tällaisen kantasolun nimi on indusoitu pluripotentti kantasolu (ipsc). Mitä hyötyä kantasolututkimuksesta voi olla? Kantasolujen avulla voidaan tutkia sitä, miten monimutkainen eliö kehittyy hedelmöittyneestä munasolusta ja kehittää hoitokeinoja vakaviin sairauksiin kuten syöpä ja synnynnäiset vauriot. Kantasoluilla voidaan korvata vaurioituneita soluja ja hoitaa sairauksia tätä ominaisuutta käytetään jo palovammojen hoidossa ja leukemiapotilaiden veren korvaamisessa. Kantasoluilla saatetaan voida korvata solukatoa sellaisissa tällä hetkellä parantumattomissa sairauksissa kuin Parkinsonin tauti, aivoverenvuodot, sydäntauti ja diabetes. Kantasoluilla voidaan ehkä mallintaa sairauksien prosesseja laboratoriossa, jotta sairauksia ymmärretään paremmin. Kantasolujen avulla voidaan testata uusia hoitomuotoja ja vähentää siten eläinkokeita. Alkion kantasolujen tutkimus on useimmissa maissa tiukasti säänneltyä, koska se edellyttää ihmisalkion tuhoamista tai terapeuttista kloonaamista. Nämä ovat molemmat erittäin monimutkaisia ja myös kiisteltyjä toimenpiteitä. EU:ssa ihmisalkion kantasolututkimus on sallittua Ruotsissa, Suomessa, Belgiassa, Kreikassa, Britanniassa, Tanskassa, Espanjassa ja Alankomaissa; laitonta se on Saksassa, Itävallassa, Irlannissa, Italiassa ja Portugalissa. Lähde: EuroStemCell FAQ,

10 Infokortti B: Alkioseulonta Mitä on alkioseulonta? Alkioseulonta eli alkiodiagnostiikka on teknologia, jonka avulla tulevat vanhemmat voivat valita syntymättömälle lapselleen joitakin ominaisuuksia jo ennen kuin raskaus alkaa. Mitä hyötyä on alkioseulonnasta? Sen avulla voidaan välttää perinnöllisen sairauden tai vamman siirtyminen jälkeläiselle ilman raskauden keskeytystä. Alkiot diagnosointia varten tuotetaan perinteisellä koeputkihedelmöitystekniikalla. Miten seulonta tehdään? Alkion ollessa n. kahdeksan solun asteella siitä otetaan yksi tai kaksi solua ja DNA:sta analysoidaan tiettyjä ominaisuuksia. Jos alkiosta ei löydy perinnöllisiä sairauksia tai vaurioita, se voidaan siirtää kohtuun ja raskaus voi alkaa. Millaisia eettisiä kysymyksiä alkioseulontaan liittyy? Seulonnalla voidaan selvittää alkion sukupuoli, joten sitä voidaan käyttää sukupuolen valitsemiseen. Tulevaisuudessa seulonnalla voidaan ehkä valita muitakin perinnöllisiä ominaisuuksia, jotka eivät liity sairauksiin tai vaurioihin. Seulontaan kytkeytyy siis mahdollisuus design-vauvojen luomisesta. Seulonta on kallista, eivätkä sairausvakuutukset tai julkiset terveydenhuoltojärjestelmät aina korvaa kustannuksia. Siksi alkioseulonta kasvattaa kuilua niiden välillä, joilla on varaa maksaa ja niiden välillä, joilla ei ole varaa, vaikka seulonnasta olisi heille hyötyä. Lähde: PlayDecide-peli: Wikipedia:

11 Infokortti C: Ksenotransplantaatio Mitä on ksenotransplantaatio? Ksenotransplantaatio (xenos- kreikan sanasta "vieras") tarkoittaa elävien solujen, kudosten tai elinten siirtämistä lajista toiseen. Se sisältää: Kokonaisten elinten siirtämisen Solunsiirtohoidot Bioartificial Liver Device (BAL), sian maksasoluja käytetään ihmisen maksan toiminnassa. Perinteiset siirteet Ensimmäisistä sydämensiirroista lähtien on ihmiselimiä pidetty parhaina siirteinä. Jokaista luovutettua elintä odottaa viisi potilasta. Elimistä on siis vakava pula, eikä vaihtoehtoisia hoitomuotoja yleensä ole olemassa. Kystistä fibroosia sairastavat kuolevat yleensä ennen 30. ikävuottaan, elleivät saa keuhko- tai sydänkeuhkosiirtoa. Elinpulan ratkaisu Ksenotransplantaatiolla voidaan ratkaista pula siirtoelimistä käyttämällä sian tai kädellisten elimiä, koska ne muistuttavat kooltaan ja rakenteeltaan ihmisen elimiä. Yleensä käytetään sikoja, koska niiden elimet ovat suunnilleen oikean kokoisia ja suhteellisen halpoja, ja niiden käyttämiseen liittyy vähemmän eettisiä ongelmia kuin apinoiden elinten käyttämiseen. Kokonaisten elinten siirtämisen lisäksi tutkitaan parhaillaan sian hermosolujen käyttämistä Parkinsonin taudin ja Huntingtonin taudin hoidossa. Hylkimisreaktio Ksenotransplantaatiossa ongelmana on se, että ihmiskeho tunnistaa uuden elimen ulkopuoliseksi ja reagoi sitä vastaan. Ihmiselinten siirtäminen onnistuu nykyään hyvin, koska immunosuppressiiviset lääkkeet estävät hylkimisreaktiota ja leikkaustekniikat ovat kehittyneet. Estääkseen hylkimisreaktiota ksenotransplantaatiossa tutkijat muuntavat eläinten geenejä: eläimen geeneistä voidaan poistaa molekyyli, jonka perusteella ihmisen immuunijärjestelmä tunnistaa vieraan lajin, ja sikoihin voidaan siirtää ihmisen geenejä. Lähde: Xenotransplantation Decide -peli,

12 Infokortti D: Kloonaus (SCNT) Tumansiirron (SCNT) avulla suoritetulla kloonauksella syntyi Dolly-lammas, ensimmäinen aikuisen solun DNA:sta kloonattu eläin. Tässä toimenpiteessä poistetaan munasolusta tuma ja sen tilalle laitetaan toisen, aikuisesta yksilöstä otetun solun tuma. Dollyn tapauksessa solu otettiin aikuisen lampaan utareesta. Solun tumassa oli luovuttajalampaan DNA:ta. Tuma siirretään munasoluun ja solua stimuloidaan keinotekoisesti käyttäytymään kuten siittiösolun hedelmöittämä munasolu. Solu jakautuu elatusnesteessä alkiorakkulaksi, jolla on noin sata solua. Alkiorakkulan DNA on lähes identtinen luovuttajaeläimen DNA:n kanssa kysessä on siis geneettinen klooni. Tässä vaiheessa voidaan lähteä kahteen suuntaan: Reproduktiivinen (lisääntymistavoitteinen) kloonaus Dolly saatiin aikaan siirtämällä kloonattu alkiorakkula aikuisen lampaan kohtuun, jossa se kehittyi maailman kuuluisimmaksi karitsaksi. Kun kloonaamalla tuotetaan elävä kopio toisesta eläimestä, menetelmän nimi on reproduktiivinen eli lisääntymistavoitteinen kloonaus. Se on onnistunut lampailla, vuohilla, lehmillä, hiirillä, sioilla, kissoilla, kaneilla ja koirilla. Tällainen kloonaus ei liity kantasolututkimukseen. Useimmissa maissa on kiellettyä yrittää ihmisen reproduktiivista kloonaamista. Terapeuttinen (hoitotavoitteinen) kloonaus Terapeuttisessa kloonauksessa alkiorakkulaa ei siirretä kohtuun. Sen sijaan siitä eristetään alkion kantasoluja. Nämä kantasolut vastaavat geneettisesti luovuttajaeliötä, mikä antaa mahdollisuuden perinnöllisten sairauksien tutkimiseen. Kantasoluja voidaan ylläkuvatulla menetelmällä tuottaa esim. diabetesta tai Alzheimerin tautia sairastavan luovuttajan soluista. Kantasoluja voidaan tutkia laboratoriossa ja mahdollisesti ymmärtää paremmin näiden sairauksien syitä ja mekanismeja. Terapeuttisen kloonauksen toinen pitkän tähtäimen tavoite on potilaan solujen kanssa identtisten solujen valmistaminen. Tällaisten solujen siirtäminen potilaaseen ei aiheuttaisi minkäänlaista hylkimisreaktiota. Tähän päivään mennessä ei terapeuttisella kloonauksella ole vielä tuotettu yhtään ihmisen alkiokantasolulinjaa. Tässä esitetyt mahdollisuudet ovat siis vielä kaukana tulevaisuudessa. Lähde: EuroStemCell FAQ,

13 Infokortti E: Varovaisuusperiaate Mikä on varovaisuusperiaate? Varovaisuusperiaatteen mukaan mitään uutta teknologiaa ei pidä käyttää (tai edes kehittää) ennen kuin on saatu riittävästi todisteita sen vaarattomuudesta. Vaikka varovaisuusperiaatetta voitaisiin soveltaa mihin tahansa teknologiaan, siihen on vedottu erityisesti bioteknologiassa. Varovaisuusperiaatteen etuja Periaatteen takana on ajatus, että yhteiskunnalla on velvollisuus suojella jäseniään vaaroilta. Suojatoimia voidaan höllentää vain, jos tieteellisesti osoitetaan, ettei vaaraa ole. Varovaisuusperiaatteen arvostelua Arvostelijoiden mukaan varovaisuusperiaate on epäkäytännöllinen, koska riskejä on aina kun mitä hyvänsä teknologiaa käytetään. Jos periaatetta sovelletaan tiukasti, ei tieteellinen tutkimus voi edetä. Useimmilla teknologioilla on kaksi puolta, eikä väärinkäytön mahdollisuus saa estää teknologian kehittämistä. Tämänhetkinen tietämys ja teknologia perustuu aikaisempien tutkijasukupolvien työhön. Tällä hetkellä tehtävä työ muodostaa pohjan tulevaisuuden tietämykselle. Tutkimuksen kieltäminen hidastaa kehitystä ja voi aiheuttaa ikäviä vaikutuksia tuleville sukupolville. Filosofi Immanuel Kant (1784) totesi tieteellisen kehityksen tarpeellisuuden esseessään Vastaus kysymykseen: Mitä on valistus? : Mikään aikakausi ei voi sitoutua ja vannoa saattavansa seuraavaa sellaiseen tilaan, missä sen olisi mahdotonta kartuttaa (varsinkin tärkeitä) tietoja, puhdistaa niitä väärinkäsityksistä ja ylipäänsä kulkea edelleen valistusta kohti. Se olisi rikos ihmisluontoa vastaan, jonka alkuperäinen kutsumus muodostuu juuri tästä edistymisestä... Esimerkiksi geenimuuntelu ja tumansiirtotekniikka (terapeuttinen kloonaus) ihmisillä ovat kehittyneet rajoitusten takia paljon hitaammin kuin olisivat muuten kehittyneet. Siksi vaikuttaa selvältä, että vaikka kaikkea mitä voidaan tehdä ei suinkaan pidä tehdä, varovaisuusperiaatteeseen vetoaminen voi estää teknologiaa, joka parantaisi tulevien sukupolvien elämänlaatua. Hyötyjen ja riskien väliseen tasapainoon pyrkiminen (suhteellisuusperiaate) on toinen mahdollinen lähestymistapa. Lähde: Xplore Health Background information on biotechnology, Luis Ruiz Avila ja Josep Santaló, osiossa Resources for educators.

14 Infokortti F: Distributiivinen oikeudenmukaisuus Distributiivisella oikeudenmukaisuudella tarkoitetaan terveydenhuollon oikeudenmukaista jakautumista ihmisten kesken. Bioteknologia on korkeateknologinen ala, mikä tarkoittaa, että se on aikaavievää ja kallista ja siten vain rikkaiden maiden ja ihmisten ulottuvilla. Sen johdosta bioteknologiassa jää usein syrjään kiinnostavaakin tutkimusta, ei siksi, että siitä ei olisi hyötyä monille ihmisille, vaan siksi, että se ei tuota paljon rahaa. Tämä on ongelma kehittyville maille, joissa parempaa terveydenhuoltoa kaikkein eniten tarvitaan, mutta bioteknologiasta hyödytään kaikkein vähiten. Esimerkkejä kehittyviä maita hyödyttävästä tutkimuksesta ovat malariarokote ja kultainen riisi. Kultainen riisi Kultainen riisi on Oryza sativa -riisin lajike, joka geenimuuntelun avulla on saatu tuottamaan A- vitamiinin esiastetta, beetakaroteenia. Kultainen riisi kehitettiin avuksi alueille, joilla ihmiset eivät saa ravinnostaan riittävästi A-vitamiinia. Yksityiskohtaista tietoa riisistä julkaistiin ensi kertaa Science-lehdessä vuonna Kultaista riisiä ei tässä vaiheessa käytetä ihmisten ravintona. Kultaisen riisin puolestapuhujat Kultaiseen riisiin johtaneen tutkimuksen tavoitteena oli auttaa A-vitamiinin puutteesta kärsiviä lapsia luvun alussa 124 miljoonaa ihmistä 118:ssa Afrikan ja Kaakkois-Aasian maassa kärsi tästä puutteesta. Se on syynä 1 2 miljoonaan kuolemaan. Geenimuuntelun puolestapuhujien mukaan ei ole todisteita siitä, että geenimuuntelu on ympäristölle vahingollista. Kultaisen riisin vastustajat Vaikka kultainen riisi kehitettiin humanitäärisessä tarkoituksessa, ympäristö- ja globalisaatioaktivistit vastustivat sitä. Osa heistä vastusti kaikkien geenimuunneltujen eliöiden päästämistä ympäristöön ja osa pelkäsi, että kultainen riisi johtaisi laajempaan geenimuuntelun käyttöön. Ei ole todisteita siitä, että geenimuuntelu on ympäristölle turvallista. Lähde: Xplore Health Background information on biotechnology, Luis Ruiz Avila ja Josep Santaló, osiossa Resources for educators. Wikipedia kultaisesta riisistä:

15 Infokortti G: Synteettinen biologia Synteettinen biologia on yksi bioteknologian uusimmista alueista. Se tarkoittaa tutkimusta (ja sitä tekevää teollisuutta), jolla pyritään kehittämään menetelmiä kokonaan uusien biologisten komponenttien, toimintojen ja järjestelmien suunnittelemiseen ja rakentamiseen. Synteettiset biologit tuottavat uusia eliöitä, joilla on toimintoja, joita ei löydy luonnosta. Tärkeimpiä alueita ovat energiantuotanto, biopuhdistus ja terveydenhoito. Kokonaan uuden eliön (bakteerin) luominen edellyttää koko geneettisen koodin suunnittelemista alusta alkaen. Prosessissa yhdistellään geenejä eri eliöistä. Yksi tunnetuimmista synteettisen biologian esimerkeistä on tunnetun biologin Craig Venterin kehittämä kokonaan synteettinen ja täysin toimiva mykoplasmabakteeri, jonka koko DNA tehtiin koneella. Mihin synteettista biologiaa voidaan käyttää? Synteettisen biologian tutkimuksessa pyritään edistämään useita biotekniikan, kemian ja biologian tutkimusaloja. Lopullisena tavoitteena biologisten järjestelmien suunnittelussa ja rakentamisessa on tiedon käsitteleminen, kemikaalien muokkaaminen ja materiaalien ja rakenteiden valmistaminen niin, että pystymme paremmin huolehtimaan ihmisten terveydestä ja ympäristöstä, tuottamaan energiaa uusien biokemikaalien avulla, tuottamaan ruokaa uusilla tavoilla ja tutkimaan elämän syntyä. Biologit käyttävät synteettistä biologiaa myös tämänhetkisen elävien järjestelmien ymmärryksen testaamiseen rakentamalla jostakin järjestelmästä version tämänhetkisen ymmärryksen perusteella. Sairauksien hoito ja ympäristönsuojelu ovat alueita, joilla synteettiseen biologiaan kohdistuu eniten odotuksia; toiveissa on mm. vedyn ja biopolttoaineiden tuottaminen sekä hiilidioksidin ja muiden kasvihuonekaasujen suodattaminen ilmakehästä synteettisten bakteerien avulla. Millaisia eettisiä kysymyksiä synteettiseen biologiaan liittyy? Joidenkin mielestä synteettinen biologia rikkoo luonnonjärjestystä vastaan. Useimmat vastustajat vetoavat varovaisuusperiaatteeseen (ks. infokortti E) ja siihen, että tästä teknologiasta voi seurata ennustamattomia ja hallitsemattomia vaikutuksia. Lähde: Xplore Health Background information on biotechnology, Luis Ruiz Avila ja Josep Santaló, osiossa Resources for educators. Wikipedia:

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki

Lisätiedot

Kantasolututkimuksen etiikasta - uusimmat näkymät. Timo Tuuri HUS, Naistenklinikka Biomedicum kantasolukeskus

Kantasolututkimuksen etiikasta - uusimmat näkymät. Timo Tuuri HUS, Naistenklinikka Biomedicum kantasolukeskus Kantasolututkimuksen etiikasta - uusimmat näkymät Timo Tuuri HUS, Naistenklinikka Biomedicum kantasolukeskus Kantasolut A) Kyky jakautua itsensä kaltaisiksi soluiksi (uusiutumiskyky) B) Kyky erilaistua

Lisätiedot

Luku 20. Biotekniikka

Luku 20. Biotekniikka 1. Harjoittele käsitteitä Biotekniikkaa on tekniikka, jossa käytetään hyväksi fysiikkaa. tekniikka, jossa käytetään hyväksi puuta. tekniikka, jossa käytetään hyväksi eläviä eliöitä. puutarhakasvien siementen

Lisätiedot

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Geenitekniikan perusmenetelmät

Geenitekniikan perusmenetelmät Loppukurssikoe To klo 14-16 2 osiota: monivalintatehtäväosio ja kirjallinen osio, jossa vastataan kahteen kysymykseen viidestä. Koe on auki klo 14.05-16. Voit tehdä sen oppitunnilla, jolloin saat tarvittaessa

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Symbioosi 2 VASTAUKSET

Symbioosi 2 VASTAUKSET Luku 13 Symbioosi 2 VASTAUKSET 1. Termit Vastaus: a= sukusolut b= genotyyppi c= F2-polvi d= F1-polvi e= P-polvi 2. Termien erot a. Fenotyyppi ja genotyyppi Vastaus: fenotyyppi on yksilön ilmiasu, genotyyppi

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

Biopankkeja koskeva lainsäädäntö

Biopankkeja koskeva lainsäädäntö 1 Biopankkeja koskeva lainsäädäntö Biomedicum 20.9.2004 Mervi Kattelus mervi.kattelus@stm.fi 2 Mikä on biopankki? Ei ole määritelty Suomen lainsäädännössä Suppea määritelmä: kudosnäytekokoelma Laaja määritelmä:

Lisätiedot

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 12 X-kromosominen periytyminen TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 FOLKHÄLSANS GENETISKA KLINIK PB 211, (Topeliusgatan 20) 00251 Helsingfors tel (09)

Lisätiedot

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia

Lisätiedot

Autoimmuunitaudit: osa 1

Autoimmuunitaudit: osa 1 Autoimmuunitaudit: osa 1 Autoimmuunitaute tunnetaan yli 80. Ne ovat kroonisia sairauksia, joiden syntymekanismia eli patogeneesiä ei useimmissa tapauksissa ymmärretä. Tautien esiintyvyys vaihtelee maanosien,

Lisätiedot

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu?

Potilasopas. 12 Mitä Genetiikan Laboratoriossa Tapahtuu? 12 Mitä Genetiikan Laboratoriossa Tapahtuu? ei halua, että hänen näytettään käytetään näihin tarkoituksiin. Kuten muutkin lääketieteelliset näytteet, DNA katsotaan osaksi potilaan potilasasiakirjoja, joten

Lisätiedot

Peli tulee tulostaa A4-kokoiselle paperille tai pahville. Parhaan tulostuksen saat, kun käytät 160 g/m paperia.

Peli tulee tulostaa A4-kokoiselle paperille tai pahville. Parhaan tulostuksen saat, kun käytät 160 g/m paperia. Kiitos tämän Decide-pelipaketin lataamisesta! Jokainen pelipaketti sisältää kaiken tarvittavan Decide-pelin pelaamiseen. Yksittäistä peliä voi pelata jopa 8 pelaajaa. Jos pelaajia on enemmän, tulostakaa

Lisätiedot

Positiivisten asioiden korostaminen. Hilla Levo, dosentti, KNK-erikoislääkäri

Positiivisten asioiden korostaminen. Hilla Levo, dosentti, KNK-erikoislääkäri Positiivisten asioiden korostaminen Hilla Levo, dosentti, KNK-erikoislääkäri Krooninen sairaus - Pitkäaikainen sairaus = muuttunut terveydentila, mikä ei korjaannu yksinkertaisella kirurgisella toimenpiteellä

Lisätiedot

Ureakierron häiriöt ja rgaanishappovirtsaisuudet Lapsille

Ureakierron häiriöt ja rgaanishappovirtsaisuudet Lapsille Ureakierron häiriöt ja rgaanishappovirtsaisuudet Lapsille www.e-imd.org Mikä on ureakierron häiriö/orgaanishappovirtsaisuus? Kehomme hajottaa syömämme ruoan tuhansien kemiallisten reaktioiden avulla ja

Lisätiedot

Modernin bioteknologian sääntelyn erityiskysymyksiä

Modernin bioteknologian sääntelyn erityiskysymyksiä Modernin bioteknologian sääntelyn erityiskysymyksiä Laura Walin OTT, FT Laura Walin 2.10.2012 Luentorunko 1. Sääntelyn kohde ja sääntelyinstrumentit 2. Case: Alkiotutkimus 3. Case: Biopankit 4. Bio-oikeus

Lisätiedot

Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Geenitutkimuksista. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Geenitutkimuksista Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; Huhtikuussa 2008 Tätä työtä

Lisätiedot

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,

Lisätiedot

EUROOPAN YHTEISÖJEN KOMISSIO. Ehdotus: NEUVOSTON ASETUS

EUROOPAN YHTEISÖJEN KOMISSIO. Ehdotus: NEUVOSTON ASETUS EUROOPAN YHTEISÖJEN KOMISSIO Bryssel 16.10.2002 KOM(2002) 561 lopullinen Ehdotus: NEUVOSTON ASETUS maataloustuotteiden luonnonmukaisesta tuotantotavasta ja siihen viittaavista merkinnöistä maataloustuotteissa

Lisätiedot

Erivedge -valmisteen raskaudenehkäisyohjelma

Erivedge -valmisteen raskaudenehkäisyohjelma Erivedge -valmisteen raskaudenehkäisyohjelma Tärkeää tietoa Erivedge -valmistetta käyttäville mies- ja naispotilaille raskauden ehkäisemisestä ja ehkäisystä. 1 2 Sisältö 1. Johdanto 1.1. Mitä Erivedge

Lisätiedot

KEESHONDIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,

Lisätiedot

Biopankkilain valmistelun lyhyt historia

Biopankkilain valmistelun lyhyt historia Biopankkilain valmistelun lyhyt historia Puheenjohtaja Kimmo Pitkänen Biotekniikan neuvottelukunta Tutkijoiden ja kansanedustajien seura - TUTKAS Biotekniikan neuvottelukunta BIOPANKKIEN MERKITYS KANSALAISILLE

Lisätiedot

Peli tulee tulostaa A4-kokoiselle paperille tai pahville. Parhaan tulostuksen saat, kun käytät 160 g/m paperia.

Peli tulee tulostaa A4-kokoiselle paperille tai pahville. Parhaan tulostuksen saat, kun käytät 160 g/m paperia. Kiitos tämän Decide-pelipaketin lataamisesta! Jokainen pelipaketti sisältää kaiken tarvittavan Decide-pelin pelaamiseen. Yksittäistä peliä voi pelata jopa 8 pelaajaa. Jos pelaajia on enemmän, tulostakaa

Lisätiedot

Ihmisen kantasolut, kloonaus ja tutkimus

Ihmisen kantasolut, kloonaus ja tutkimus e Ihmisen kantasolut, kloonaus ja tutkimus e Tutkimuseettinen neuvottelukunta TENK Valtakunnallinen terveydenhuollon eettinen neuvottelukunta ETENE ETENE:n lääketieteellinen tutkimuseettinen jaosto TUKIJA

Lisätiedot

Bioteknologian perustyökaluja

Bioteknologian perustyökaluja Bioteknologian perustyökaluja DNAn ja RNAn eristäminen helppoa. Puhdistaminen työlästä (DNA pestään lukuisilla liuottimilla). Myös lähetti-rnat voidaan eristää ja muuntaa virusten käänteiskopioijaentsyymin

Lisätiedot

LUONTOA VOI SUOJELLA SYÖMÄLLÄ

LUONTOA VOI SUOJELLA SYÖMÄLLÄ LUONTOA VOI SUOJELLA SYÖMÄLLÄ Syöminen vaikuttaa ympäristöön. Ruoan tuottamiseen tarvitaan valtavasti peltoja, vettä, ravinteita ja energiaa. Peltoja on jo niin paljon, että niiden määrää on vaikeaa lisätä,

Lisätiedot

Mitä teollinen biotekniikka oikein on?

Mitä teollinen biotekniikka oikein on? 1 Mitä teollinen biotekniikka oikein on? Seminaari 17.8.2006 Biotekniikan neuvottelukunta 2 Bioteknologia! Bioteknologia on eliöiden, solujen, solujen osien tai solussa esiintyvien molekyylien toimintojen

Lisätiedot

Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016

Lisätiedot

BIOLÄÄKETIETEEN LÄPIMURROT

BIOLÄÄKETIETEEN LÄPIMURROT BIOLÄÄKETIETEEN LÄPIMURROT Jussi Huttunen Tampere 20.4.2016 LÄÄKETIETEEN MEGATRENDIT Väestö vanhenee ja sairauskirjo muuttuu Teknologia kehittyy - HOITOTEKNOLOGIA - tietoteknologia Hoito yksilöllistyy

Lisätiedot

THL/294/5.09.00/2013 Tiedonkeruun tietosisältö 1(8) 21.2.2013

THL/294/5.09.00/2013 Tiedonkeruun tietosisältö 1(8) 21.2.2013 Tiedonkeruun tietosisältö 1(8) Hedelmöityshoitotilastoinnin tiedonkeruun tietosisältö Terveyden ja hyvinvoinnin laitos (THL) kerää valtakunnalliset tiedot annetuista hedelmöityshoidoista sähköisellä tiedonkeruulomakkeella,

Lisätiedot

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus

Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kuka omistaa genomitiedon - työpaja 12.09.2014 Genomitiedon hyödyntäminen yksilötasolla ja tiedon omistajuus Kristiina Aittomäki, prof., ylilääkäri HUSLAB, Helsingin yliopisto Genomistrategia työryhmä

Lisätiedot

TALTIONI BIOPANKKITALLETTAJAN VERKKOPANKKI

TALTIONI BIOPANKKITALLETTAJAN VERKKOPANKKI TALTIONI BIOPANKKITALLETTAJAN VERKKOPANKKI Biopankkitoiminnan tavoitteet ja periaatteet Edistää lääketieteellistä tutkimusta ja tuotekehitystä sekä toimia henkilökohtaisen lääketieteen veturina Turvata

Lisätiedot

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet?

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Harvinaiset-seminaari TYKS 29.9.2011 Jaakko Ignatius TYKS, Perinnöllisyyspoliklinikka Miksi Harvinaiset-seminaarissa puhutaan

Lisätiedot

Evoluutiopuu. Aluksi. Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot. Luokkataso: 6.-9. luokka, lukio

Evoluutiopuu. Aluksi. Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot. Luokkataso: 6.-9. luokka, lukio Evoluutiopuu Avainsanat: biomatematiikka, päättely, kombinatoriikka, verkot Luokkataso: 6.-9. luokka, lukio Välineet: loogiset palat, paperia, kyniä Kuvaus: Tehtävässä tutkitaan bakteerien evoluutiota.

Lisätiedot

PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa. Jyrki Lötjönen, johtava tutkija VTT

PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa. Jyrki Lötjönen, johtava tutkija VTT PredictAD-hanke Kohti tehokkaampaa diagnostiikkaa Alzheimerin taudissa Jyrki Lötjönen, johtava tutkija VTT 2 Alzheimerin taudin diagnostiikka Alzheimerin tauti on etenevä muistisairaus. Alzheimerin tauti

Lisätiedot

STUK. Sirpa Heinävaara TUTKIMUSHANKKEET - KÄYNNISSÄ OLEVAT KANSAINVÄLISET HANKKEET. tutkija/tilastotieteilijä

STUK. Sirpa Heinävaara TUTKIMUSHANKKEET - KÄYNNISSÄ OLEVAT KANSAINVÄLISET HANKKEET. tutkija/tilastotieteilijä KÄYNNISSÄ OLEVAT TUTKIMUSHANKKEET - KANSAINVÄLISET HANKKEET Sirpa Heinävaara tutkija/tilastotieteilijä STUK RADIATION AND NUCLEAR SAFETY AUTHORITY Tutkimusten lähtökohtia Matkapuhelinsäteilyn ja aivokasvainten

Lisätiedot

Tiedätkö, mitä ovat lasten ihmisoikeudet? Selkokielinen esite

Tiedätkö, mitä ovat lasten ihmisoikeudet? Selkokielinen esite LAPSIASIAVALTUUTETTU Tiedätkö, mitä ovat lasten ihmisoikeudet? Selkokielinen esite Ihmisoikeudet kuuluvat kaikille. Ne kuuluvat myös kaikille lapsille. Lapsia ovat alle 18-vuotiaat. Mitä YK:n lapsen oikeuksien

Lisätiedot

Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta

Lisätiedot

Terveyteen liittyvät geenitestit

Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Terveyteen liittyvät geenitestit Jokaisella meistä on vanhemmiltamme perittynä oma yksilöllinen geenivalikoimamme. Tämä geneettinen rakenteemme yhdessä erilaisten ympäristön

Lisätiedot

Jyviä ja akanoita Milloin seulonta lisää terveyttä? Prof. Marjukka Mäkelä FinOHTA/Stakes

Jyviä ja akanoita Milloin seulonta lisää terveyttä? Prof. Marjukka Mäkelä FinOHTA/Stakes Jyviä ja akanoita Milloin seulonta lisää terveyttä? Prof. Marjukka Mäkelä FinOHTA/Stakes Jyviä ja akanoita Leikkuupuimuri seuloo jyvät mukaan ja akanat pois. Terveydenhuollon seulonnoissa halutaan löytää

Lisätiedot

Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa

Lisätiedot

Diabetes (sokeritauti)

Diabetes (sokeritauti) Diabetes (sokeritauti) Lääkärikirja Duodecim Pertti Mustajoki, sisätautien erikoislääkäri Diabeteksessa eli sokeritaudissa veren sokerimäärä on liian korkea. Lääkäri tai hoitaja mittaa verensokerin verinäytteestä

Lisätiedot

Lomakausi lähestyy joko sinulla on eurooppalainen sairaanhoitokortti?

Lomakausi lähestyy joko sinulla on eurooppalainen sairaanhoitokortti? MEMO/11/406 Bryssel 16. kesäkuuta 2011 Lomakausi lähestyy joko sinulla on eurooppalainen sairaanhoitokortti? Kun olet lomalla varaudu yllättäviin tilanteisiin! Oletko aikeissa matkustaa toiseen EU-maahan,

Lisätiedot

Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä

Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä Huippuyksikköseminaari 12.11.2013 Leena Vähäkylä Menestystarinat Akatemian viestinnässä Akatemian pitkäjänteinen rahoitus laadukkaaseen tutkimukseen näkyy rahoitettujen ja menestyneiden tutkijoiden tutkijanurasta

Lisätiedot

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2)

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2) 5.7 Biologia Biologia tutkii elämää ja sen edellytyksiä. Opetus syventää aikuisopiskelijan luonnontuntemusta ja auttaa ymmärtämään luonnon perusilmiöitä. Biologian opiskelu kehittää opiskelijan luonnontieteellistä

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

Tutkimus terveydestä, työkyvystä ja lääkehoidosta. Tutkimuksen keskeisimmät löydökset Lehdistömateriaalit

Tutkimus terveydestä, työkyvystä ja lääkehoidosta. Tutkimuksen keskeisimmät löydökset Lehdistömateriaalit Tutkimus terveydestä, työkyvystä ja lääkehoidosta Tutkimuksen keskeisimmät löydökset Lehdistömateriaalit Tutkimuksen taustaa Aula Research Oy toteutti Lääketeollisuus ry:n toimeksiannosta tutkimuksen suomalaisten

Lisätiedot

Pramipexol Stada. 18.10.2013, Versio V01 RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO

Pramipexol Stada. 18.10.2013, Versio V01 RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO Pramipexol Stada 18.10.2013, Versio V01 RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO VI.2 Julkisen yhteenvedon osiot Pramipexol STADA 0,088 mg tabletti Pramipexol STADA 0,18 mg tabletti Pramipexol STADA

Lisätiedot

Ennakoivat Geenitutkimukset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Ennakoivat Geenitutkimukset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com Ennakoivat Geenitutkimukset Tämän potilasoppaan on kehittänyt The Genetic Interest Group. Kääntänyt Tiina Lund-Aho. Toukokuussa 2009 Tätä työtä tuki EuroGentest, joka on Euroopan yhteisön tutkimuksen kuudennen

Lisätiedot

Kananmuna sisältää muun muassa D-vitamiina ja runsaasti proteiinia

Kananmuna sisältää muun muassa D-vitamiina ja runsaasti proteiinia Jogurtti luomuhillolla on parempi vaihtoehto kuin puuro tai aamumurot. Tutkijat ovat yhä enenevästi havainneet, mitä näiden viljojen gluteeni aiheuttaa terveydellemme. Gluteeni on syyllinen yli 150 eri

Lisätiedot

Fimea kehittää, arvioi ja informoi

Fimea kehittää, arvioi ja informoi Fimea kehittää, arvioi ja informoi SELKOTIIVISTELMÄ JULKAISUSARJA 4/2012 Eteisvärinän hoito Verenohennuslääke dabigatraanin ja varfariinin vertailu Eteisvärinä on sydämen rytmihäiriö, joka voi aiheuttaa

Lisätiedot

DNA:n informaation kulku, koostumus

DNA:n informaation kulku, koostumus DNA:n informaation kulku, koostumus KOOSTUMUS Elävien bio-organismien koostumus. Vety, hiili, happi ja typpi muodostavat yli 99% orgaanisten molekyylien rakenneosista. Biomolekyylit voidaan pääosin jakaa

Lisätiedot

Perinnöllisyyden perusteita

Perinnöllisyyden perusteita Perinnöllisyyden perusteita Perinnöllisyystieteen isä on augustinolaismunkki Gregor Johann Mendel (1822-1884). Mendel kasvatti herneitä Brnon (nykyisessä Tsekissä) luostarin pihalla. 1866 julkaisu tuloksista

Lisätiedot

5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin

Lisätiedot

NIPT NON-INVASIVE-PRENATAL TESTING

NIPT NON-INVASIVE-PRENATAL TESTING NIPT NON-INVASIVE-PRENATAL TESTING NIPT perustuu äidin veressä olevan sikiöperäisen soluvapaan DNA:n tutkimiseen ja seulonta kattaa sikiön 21-trisomian (Downin syndrooma), 18-trisomian, 13-trisomian

Lisätiedot

Tuotantoeläinten kloonaaminen

Tuotantoeläinten kloonaaminen Tuotantoeläinten kloonaaminen Tuotantoeläinten kloonaaminen Biotekniikan neuvottelukunnan julkaisuja 2008 Tuotantoeläinten kloonaaminen Biotekniikan neuvottelukunnan julkaisuja Kirjoittajat: Leena Mannonen,

Lisätiedot

Geeniteknologia mahdollisuuksia ja uhkia

Geeniteknologia mahdollisuuksia ja uhkia 1 Jaana Hallamaa Geeniteknologia mahdollisuuksia ja uhkia Ihminen on osa luontoa ja hänen elämänsä riippuu kokonaan siitä. Toisin kuin muut eläimet ihminen osaa kuitenkin muokata luontoa ja käyttää sitä

Lisätiedot

Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta

Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Tiedonjyväsiä cavalierien geenitestauksista imuroituna maailmalta Genetiikan tutkijat Englannin Kennel Clubin ja AHT:n kanssa yhteistyössä ovat laatineet seuraavanlaisen artikkelin Episodic Fallingista

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

Tyypin 2 diabetes - mitä se on?

Tyypin 2 diabetes - mitä se on? - mitä se on? sokeriaineenvaihdunnan häiriö usein osa metabolista oireyhtymää vahvasti perinnöllinen kehittyy hitaasti ja vähin oirein keski-ikäisten ja sitä vanhempien sairaus? elintavoilla hoidettava

Lisätiedot

Sustainable well-being

Sustainable well-being Mitä kuluttajat ajattelevat geenitesteistä? Biopankit osaksi hoito- ja elintapasuosituksia Sustainable well-being Subtitle Name Date 0.0.2015 Tuula Tiihonen, Johtava asiantuntija, Sitra, Hyvinvoinnin palveluoperaattori

Lisätiedot

Oikeudenmukaisuus terveyspolitiikassa ja terveydenhuollossa Suomen sosiaalifoorumi Tampere 18.5.2008

Oikeudenmukaisuus terveyspolitiikassa ja terveydenhuollossa Suomen sosiaalifoorumi Tampere 18.5.2008 Tiedosta hyvinvointia 1 Oikeudenmukaisuus terveyspolitiikassa ja terveydenhuollossa Suomen sosiaalifoorumi Tampere 18.5.2008 Marita Sihto Stakes Tiedosta hyvinvointia 2 Esityksen sisältö! Terveyspolitiikan

Lisätiedot

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna Ihmisen keho muodostuu miljardeista soluista. Vaikka nämä solut ovat tietyssä mielessä meidän omiamme, ne polveutuvat itsenäisistä yksisoluisista elämänmuodoista, jotka ovat säilyttäneet monia itsenäisen

Lisätiedot

Enemmän kuin pintaa - harjoitteluita ja opinnäytteitä Psoriasisliittossa. SoveLi-messut 11.3.2011

Enemmän kuin pintaa - harjoitteluita ja opinnäytteitä Psoriasisliittossa. SoveLi-messut 11.3.2011 Enemmän kuin pintaa - harjoitteluita ja opinnäytteitä Psoriasisliittossa SoveLi-messut 11.3.2011 Psoriasis on tulehduksellinen, pitkäaikainen iho ja tai nivelsairaus, jota sairastaa n. 2,5 3 % väestöstä

Lisätiedot

Innovatiivinen lääketeollisuus - terveydenhoidon kehityksen työkalu ja kasvua tuottavaa elinkeinoa.

Innovatiivinen lääketeollisuus - terveydenhoidon kehityksen työkalu ja kasvua tuottavaa elinkeinoa. Innovatiivinen lääketeollisuus - terveydenhoidon kehityksen työkalu ja kasvua tuottavaa elinkeinoa. 27.9.2014 Farmasialiitto, ajankohtaista lääketeollisuudesta Jussi Merikallio, Lääketeollisuus Lääketeollisuuden

Lisätiedot

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä

Euromit2014-konferenssin tausta-aineistoa Tuottaja Tampereen yliopiston viestintä Mitkä mitokondriot? Lyhyt johdatus geenitutkijoiden maailmaan Ihmisen kasvua ja kehitystä ohjaava informaatio on solun tumassa, DNA:ssa, josta se erilaisten prosessien kautta päätyy ohjaamaan elimistön,

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se

Lisätiedot

Miten lapsettomuutta hoidetaan? Hoitovaihtoehdoista Lapsettomuushoitojen arkipäivän kysymyksiä 24.5.2013

Miten lapsettomuutta hoidetaan? Hoitovaihtoehdoista Lapsettomuushoitojen arkipäivän kysymyksiä 24.5.2013 Miten lapsettomuutta hoidetaan? Hoitovaihtoehdoista Lapsettomuushoitojen arkipäivän kysymyksiä 24.5.2013 Milloin tutkimuksiin? Perustutkimukset kun raskautta on yritetty vuosi Kun asia alkaa askarruttaa

Lisätiedot

LASTEN OIKEUDET. Setan Transtukipiste. Oikeudesta olla prinssi tai prinsessa tai miettiä vielä

LASTEN OIKEUDET. Setan Transtukipiste. Oikeudesta olla prinssi tai prinsessa tai miettiä vielä LASTEN OIKEUDET Setan Transtukipiste Oikeudesta olla prinssi tai prinsessa tai miettiä vielä >> SUKUPUOLEN MONINAISUUS ON JOIDENKIN LASTEN OMINAISUUS Joskus lapsi haluaa olla välillä poika ja välillä tyttö.

Lisätiedot

TERVEYSHISTORIA - LYHYT JOHDATUS. Heini Hakosalo FT, akatemiatutkija aate- ja oppihistoria Oulun yliopisto

TERVEYSHISTORIA - LYHYT JOHDATUS. Heini Hakosalo FT, akatemiatutkija aate- ja oppihistoria Oulun yliopisto TERVEYSHISTORIA - LYHYT JOHDATUS Heini Hakosalo FT, akatemiatutkija aate- ja oppihistoria Oulun yliopisto TERVEYSHISTORIA MITÄ SE ON? "HISTORY OF MEDICINE & HEALTH" SAIRAUKSIEN JA NIIDEN HALLINNAN HISTORIAA

Lisätiedot

Fidan projektikylän etuudet

Fidan projektikylän etuudet Säännöt Pelin tavoitteena on, että ainakin yksi kylän lapsista saa käydä koulun loppuun. Peli aloitetaan seisten. Kyläläinen, joka kuolee tai joutuu poistumaan koulusta tai kylästä, istuu alas. Jos vähintään

Lisätiedot

Unelmien työ (90 min)

Unelmien työ (90 min) Unelmien työ (90 ) Oppitunti on mahdollista toteuttaa myös 45 uutissa. Tällöin toteutetaan kohdat 1, 2 ja 3 (lyhennettyinä) sekä Unelmien työpaikan yksilötyöskentelyosuus (15 ). Voit soveltaa tehtävän

Lisätiedot

29.1.2014 Dnro 420/20.01.08/2014

29.1.2014 Dnro 420/20.01.08/2014 Vuosikertomusohje 1 (2) Kudoslaitokset Sosiaali- ja terveysalan lupa- ja valvontavirasto (Valvira) Kudoslaitosten vuosikertomukset vuodesta 2013 Kudoslaitosten on toimitettava Lääkealan turvallisuus- ja

Lisätiedot

Tehty yhteistyönä tri Jan Torssanderin kanssa. Läkarhuset Björkhagen, Ruotsi.

Tehty yhteistyönä tri Jan Torssanderin kanssa. Läkarhuset Björkhagen, Ruotsi. idslofi04.12/06.2 Tehty yhteistyönä tri Jan Torssanderin kanssa. Läkarhuset Björkhagen, Ruotsi. Galderma Nordic AB. Box 15028, S-167 15 Bromma. Sweden Tel +46 8 564 355 40, Fax +46 8 564 355 49. www.galdermanordic.com

Lisätiedot

Kaikki eläimet täyttävät alla olevat seitsemän elämälle välttämätöntä ehtoa: 2. Hengittäminen Voi ottaa sisään ja poistaa kehostaan kaasuja

Kaikki eläimet täyttävät alla olevat seitsemän elämälle välttämätöntä ehtoa: 2. Hengittäminen Voi ottaa sisään ja poistaa kehostaan kaasuja Ravintoketjut Elämän ehdot Kaikki eläimet täyttävät alla olevat seitsemän elämälle välttämätöntä ehtoa: 1. Liikkuminen Pystyy liikuttelemaan kehoaan 2. Hengittäminen Voi ottaa sisään ja poistaa kehostaan

Lisätiedot

Suomalaiset ja kenkien eettisyys. Mielipidetutkimus suomalaisten tiedoista ja odotuksista koskien kenkien tuotannon eettisyyttä ja EU:ta

Suomalaiset ja kenkien eettisyys. Mielipidetutkimus suomalaisten tiedoista ja odotuksista koskien kenkien tuotannon eettisyyttä ja EU:ta Suomalaiset ja kenkien eettisyys Mielipidetutkimus suomalaisten tiedoista ja odotuksista koskien kenkien tuotannon eettisyyttä ja EU:ta Johdanto Suomalaiset ostavat 21 miljoonaa paria kenkiä vuosittain.

Lisätiedot

KOMISSION KERTOMUS EUROOPAN PARLAMENTILLE, NEUVOSTOLLE, TALOUS- JA SOSIAALIKOMITEALLE JA ALUEIDEN KOMITEALLE

KOMISSION KERTOMUS EUROOPAN PARLAMENTILLE, NEUVOSTOLLE, TALOUS- JA SOSIAALIKOMITEALLE JA ALUEIDEN KOMITEALLE EUROOPAN KOMISSIO Bryssel 17.6.011 KOM(011) 35 lopullinen KOMISSION KERTOMUS EUROOPAN PARLAMENTILLE, NEUVOSTOLLE, TALOUS- JA SOSIAALIKOMITEALLE JA ALUEIDEN KOMITEALLE Toinen kertomus vapaaehtoisista maksuttomista

Lisätiedot

SISÄLTÖ. Keho ja seksuaalisuus Tunteet ja seksuaalisuus Tytöksi ja pojaksi Isä ja lapset Äiti ja lapset Mallioppiminen

SISÄLTÖ. Keho ja seksuaalisuus Tunteet ja seksuaalisuus Tytöksi ja pojaksi Isä ja lapset Äiti ja lapset Mallioppiminen Seksuaalisuus SISÄLTÖ Keho ja seksuaalisuus Tunteet ja seksuaalisuus Tytöksi ja pojaksi Isä ja lapset Äiti ja lapset Mallioppiminen Lapsen kysymykset Lapsen häiritty seksuaalisuus Suojele lasta ja nuorta

Lisätiedot

Seulontavaihtoehdot ja riskit

Seulontavaihtoehdot ja riskit Seulontavaihtoehdot ja riskit Hannele Laivuori HUSLAB Perinnöllisyyslääketieteen yksikkö Jaakko Ignatius TYKS, Perinnöllisyyslääketiede Finohta / Sikiöseulontojen yhtenäistäminen / Hannele Laivuori ja

Lisätiedot

1.000.000.000.000 euron ongelma yksi ratkaisu Suomesta? Sijoitus Invest 2015, Helsinki 11.11.2015 Pekka Simula, toimitusjohtaja, Herantis Pharma Oyj

1.000.000.000.000 euron ongelma yksi ratkaisu Suomesta? Sijoitus Invest 2015, Helsinki 11.11.2015 Pekka Simula, toimitusjohtaja, Herantis Pharma Oyj 1.000.000.000.000 euron ongelma yksi ratkaisu Suomesta? Sijoitus Invest 2015, Helsinki 11.11.2015 Pekka Simula, toimitusjohtaja, Herantis Pharma Oyj 1 Tärkeää tietoa Herantis Pharma Oy ( Yhtiö ) on laatinut

Lisätiedot

TUBERKULOOSI. Oireet: kestävä ja limainen yskös, laihtuminen, suurentuneet imusolmukkeet ja ruokahaluttomuus

TUBERKULOOSI. Oireet: kestävä ja limainen yskös, laihtuminen, suurentuneet imusolmukkeet ja ruokahaluttomuus TUBERKULOOSI On Mycobacterium tuberculosis bakteerin aiheuttama infektio. Oireet: kestävä ja limainen yskös, laihtuminen, suurentuneet imusolmukkeet ja ruokahaluttomuus Hoitona käytetään usean lääkkeen

Lisätiedot

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän

Lisätiedot

Lapsivesitutkimus. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Lapsivesitutkimus. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Lapsivesitutkimus Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy s and St Thomas Hospital, London, United Kingdom; the Royal College of Obstetricians

Lisätiedot

LUONNON TUOTTEET & EKOKOSMETIIKKA PALVELUYRITTÄJÄN NÄKÖKULMASTA 20.3.2014

LUONNON TUOTTEET & EKOKOSMETIIKKA PALVELUYRITTÄJÄN NÄKÖKULMASTA 20.3.2014 LUONNON TUOTTEET & EKOKOSMETIIKKA PALVELUYRITTÄJÄN NÄKÖKULMASTA 20.3.2014 Kirsti Järvensivu, EKOHOITOLA VITAROSA Ekokosmetologi, dipl. refleksologi ja- fytoterapeutti EKOHOITOLA VITAROSA LUONNOLLISTA KAUNEUTTA

Lisätiedot

Istukkanäytetutkimus. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Istukkanäytetutkimus. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Istukkanäytetutkimus Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy s and St Thomas Hospital, London, United Kingdom; the Royal College of Obstetricians

Lisätiedot

Suomalaisen maatiaiskanan säilytysohjelman koulutuspäivä, Riihimäki, 25.10.2014 Pasi Hellstén

Suomalaisen maatiaiskanan säilytysohjelman koulutuspäivä, Riihimäki, 25.10.2014 Pasi Hellstén Suomalaisen maatiaiskanan säilytysohjelman koulutuspäivä, Riihimäki, 25.10.2014 Pasi Hellstén Sisäsiittoisuudella tarkoitetaan perinnöllisyystieteessä lisääntymistä, jossa pariutuvat yksilöt ovat enemmän

Lisätiedot

LAPSET JA BIOPANKIT. Valvira 25.11.2014. Jari Petäjä

LAPSET JA BIOPANKIT. Valvira 25.11.2014. Jari Petäjä LAPSET JA BIOPANKIT Valvira 25.11.2014 Jari Petäjä 1 Lasten elämänkaari sairaanhoidon näkökulmasta Aikuisten hoito kasvu ja kehitys perhe ja vanhemmuus raha, taudit potilaan hoitomyöntyvyys 0 ikä 16 25

Lisätiedot

Paksusuolisyövän seulontatulokset Suomessa. Nea Malila Suomen Syöpärekisteri

Paksusuolisyövän seulontatulokset Suomessa. Nea Malila Suomen Syöpärekisteri Paksusuolisyövän seulontatulokset Suomessa Suomen Syöpärekisteri Sidonnaisuudet kahden viimeisen vuoden ajalta LT, dosentti Päätoimi Suomen Syöpärekisterin johtaja, Suomen Syöpäyhdistys ry Sivutoimet syöpäepidemiologian

Lisätiedot

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008

Kromosomimuutokset. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com. Huhtikuussa 2008 16 Kromosomimuutokset Huhtikuussa 2008 Tätä työtä tuki EuroGentest, joka on Euroopan yhteisön tutkimuksen kuudennen puiteohjelman rahoittama verkosto. Kääntänyt Tiina Lund-Aho yhteistyössä Väestöliiton

Lisätiedot

Pitkälle kehittyneet terapiatuotteet. Paula Salmikangas Lääkelaitos

Pitkälle kehittyneet terapiatuotteet. Paula Salmikangas Lääkelaitos Pitkälle kehittyneet terapiatuotteet Paula Salmikangas Lääkelaitos Pitkälle kehittyneet terapiatuotteet (Advanced Therapy Medicinal Products) geeniterapiatuotteet soluterapiatuotteet kudosmuokkaustuotteet

Lisätiedot

Paremman elämän puolesta

Paremman elämän puolesta Paremman elämän puolesta MSD toimii paremman elämän puolesta, suomalaisen potilaan parhaaksi. Meille on tärkeää, että jokainen lääkehoitoa tarvitseva saa juuri hänelle parhaiten sopivan hoidon. Me MSD:llä

Lisätiedot

Laajakirjoisia beetalaktamaaseja tuottavat bakteerit ja MRSA - Uudet ilmoitettavat eläintaudit

Laajakirjoisia beetalaktamaaseja tuottavat bakteerit ja MRSA - Uudet ilmoitettavat eläintaudit Laajakirjoisia beetalaktamaaseja tuottavat bakteerit ja MRSA - Uudet ilmoitettavat eläintaudit Erikoistutkija Suvi Nykäsenoja Jaostopäällikkö Antibioottijaosto Elintarvike- ja rehumikrobiologian tutkimusyksikkö

Lisätiedot

Testaajan eettiset periaatteet

Testaajan eettiset periaatteet Testaajan eettiset periaatteet Eettiset periaatteet ovat nousseet esille monien ammattiryhmien toiminnan yhteydessä. Tämä kalvosarja esittelee 2010-luvun testaajan työssä sovellettavia eettisiä periaatteita.

Lisätiedot

Tampereen BIOPANKKI. Selvitys näytteenantajalle suostumuksen antamista varten

Tampereen BIOPANKKI. Selvitys näytteenantajalle suostumuksen antamista varten Tampereen BIOPANKKI Selvitys näytteenantajalle suostumuksen antamista varten Pyydämme sinulta suostumusta näytteiden ja sinua koskevien tietojen keräämiseksi Tampereen Biopankkiin ja käytettäväksi biopankkitutkimukseen.

Lisätiedot

Ihmisen elämänkaari. Syntymä

Ihmisen elämänkaari. Syntymä Ihmisen elämänkaari Jokainen meistä on saanut alkunsa, kun miehen siittiö on hedelmöittänyt naisen munasolun. Siitä on saanut alkunsa uusi elämä, uusi elämän tarina. Vaikka jokaisella on oma tarinansa,

Lisätiedot

SUOMI EUROOPASSA 2002 -TUTKIMUS

SUOMI EUROOPASSA 2002 -TUTKIMUS A SUOMI EUROOPASSA 2002 -TUTKIMUS GS1. Alla kuvaillaan lyhyesti ihmisten ominaisuuksia. Lukekaa jokainen kuvaus ja rastittakaa, kuinka paljon tai vähän kuvaus muistuttaa teitä itseänne. a. Ideoiden tuottaminen

Lisätiedot