Mitä uutta rintasyövästä

Koko: px
Aloita esitys sivulta:

Download "Mitä uutta rintasyövästä"


1 Mitä uutta rintasyövästä Onkologiapäivät Käsiteltäviä aiheita Neoadjuvanttihoidot NOAH-studyn pitkäaikaistulokset Adjuvanttihoidot Tamoksifeeni 5v. vs. 10 v. HERA-tutkimuksen päivityksiä TEACH-tutkimus kainalon imusolmukealueiden hoitoa Levinnen rintasyövän hoidot HER2+ & ensilinjan hoito HER2+ & toisen linjan hoito PI3K signaaliketjun mutaatiot Yhteenveto 1

2 NOAH / Gianni (ASCO 2013) NOAH, faasi 3 neoadjuvanttitutkimus: pitkäaikaistulokset! 235 potilasta: HER2+ & LABC AP x 3 P x 4 CMF x 3 ± trastuzumab every 3 weeks ad 1 vuosi CT+H CT EFS at 5 years 57.5% vs 43.3% (HR 0.64, p=0.013) EFS at 5 years in pcr 86.5% vs 54.8% (HR 0.29, p=0.008) OS 5 years 73.5% vs 62.9% (HR 0.66, p=0.055) BCSS 5 years 77.4% vs 63.9% (HR 0.59, p=0.023) ATLAS-tutkimus (adjuvant tamoksifen, longer against shorter) ASCO 2013 ja Lancet 2013;381: ER+ potilasta (v ) data tilanteen mukaan Tamoksifeeni 5v. vs. 10 v. reucurrence 711 vs. 617 p=0.002 bc deaths 397 vs. 331 p=0.01 all deaths 722 vs. 639 p=0.01 pidemmän hoidon hyöty tuli esiin ennen kaikkea seurannan edetessä 2

3 ATLAS-tutkimus: Tamoksifeeni 5 v. vs. 10 v. ATLAS-study Recurrence Breast cancer mortality Abs ero 3.7% Abs ero 2.8% ATLAS-tutkimus: Tamoksifeeni 5 v. vs. 10 v. ATLAS 3

4 attom (adjuvant tamoksifen treatment offers more) ASCO potilasta (2755 ER+, 4198 ER unknown) v randomoitiin 5 v. Tam jälkeen Tam 5v. vs. 10v. reucurrence 672 vs. 580 p=0.003 all deaths 910 vs. 849 p=0.1 HR v. 5-9 välillä ja myöhemmin attom ASCO 2013 attom 4

5 attom ASCO 2013 attom ATLAS & attom Tamoksifeeni 5v. vs. 10 v keuhkoembolian riski (HR 1.87 & p=0.01) keuhkoemboliaan kuolleisuudessa ei eroa kohtusyövän riski (HR 1.74, p= & HR 2.20, p ) kohtusyövän kuolleisuus molemmissa tutkimuksissa tulokset merkittävät jatketun tamoksifeenihoidon eduksi hoidolla haittansa nuoria potilaita vähän: miten alle 40? miten alle 50 v.? 5

6 HER2+ / adjuvanttihoito / HERA ESMO 2012 HERA tutkimus: 5102 HER2+ potilasta joilla N+ tai N0T1c kemo mikä vaan, trastuzumabi kemon jälkeen 1 vuosi, SÄD & HOR talon tapaan trastuzumabi 1v vs. vertailuhaara crossing over: 52.1% vertailuhaaran potilaista sai trastuzumabi hoitoa 8 v. seurantadata ei vielä julkaistu, mutta ESMO:ssa näytettiin HR tulokset DFS ja OS osalta SUMMARY OF DFS ITT ANALYSES FOR 1 YEAR TRASTUZUMAB VS. OBSERVATION ACROSS ANALYSIS TIME POINTS Median follow-up (% follow-up time after selective crossover) 2005 (0%) 1 yr MFU 0.54 DFS benefit No. of DFS events 1 year trastuzumab vs observation 127 vs 220 P< (4.3%) 2008 (33.8%) 2012 (48.5%) 2 yrs MFU 4 yrs MFU 8 yrs MFU vs 321 P< vs 458 P< vs 570 P< Favours 1 year trastuzumab Favours observation HR (95% CI) Extended from Gianni et al. Lancet Oncol

7 SUMMARY OF OS ITT ANALYSES FOR 1 YEAR TRASTUZUMAB VS. OBSERVATION ACROSS ANALYSIS TIME POINTS Median follow-up (% follow-up time after selective crossover) 2005 (0%) 1 yr MFU 0.76 OS benefit No. of deaths 1 year trastuzumab vs observation 29 vs 37 P= (4.1%) 2 yrs MFU vs 90 P= (30.9%) 2012 (45.5%) 4 yrs MFU 8 yrs MFU vs 213 P= vs 350 P= Favours 1 year trastuzumab Favours observation HR (95% CI) Extended from Gianni et al. Lancet Oncol HER2+ adjuvantti / HERA jatkuu HERA: 1 v. hoito vs. ei: lobulaarinen rintasyöpä 187 / 3401 (5.5%) HR for DFS trastuzumabi vs. ei : 0.63 lob bc ja 0.77 dukt bc HR for OS trastuzumabi vs. ei: 0.60 lob bc ja 0.86 dukt bc lobulaarinen alatyyppi ei huononna Herceptin hoidon tehoa HERA: 1 vuoden hoito vs. seuranta: Aivometastasointi CNS relapsi ensimmäisenä metastasointi paikkana trastuzumabi ryhmä 37/1703 (2.2%) vs. seurantaryhmä 32/1698 (1.9%) aivometastasointi potilailla, jotka ovat kuolleet rintasyöpään Trastuzumabi ryhmä 88/186 (47%) vs. seurantaryhmä 129/227 (57%) trastuzumabi liitännäisvaiheessa ei lisää aivometastasointia 7

8 HER2+ / adjuvanttihoito / HERA HERA tutkimus: 5102 HER2+ potilasta joilla N+ tai N0T1c kemo mikä vaan, trastuzumabi kemon jälkeen, SÄD & HOR talon tapaan 3105 potilasta rand. trastuzumabi 1v vs. trastuzumabi 2v DFS 8 v: 76.0% vs. 75.8% OS 8 v: 87.6% vs. 86.4% EF lasku 4.1% vs. 7.2% toinen vuosi trastuzumabi-hoitoa ei tuonut etua KAINALO: NSABP B-32 ASCO SNB negatiivista potilasta randomoitiin prospektiiviseen tutkimukseen 10 v. seuranta SNB yksin vs. SNB + evakuaatio DFS 76.9% vs. 76.9% OS 87.8% vs. 88.9% Puhdas vartijaimusolmuke SNB:ssä riittää! 8

9 KAINALO: EORTC:n AMAROS tutkimus (ASCO 2013) potilasta ( ), joista SNB potilasta SNB+ potilaat randomoitiin: kainalon evakuaatio vs. sädehoito 60% oli makrometastaseja mediaani seuranta-aika reilut 6 vuotta, 5v. tulokset Evakuaatio vs. sädehoito local relapse 4 / 744 (0.54%) vs. 7 / 681 (1.03%) OS 93.27% vs. 92.5% lymphödema 28% vs. 14% Seuranta-aika vielä lyhyt Onko SNB+ potilailla kainalonsädehoito yhtä hyvä kuin evakuaatio? EBCTCG 2012: Mastektomia + kainaloevakuaatio ± RT: pn1 (1-3) Recurrence Aiheeseen liittyvät kuvat eivät ole julkisesti nähtävissä, mutta kuvat voi pyytää henkilökohtaisesti Päivi Auviselta EBCTCG 2012: provisional results not for publication or citation 9

10 EBCTCG 2012: Mastektomia + Kainaloevakuaatio ± RT: pn1 (1-3) Breast Cancer Mortality Aiheeseen liittyvät kuvat eivät ole julkisesti nähtävissä, mutta kuvat voi pyytää henkilökohtaisesti Päivi Auviselta EBCTCG 2012: provisional results not for publication or citation EBCTCG kokous 2012 Mastektomia + kainaloevakuaatio ± RT: pn1 (1-3) uusimien ja rintasyöpäkuolleisuuden osalta jo 1 positiivisen imusolmukkeen potilailla kliininen hyöty sädehoidosta merkittävä voiko leikkaustekniikka olla nykyisin erilainen? voiko kainalon diagnostiikka olla nykyisin erilainen? jos kainaloa ei ole evakuoitu, olisiko sädehoidon hyöty pienempi, yhtä suuri vai suurempi? missä viipyy Whelan et al. julkaisu N1 potilaiden sädehoidosta (ASCO 2011)? 10

11 PI3K-pathway 11

12 PI3K & lääkeresistenssi (San Antonio, St Gallen, ASCO) ER/PR + HER2- (luminal A) rintasyöpä PI3K Akt mtor solunsisäinen signaalireitti Hormoniresistenssin kehittyminen on yhteydessä ko. signaalireitin aktivoitumiseen signaalireitin inhiboituminen voi palauttaa herkkyyden hormonaaliselle hoidolle everolimus + exemestaani hormonirefraktaareilla (non-streoidal AI) potilailla (Bolero-2) Ongelmia toksisuus (pneumoniitti, stomatiitti, ripuli jne) korvausasiat mitä tulevaisuus tuokaan tullessaan? arvokasta pioneerityötä paljon uusia tutkimuksia tekeillä 12

13 Progressive disease in bone in the subgroup of patients with bone metastases at baseline (n = 556). Gnant M et al. JNCI J Natl Cancer Inst 2013;105: The Author Published by Oxford University Press. All rights reserved. For Permissions, please Without visceral metastases 13

14 With visceral metastases Levinnyt HER2 rintasyöpä; mitä uutta? HER2+ tauti: first line pertuzumabi second line T-DM1 PI3K mutaatio HER2+ 14

15 Overall survival (%) RCH n=406 Placebo + trastuzumab PD Patients with HER2-positive MBC centrally confirmed (N=808) 1:1 Docetaxel 6 cycles recommended Pertuzumab + trastuzumab PD n=402 Docetaxel 6 cycles recommended Pertuzumab: sitoutuu HER2 reseptorissa eri kohtaan kuin trastuzumabi & estää HER2 ligandin dimerisaatiota toisten ligandien kanssa 2 9 Cleopatra: overall survival analysis RCH n at risk Ptz + T + D Pla + T + D year 94% 89% years 81% 69% Time (months) years % 50% Ptz + T + D: 113 events; median not reached Pla + T + D: 154 events; median 37.6 months HR= % CI p= Stopping boundary for concluding statistical significance at this second interim analysis was p D, docetaxel; Pla, placebo; Ptz, pertuzumab; T, trastuzumab

16 Independently-assessed PFS (%) Overall survival in predefined subgroups RCH Prior (neo)adjuvant chemotherapy Region Age group Race Disease type ER/PgR status HER2 status All No Yes Europe North America South America Asia <65 years 65 years <75 years 75 years White Black Asian Other Visceral disease Non-visceral disease Positive Negative IHC 3+ FISH-positive Favors pertuzumab Favors placebo n HR 95% CI Cleopatra Placebo arm; Placebo + Trastuzumab + Docetaxel PIK3CA mutation associated with poorer prognosis PI3K: Pla+T+D: WT 101 events 63 events Time (months) Number at risk Pla+T+D WT Pla+T+D Mut Pla+T+D: Mut Mut, mutated; WT, wild-type 16

17 Independently-assessed PFS (%) Cleopatra; both arms PIK3CA mutation associated with poorer prognosis Placebo Pertuzumab Number at risk Pla+T+D WT Pla+T+D Mut Ptz+T+D WT Ptz+T+D Mut Pla+T+D: WT Ptz+T+D: WT 101 events 63 events Time (months) Pla+T+D: Mut Ptz+T+D: Mut 83 events 45 events Mut, mutated; WT, wild-type HER2 & PI3K (San Antonio, St Gallen, ASCO) HER+ & Cleopatra taksaani & trastuzumabi ± pertuzumabi molemmissa ryhmissä PI3K mutaatio+ potilailla meni selvästi huonommin hyöty molemmissa ryhmissä pertuzumabi lääkkeestä saman suuruinen Bolero-3 (ASCO 2013) HER2+, trastuzumabi-resistant randomoitu, placebo-kontrolloitu, faasi 3 tutkimus Navelbine + Trastuzumab ± everolimus alustavissa tutkimuksissa everolimus ryhmän potilailla menee hivenen paremmin (HR 0.78, p ) BRCA1 & BRCA2 kantajat PI3K ketjun salpaus saattaa palauttaa herkkyyden PARP-inhibiittoreille 17

18 Proportion progression-free HER2 T-DM1 Emtansine release Inhibition of microtubule polymerization Lysosome P P P Trastuzumab-specific MOA Antibody-dependent cellular cytotoxicity (ADCC) Inhibition of HER2 signaling Inhibition of HER2 shedding Internalization Nucleus Median (months) No. of events Cap + Lap T-DM Stratified HR=0.650 (95% CI, 0.55, 0.77) P< Time (months) No. at risk by independent review: Cap + Lap T-DM Unstratified HR=0.66 (P<0.0001). 18

19 Uusi hoitosuositus! Mitä uutta käytännön läheinen helppo päivittää helppokäyttöinen moni-ammatillinen antaa liikkumavaraa huomioi rintasyövän biologiaa Yhteenveto trastuzumabi kuuluu HER2+ potilaiden neoadjuvanttihoitoon Tamoksifeeni 10 v. parempi kuin 5v. Mutta kenelle? HER2+ adjuvantti trastuzumabi: 2 v. hoito ei tuo lisäetua trastuzumabi hoidon hyöty sama lobulaarista syöpää sairastavilla hoito ei lisää aivometastasointia Sädehoidon asema N1 (1-3) kainalon osalta? PI3K mukana monen eri ryhmän lääkeresistenssi asioissa levinnyt HER2+ tauti ensi linjaan pertuzumabi toiseen linjaan tulossa T-Dm1 Uusi hoitosuositus! 19

20 Kiitos! 20

Mitä uutta rintasyövästä. Onkologiapäivät

Mitä uutta rintasyövästä. Onkologiapäivät Mitä uutta rintasyövästä Onkologiapäivät 2013 31.8.2013 Käsiteltäviä aiheita Neoadjuvanttihoidot NOAH-studyn pitkäaikaistulokset Adjuvanttihoidot Tamoksifeeni 5v. vs. 10 v. HERA-tutkimuksen päivityksiä


Seminoman hoito ja seuranta. S. Jyrkkiö

Seminoman hoito ja seuranta. S. Jyrkkiö Seminoman hoito ja seuranta S. Jyrkkiö 17.4.2015 Kivessyöpä yleistyy Pohjoismaissa Seminoman ja non-seminoomien yleisyys Pohjoismaissa Kuolleisuus kivessyöpään Pohjoismaissa Kivessyöpä 5 v OSS Kivestuumoreiden


Mitä uutta eturauhassyövän sädehoidosta? Mauri Kouri HUS Syöpätautien klinikka Onkologiapäivät 31.8.13 Turku

Mitä uutta eturauhassyövän sädehoidosta? Mauri Kouri HUS Syöpätautien klinikka Onkologiapäivät 31.8.13 Turku 1 Mitä uutta eturauhassyövän sädehoidosta? Mauri Kouri HUS Syöpätautien klinikka Onkologiapäivät 31.8.13 Turku 2 ASCO GU 2013 Radikaali prostatektomian jälkeinen sädehoito ARO 92-02 / AUO AP 09/95 10v


Mitä uutta lymfoomien hoitokäytännöissä? S. Jyrkkiö, TYKS Onkologiapäivät 30.8.13

Mitä uutta lymfoomien hoitokäytännöissä? S. Jyrkkiö, TYKS Onkologiapäivät 30.8.13 Mitä uutta lymfoomien hoitokäytännöissä? S. Jyrkkiö, TYKS Onkologiapäivät 30.8.13 N=549 FU 45 kk PFS 69 vs 31 kk R-B R-CHOP Alopecia 0 % 100 % Hematol toksisuus 30 68 Infektiot 37 50 Neuropatia 7 29 Stomatiitti



MITÄ UUTTA SARKOOMIEN HOIDOSSA? MITÄ UUTTA SARKOOMIEN HOIDOSSA? O S A S T O N Y L I L Ä Ä K Ä R I M A I J A T A R K K A N E N H Y K S S Y Ö P Ä K E S K U S LUENNON SISÄLTÖ luu- ja pehmytkudossarkoomat ei pediatrisia tutkimuksia ei gynekologisia


Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen

Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen Tärkeä lääketurvatiedote terveydenhuollon ammattilaisille. RAS-villityyppistatuksen (KRAS- ja NRAS-statuksen eksoneissa 2, 3 ja 4) varmistaminen on tärkeää ennen Erbitux (setuksimabi) -hoidon aloittamista


Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys

Molekyylidiagnostiikka keuhkosyövän hoidossa. Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Molekyylidiagnostiikka keuhkosyövän hoidossa Jussi Koivunen, el, dos. Syöpätautien ja sädehoidon klinikka/oys Sidonnaisuudet Taloudelliset riippuvuudet: Konsultointi: - Tutkimusrahoitus: - Honorariat:


Mitä uutta kolorektaalisyövästä?

Mitä uutta kolorektaalisyövästä? Mitä uutta kolorektaalisyövästä? Tapio Salminen, TAYS Valtakunnalliset onkologiapäivät 2013 Metastasoineen taudin hoidon valinnan periaatteet kolorektaalisyövässä Ryhmä 0 R0 resekoitavissa oleva maksa


Pinnallisesti invasoiva levyepiteelikarsinooma (Stage IA1; invaasio < 3 mm, laajuus < 7 mm)

Pinnallisesti invasoiva levyepiteelikarsinooma (Stage IA1; invaasio < 3 mm, laajuus < 7 mm) Levyepiteeli Lievät muutokset Atypia condylomatosa/litteä kondylooma CIN 1 (lievä dysplasia) Esiastemuutokset CIN 2 (= keskivahva dysplasia) CIN 3 (= vahva dysplasia ja carcinoma in situ) Pinnallisesti


Muuttuva diagnostiikka avain yksilöityyn hoitoon

Muuttuva diagnostiikka avain yksilöityyn hoitoon Muuttuva diagnostiikka avain yksilöityyn hoitoon Olli Carpén, Patologian professori, Turun yliopisto ja Patologian palvelualue, TYKS-SAPA liikelaitos ChemBio Finland 2013 EGENTLIGA HOSPITAL FINLANDS DISTRICT


keuhkosyövän uusista hoitotutkimuksista Jussi Koivunen, el dos OYS/Syöpätaudit

keuhkosyövän uusista hoitotutkimuksista Jussi Koivunen, el dos OYS/Syöpätaudit keuhkosyövän uusista hoitotutkimuksista Jussi Koivunen, el dos OYS/Syöpätaudit 30.8.2014 Sidonnaisuudet Taloudelliset riippuvuudet: Konsultointi: - Tutkimusrahoitus: - Osakkeet: - Honorariat: Eli Lilly,


Kivessyövän hoidossa tapahtuu

Kivessyövän hoidossa tapahtuu Kivessyövän hoidossa tapahtuu S. Jyrkkiö, Tyks Onkologiapäivät 30.8.2014 Kivessyöpä yleistyy Nordcan database/ylönen O. 1 ST I kivessyöpä: seuranta tai adj hoito? 2 Seminoma ST I SWENOTECA tulokset V 2007-2010



MUUTOKSET VALTIMOTAUTIEN ESIINTYVYYDESSÄ MUUTOKSET VALTIMOTAUTIEN ESIINTYVYYDESSÄ Yleislääkäripäivät 2017 Veikko Salomaa, LKT Tutkimusprofessori 23.11.2017 Yleislääkäripäivät 2017 / Veikko Salomaa 1 SIDONNAISUUDET Kongressimatka, Novo Nordisk


Espoossa ) Perjeta-liitännäishoidon hoidollinen arvo

Espoossa ) Perjeta-liitännäishoidon hoidollinen arvo Espoossa 19.10.2018 Roche Oy:n kommentteja Fimean 4.10.2018 julkaisemaan arviointiraporttiin pertutsumabin hoidollisesta ja taloudellisesta arvosta HER2-positiivisen varhaisvaiheen rintasyövän liitännäishoidossa


Rintasyövän nykyaikainen hoito ja seuranta

Rintasyövän nykyaikainen hoito ja seuranta Rintasyövän nykyaikainen hoito ja seuranta One fits all vai Räätälöity hoito Rintasyöpä Suomessa Rintasyöpään sairastui 2007 4142 suomalaista naista ja 16 miestä Hoitotulokset ovat kansainvälisestikin


Estrogeenireseptorimodulaatio stroken riskitekijänä. Tomi Mikkola HYKS Naistensairaala

Estrogeenireseptorimodulaatio stroken riskitekijänä. Tomi Mikkola HYKS Naistensairaala Estrogeenireseptorimodulaatio stroken riskitekijänä Tomi Mikkola HYKS Naistensairaala Sidonnaisuudet Toiminut asiantuntijana seuraaville lääkeyrityksille: Bayer Schering, Schering-Plough Luennoitsijana


Miten syövän hoidon hyötyä mitataan? Olli Tenhunen LT FIMEA/PPSHP

Miten syövän hoidon hyötyä mitataan? Olli Tenhunen LT FIMEA/PPSHP Miten syövän hoidon hyötyä mitataan? Olli Tenhunen LT FIMEA/PPSHP Disclosures No interests in pharmaceutical industry Member of EMA Scientific Advice Working Party, Oncology Working Party, Committee for



PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING Veijalainen O, Kares S, Kujala P, Vuento R, TirKkonen M, Kholová I, Osuala V, Mäenpää J University and University Hospital of Tampere, Finland,


Noona osana potilaan syövän hoitoa

Noona osana potilaan syövän hoitoa Noona osana potilaan syövän hoitoa Noona lyhyesti Noona on mobiilipalvelu osaksi potilaan syövän hoitoa Noonan avulla Potilas osallistuu aktiivisesti hoitoonsa raportoimalla hoidon aikaisia haittoja. Hän


Uutta melanoomasta. Pia Vihinen TYKS/Syöpäklinikka. Tutkimukset kun epäilet melanooman leviämistä

Uutta melanoomasta. Pia Vihinen TYKS/Syöpäklinikka. Tutkimukset kun epäilet melanooman leviämistä Uutta melanoomasta Pia Vihinen TYKS/Syöpäklinikka Tutkimukset kun epäilet melanooman leviämistä Vartalon TT tutkimus tai PET-TT Verikokeet; Hb, maksa-arvot, krea Korkea LDH huonon ennusteen merkki PAD:


Ruokatorvisyövän sädehoito

Ruokatorvisyövän sädehoito Ruokatorvisyövän sädehoito 18.4.2013 Sädehoitopäivät, Lahti EL, LT Kaisa Lehtiö, OYS Yleistä Tutkimustietoa Hoitosuosituksista Käytännön toteutuksesta Ruokatorvisyöpä Suomessa 2011 273 uutta tapausta 231


KLL Lymfosytoosin selvittely KLL:n seuranta ja hoito. Hematologian alueellinen koulutuspäivä 14.4.2016 Anu Laasonen

KLL Lymfosytoosin selvittely KLL:n seuranta ja hoito. Hematologian alueellinen koulutuspäivä 14.4.2016 Anu Laasonen KLL Lymfosytoosin selvittely KLL:n seuranta ja hoito Hematologian alueellinen koulutuspäivä 14.4.2016 Anu Laasonen KLL:n diagnostiikka, seuranta ja hoito-ohjeet löytyvät täältä: -> Hoito-ohjeet


Tervekudosten huomiointi rinnan sädehoidossa

Tervekudosten huomiointi rinnan sädehoidossa Tervekudosten huomiointi rinnan sädehoidossa Onkologiapäivät 30.8.2013 Sairaalafyysikko Sami Suilamo Tyks, Syöpäklinikka Esityksen sisältöä Tervekudoshaittojen todennäköisyyksiä Tervekudosten annostoleransseja


Kohti rintasyövän säästävämpää leikkaus- ja sädehoitoa

Kohti rintasyövän säästävämpää leikkaus- ja sädehoitoa RINTASYÖPÄ Marjut Leidenius ja Leila Vaalavirta Kohti rintasyövän säästävämpää leikkaus- ja sädehoitoa 1198 Rintasyövän leikkaus- ja sädehoidon tavoitteena on minimoida taudin uusiutumisen riski rinnassa,


Ruokatorvisyöpä. Ruokatorvisyöpä 2013. Ruokatorven syövän yleisyyden alueelliset vaihtelut. Ruokatorven levyepiteelisyövän etiologia

Ruokatorvisyöpä. Ruokatorvisyöpä 2013. Ruokatorven syövän yleisyyden alueelliset vaihtelut. Ruokatorven levyepiteelisyövän etiologia Ruokatorvisyöpä Ruokatorvisyöpä 2013 Eero Sihvo Dos KSKS Nielemisvaikeus Suomessa vajaa 300/v 14. yleisin ca >20. yleisin ca 2 histologista päätyyppiä Distaalinen ruokatorvi 40,0 35,0 30,0 25,0 20,0 15,0


Mitä uutta eturauhassyövästä? Tapio Utriainen, HUS Onkologiapäivät

Mitä uutta eturauhassyövästä? Tapio Utriainen, HUS Onkologiapäivät Mitä uutta eturauhassyövästä? Tapio Utriainen, HUS Onkologiapäivät 31.8.2013 Mitä uutta eturauhassyövästä? Julkaisujen, ei uusien tulosten vuosi mcrpc:ssä AFFIRM, ALSYMPCA, COU-AA-302 Hyödyttääkö dosetakselihoito


Uutta lääkkeistä: Palbosiklibi

Uutta lääkkeistä: Palbosiklibi Page 1 of 5 JULKAISTU NUMEROSSA 1/2017 UUTTA LÄÄKKEISTÄ Uutta lääkkeistä: Palbosiklibi Annikka Kalliokoski / Kirjoitettu 25.1.2017 / Julkaistu Ibrance 75 mg, 100 mg, 125 mg kovat kapselit, Pfizer Limited


Kenelle täsmähoitoja ja millä hinnalla?

Kenelle täsmähoitoja ja millä hinnalla? Kenelle täsmähoitoja ja millä hinnalla? Heikki Joensuu ylilääkäri, Syöpätautien klinikka, HYKS, ja professori, Lääketieteellinen tiedekunta, Helsingin yliopisto EUROCARE-4 tutkimus Syöpäpotilaiden eloonjääminen


Somaattinen sairaus nuoruudessa ja mielenterveyden häiriön puhkeamisen riski

Somaattinen sairaus nuoruudessa ja mielenterveyden häiriön puhkeamisen riski + Somaattinen sairaus nuoruudessa ja mielenterveyden häiriön puhkeamisen riski LINNEA KARLSSON + Riskitekijöitä n Ulkonäköön liittyvät muutokset n Toimintakyvyn menetykset n Ikätovereista eroon joutuminen



RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA RINNAN NGS PANEELIEN KÄYTTÖ ONKOLOGIN NÄKÖKULMA Johanna Mattson dosentti ylilääkäri, vs. toimialajohtaja HYKS Syöpäkeskus 28.11.2016 1 RINTASYÖPÄ SUOMESSA 5008 uutta tapausta vuonna 2014 Paikallinen rintasyöpä


AML hoitotutkimuksia. AML-työryhmäkokous

AML hoitotutkimuksia. AML-työryhmäkokous AML hoitotutkimuksia AML-työryhmäkokous 27.09.2017 Tutkimuskysymyksiä Induktiohoito Remissioiden määrä Hoidon toksisuus Konsolidaatiohoito Relapsin esto (RFS, OS) Hoidon toksisuus AraC annos Antrasykliini


Koneoppimisen hyödyt arvopohjaisessa terveydenhuollossa. Kaiku Health

Koneoppimisen hyödyt arvopohjaisessa terveydenhuollossa. Kaiku Health Koneoppimisen hyödyt arvopohjaisessa terveydenhuollossa Kaiku Health Petri Avikainen Kaiku Health Petri Avikainen @silputtelija @silppuri Kaiku Health Software Engineer Kaiku Health Software Engineer


Pienet annokset seminooman sädehoidossa ja seurannassa. Sädehoitopäivät 17.4.2015 Turku Antti Vanhanen

Pienet annokset seminooman sädehoidossa ja seurannassa. Sädehoitopäivät 17.4.2015 Turku Antti Vanhanen Pienet annokset seminooman sädehoidossa ja seurannassa Sädehoitopäivät 17.4.2015 Turku Antti Vanhanen Seminooman adjuvantti sädehoito: muutokset kohdealueessa ja sädeannoksessa Muinoin: Para-aortaali-





Results on the new polydrug use questions in the Finnish TDI data

Results on the new polydrug use questions in the Finnish TDI data Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen


Lonkkamurtumapotilaan laiminlyöty (?) lääkehoito. Matti J.Välimäki HYKS, Meilahden sairaala Endokrinologian klinikka Helsinki 5.2.

Lonkkamurtumapotilaan laiminlyöty (?) lääkehoito. Matti J.Välimäki HYKS, Meilahden sairaala Endokrinologian klinikka Helsinki 5.2. Lonkkamurtumapotilaan laiminlyöty (?) lääkehoito Matti J.Välimäki HYKS, Meilahden sairaala Endokrinologian klinikka Helsinki 5.2.2010 Osteoporoosin lääkehoito Mitä pitempi kokemus, sitä skeptisempi suhtautuminen





Läpimurto ms-taudin hoidossa?

Läpimurto ms-taudin hoidossa? Läpimurto ms-taudin hoidossa? Läpimurto ms-taudin hoidossa? Kansainvälisen tutkijaryhmän kliiniset kokeet uudella lääkkeellä antoivat lupaavia tuloksia sekä aaltoilevan- että ensisijaisesti etenevän ms-taudin


Antibody-Drug conjugates: Basic consepts, examples and future perspectives

Antibody-Drug conjugates: Basic consepts, examples and future perspectives Antibody-Drug conjugates: Basic consepts, examples and future perspectives Giulio Casi and Dario Neri Journal of Controlled Release 161:422-428, 2012 Esityksen sisältö Vasta-ainekonjugaatin (antibody-drug


Seminooman sädehoito. Paula Lindholm Tyks, syöpätaudit

Seminooman sädehoito. Paula Lindholm Tyks, syöpätaudit Seminooman sädehoito Paula Lindholm Tyks, syöpätaudit Miten seminooma leviää? 85% kliininen stage I ja 11% st II para-aortaali-imusolmukkeet Ipsilateraaliset parailiakaaliset Ipsilateraalinen munuaishilus


tgg agg Supplementary Figure S1.

tgg agg Supplementary Figure S1. ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt



PUNASOLUT RYHMÄN MUKAISESTI PUNASOLUT RYHMÄN MUKAISESTI Verikeskuspäivä 2018 Susanna Sainio Ensisijaisesti potilaan ABO- ja RhD-veriryhmän mukaisia valmisteita minimoida ABO-epäsopivien punasolujen siirrosta johtuvien hemolyyttisten


Mitä pitäisi tietää rintasyövän hoidosta ja seurannasta?

Mitä pitäisi tietää rintasyövän hoidosta ja seurannasta? Mitä pitäisi tietää rintasyövän hoidosta ja seurannasta? Suomen yleislääkäriyhdistys 13.05.2016 Päivi Salminen-Peltola osastonylilääkäri HUS Hyvinkään sairaala Sisältö Lähettäminen ja tutkimukset perusterveydenhuollossa


Arviointien hyödyntäminen käytännön työssä Ayl Katariina Klintrup Syöpätautien ja hematologian vastuualue

Arviointien hyödyntäminen käytännön työssä Ayl Katariina Klintrup Syöpätautien ja hematologian vastuualue Arviointien hyödyntäminen käytännön työssä 19.9.2018 Ayl Katariina Klintrup Syöpätautien ja hematologian vastuualue 1 Uuden lääkkeen käyttöönotto Alle 35 000? Menettelytapa alle 35 000 kustannuksissa?


Increase of opioid use in Finland when is there enough key indicator data to state a trend?

Increase of opioid use in Finland when is there enough key indicator data to state a trend? Increase of opioid use in Finland when is there enough key indicator data to state a trend? Martta Forsell, Finnish Focal Point 28.9.2015 Esityksen nimi / Tekijä 1 Martta Forsell Master of Social Sciences


Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet

Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet Paksusuolisyövän uudet tuulet ja 2014 tulleet uutuudet Pia Österlund el, dosentti Kliininen opettaja HY/HYKS syöpätaudit 29 elokuuta 2014 Sidonnaisuudet Palkkioita ja/tai matkakorvauksia: Amgen, Bayer,


Elämänkulku ja vanheneminen

Elämänkulku ja vanheneminen Elämänkulku ja vanheneminen Taina Rantanen Gerontologian ja kansanterveyden professori Gerontologian tutkimuskeskus Terveystieteiden laitos Jyväskylän yliopisto Miksi tutkia pitkäikäisyyttä ja vanhuuden


ESTO Eturauhassyövältä Suojaavien lääkkeellisten Tekijöiden Osoittaminen

ESTO Eturauhassyövältä Suojaavien lääkkeellisten Tekijöiden Osoittaminen ESTO Eturauhassyövältä Suojaavien lääkkeellisten Tekijöiden Osoittaminen LT Teemu Murtola Tampereen yliopisto, lääketieteen yksikkö TAYS, urologian vastuualue Lääke-epidemiologia Suomessa-seminaari Huhtikuu


NOPHO-ALL2008 22.8.2014 N= 200 7.10.2014. Helene Hallböök, Uppsala Univ.

NOPHO-ALL2008 22.8.2014 N= 200 7.10.2014. Helene Hallböök, Uppsala Univ. NOPHO-ALL2008 TILANNE TUTKIMUSMAISSA JA OMAT KOKEMUKSET PILOTTIPOTILAIDEN HOIDOSTA AKUUTTI LEUKEMIA RYHMÄ 24.9.204 UWK 22.8.204 N= 200 Mean age 28.5 y (range 8-46y) Srvival data on 82 pts cohort sed for


Eturauhassyövän uudet lääkehoidot

Eturauhassyövän uudet lääkehoidot Eturauhassyövän uudet lääkehoidot 24.04.2015 Petteri Hervonen, LT, Syöpätautien erikoislääkäri Docrates Syöpäsairaala, TAYS Yleistä Eturauhassyöpä on miesten yleisin syöpätyyppi Lähes 5000 uutta diagnoosia/vuosi


Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä

Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä Syöpätautien hoidoista vaikuttavia tuloksia, lisää elinvuosia, odotuksia ja pettymyksiä Pirkko-Liisa Kellokumpu-Lehtinen Säde- ja kasvainhoidon professori/ylilääkäri, Tay/Tays 20.11.2012 Sairaalapäivät,


Tekonivelpotilas anestesialääkärin kannalta. LT Antti Aho Tekonivelsairaala Coxa

Tekonivelpotilas anestesialääkärin kannalta. LT Antti Aho Tekonivelsairaala Coxa Tekonivelpotilas anestesialääkärin kannalta LT Antti Aho Tekonivelsairaala Coxa 19.4.2017 Esikäynti Leikkaus Heräämö/vuodeosasto Kuntoutuminen Potilaan hyvinvointi/homeostaasi/potilas säilyy hengissä Hyvä


Paikallisen eturauhassyövän uudet hoitotutkimukset

Paikallisen eturauhassyövän uudet hoitotutkimukset Paikallisen eturauhassyövän uudet hoitotutkimukset Vesa Kataja Kliinisen onkologian dosentti Johtajaylilääkäri, KSSHP Valtakunnalliset Onkologiapäivät 29.-30.8.2014, Oulu Paikallinen eturauhassyöpä Diagnostiikka:


NEWS. N o 2/15. Pääkirjoitus: SOLDista BOLDiin! 10 kysymystä rintakirurgian koulutuksesta Suomessa

NEWS. N o 2/15. Pääkirjoitus: SOLDista BOLDiin! 10 kysymystä rintakirurgian koulutuksesta Suomessa NEWS S U O M E N R I N TA S Y Ö P Ä RY H M Ä RY N o 2/15 F I N N I S H B R E A S T C A N C E R G RO U P Pääkirjoitus: SOLDista BOLDiin! s.3 HEiKKi joensuu 10 kysymystä rintakirurgian koulutuksesta Suomessa





Finland, Data Sources Last revision: 01-11-2011

Finland, Data Sources Last revision: 01-11-2011 Finland, Data Sources Last revision: 01-11-2011 LIVE BIRTHS Live births by age/cohort of mother 1976-1981: Väestö 1976-1981 Osa I, Väestörakenne ja väestönmuutokset, Koko maa ja läänit. Suomen Virallinen



MIESTEN JA ALLE 35-VUOTIAIDEN NAISTEN RINTASYÖPÄ MIESTEN JA ALLE 35-VUOTIAIDEN NAISTEN RINTASYÖPÄ Ari-Pekka Asikainen LK & Minna Tanner Dosentti/ Oyl, TAYS, Syövän hoidon vastuualue Syventävien opintojen kirjallinen työ Tampereen yliopisto Lääketieteen


Efficiency change over time

Efficiency change over time Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel



VUODEN TÄRKEÄT SÄDEHOITOTUTKIMUKSET. Jan Seppälä. Sädehoitopäivät 2015 VUODEN TÄRKEÄT SÄDEHOITOTUTKIMUKSET Jan Seppälä Sädehoitopäivät 2015 17/04/2015 1 Viime vuoden tärkeät tapahtumat Adrian Begg (1946 2014), kuului mm. ESTROn säteilybiologiatoimikuntaan, piti kursseja kliinisestä


Rintasyövän liitännäislääkehoidot

Rintasyövän liitännäislääkehoidot Riikka Huovinen, Päivi Auvinen, Johanna Mattson ja Heikki Joensuu KATSAUS Rintasyövän liitännäislääkehoidot Suurin osa rintasyövistä on hormonireseptoripositiivisia ja kasvutavaltaan hitaita. Biologisten


Luuston SPECT ja PETCT

Luuston SPECT ja PETCT Luuston SPECT ja PETCT Marko Seppänen, dos, oyl Isotooppiosasto ja Valtakunnallinen PET-keskus TYKS Luuston kuvantaminen Gammakuvauksella vs. PET-menetelmällä SPET-CT vs. PET/CT


Levinneen rintasyövän hoito

Levinneen rintasyövän hoito Johanna Mattson ja Riikka Huovinen KATSAUS Levinneen rintasyövän hoito Levinnyt rintasyöpä on edelleen parantumaton sairaus, vaikka sen hoitoon on viime vuosina tullut useita uusia tehokkaita lääkkeitä.


Miehen rintasyöpä. Riskitekijät. Oireet, diagnostiikka ja levinneisyys

Miehen rintasyöpä. Riskitekijät. Oireet, diagnostiikka ja levinneisyys Johanna Mattson ja Leena Vehmanen Rintasyöpä on miehillä harvinainen. Sairauden diagnoosi saattaa viivästyä, koska lääkäri tai potilas eivät osaa sitä epäillä. Käytettävissä oleva tieto perustuu taudin


Suomen Potilasturvallisuusyhdistys SPTY ry

Suomen Potilasturvallisuusyhdistys SPTY ry Suomen Potilasturvallisuusyhdistys SPTY ry 24.10.2017 Suomen Potilasturvallisuusyhdistys ry Perustettu v. 2010 Perustehtävä: edistää potilasturvallisuutta ja potilasturvallisuuden tutkimusta Suomessa Toimintaa


BRCA-kantaja ja hormonihoidot

BRCA-kantaja ja hormonihoidot BRCA-kantaja ja hormonihoidot 1. 1 0. 2 0 1 1 T u o h i l a m p i H A N N A H A U T A M Ä K I, E R I K O I S T U V A L Ä Ä K Ä R I H Y K S N K L Esityksen sisältö Yleistä BRCA-mutaatioista Esiintyvyys


Never ending story -käsihygieniahavainnointi käytännössä

Never ending story -käsihygieniahavainnointi käytännössä Never ending story -käsihygieniahavainnointi käytännössä 42. Valtakunnalliset Sairaalahygieniapäivät 16. 17.3.2016 Helena Ojanperä osastonhoitaja/hygieniahoitaja, sh,ttm PPSHP/OYS infektioiden torjuntayksikkö


PYLL-seminaari 30.3.2011

PYLL-seminaari 30.3.2011 PYLL-seminaari 30.3.2011 Sairaalajohtaja Jari Välimäki syöpätautien osuus ennenaikaisten elinvuosien menetysten aiheuttajina etenkin ESshp:n naisten keskuudessa kiinnittää huomiota ne ovat PYLL-tilastossa





Miten ehkäistä suolisyöpää? Jukka- Pekka Mecklin Yleiskirurgian professori K- SKS ja Itä- Suomen yliopisto

Miten ehkäistä suolisyöpää? Jukka- Pekka Mecklin Yleiskirurgian professori K- SKS ja Itä- Suomen yliopisto Miten ehkäistä suolisyöpää? Jukka- Pekka Mecklin Yleiskirurgian professori K- SKS ja Itä- Suomen yliopisto Suolisyövän ehkäisy 1. Suolisyövän yleisyys väestössä 2. Suolisyövän riskiryhmät 3. Suolisyövän


Alternative DEA Models

Alternative DEA Models Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex


Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli. Lataa

Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli. Lataa Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli Lataa Kirjailija: Pekka Rapeli ISBN: 9789523022232 Sivumäärä: 173 Formaatti: PDF Tiedoston koko: 11.54 Mb Opioid substitution


Eturauhassyövän seulonta. Patrik Finne

Eturauhassyövän seulonta. Patrik Finne Eturauhassyövän seulonta Patrik Finne Ulf-Håkan Stenman-juhlasymposiumi, 21.4.2009 Seulonnan tavoite löytää syöpä aikaisemmin, ennen kuin se on levinnyt mahdollistaa radikaalinen hoito Vähentää kuolleisuutta


Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies

Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!


SELL Student Games kansainvälinen opiskelijaurheilutapahtuma

SELL Student Games kansainvälinen opiskelijaurheilutapahtuma SELL Student Games kansainvälinen opiskelijaurheilutapahtuma Painonnosto 13.5.2016 (kansallinen, CUP) Below in English Paikka: Nääshalli Näsijärvenkatu 8 33210 Tampere Alustava aikataulu: Punnitus 12:00-13:00


Metsälamminkankaan tuulivoimapuiston osayleiskaava

Metsälamminkankaan tuulivoimapuiston osayleiskaava VAALAN KUNTA TUULISAIMAA OY Metsälamminkankaan tuulivoimapuiston osayleiskaava Liite 3. Varjostusmallinnus FCG SUUNNITTELU JA TEKNIIKKA OY 12.5.2015 P25370 SHADOW - Main Result Assumptions for shadow calculations



FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists



Supplies Supplies - 239150-2018 05/06/2018 S105 - - Supplies - Contract notice - Open procedure I. II. III. IV. VI. Finland-Oulu: Medical equipments 2018/S 105-239150 Contract notice Supplies Directive 2014/24/EU


Rintasyöpä Suomessa. Mammografiapäivät Tampere 26.6.2009. Risto Sankila. Ylilääkäri, Suomen Syöpärekisteri, Helsinki

Rintasyöpä Suomessa. Mammografiapäivät Tampere 26.6.2009. Risto Sankila. Ylilääkäri, Suomen Syöpärekisteri, Helsinki Rintasyöpä Suomessa Mammografiapäivät Tampere 26.6.2009 Risto Sankila Ylilääkäri, Suomen Syöpärekisteri, Helsinki Suomen Syöpärekisteri Syöpätautien tilastollinen ja epidemiologinen tutkimuslaitos... syöpärekisteri


2017/S Contract notice. Supplies

2017/S Contract notice. Supplies Supplies 153936 2017 25/04/2017 S80 - - Supplies - Contract notice - Open procedure I. II. III. IV. VI. -: Medical equipments, pharmaceuticals and personal care products 2017/S 080-153936 Contract notice


On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs


Sakari Hietanen TYKS/Gynekologinen syövänhoito

Sakari Hietanen TYKS/Gynekologinen syövänhoito Sakari Hietanen TYKS/Gynekologinen syövänhoito Ei sidonnaisuuksia 900 Kohdun runko- osan syövän insidenssi 800 700 600 500 400 300 200 100 0 1957-1961 1962-1966 1967-1971 1972-1976 1977-1981 1982-1986


Surveillance and epidemiology of hepatitis C in Finland

Surveillance and epidemiology of hepatitis C in Finland Surveillance and epidemiology of hepatitis C in Finland Markku Kuusi MD, PhD National Institute for Health and Welfare Infectious Disease Control Unit Register-based data [National Infectious Disease Register


Käsitys rintasyövän patogeneesistä ja hoidosta

Käsitys rintasyövän patogeneesistä ja hoidosta Katsaus Marjut Leidenius Säästävä kirurgia on vakiinnuttanut asemansa rintasyövän hoitomuotona maassamme. Suurimpana ongelmana on syövän taipumus uusiutua leikatussa rinnassa. Säästävän leikkauksen jälkeiset



TM ETRS-TM35FIN-ETRS89 WTG SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579


Levinneen rintasyövän oraalinen lääkehoito. Paula Poikonen- Saksela LT, erikoislääkäri HUS Syöpäkeskus

Levinneen rintasyövän oraalinen lääkehoito. Paula Poikonen- Saksela LT, erikoislääkäri HUS Syöpäkeskus Levinneen rintasyövän oraalinen lääkehoito Paula Poikonen- Saksela LT, erikoislääkäri HUS Syöpäkeskus ETÄPESÄKKEINEN RINTASYÖPÄ 20-30 %:lle rintasyövän sairastaneista kehi@yy taudin metastasoinc Keskimääräinen


( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145

( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145 OX2 9 x N131 x HH145 Rakennuskanta Asuinrakennus Lomarakennus Liike- tai julkinen rakennus Teollinen rakennus Kirkko tai kirkollinen rak. Muu rakennus Allas Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 2 km


Rintasyövän hoitosuositus

Rintasyövän hoitosuositus KÄYPÄ HOITO Diagnostiikka Rintasyövän epidemiologiaa, seulontaa ja diagnostiikkaa koskeva suositus julkaistaan erikseen. Luokitus Rintasyövän hoitoratkaisut pohjautuvat pitkälti leikkauksen jälkeiseen


Molekyyligeneettiset testit syövän hoidon suuntaajina. Laura Lahtinen Molekylibiologi, FT Patologia Keski-Suomen keskussairaala

Molekyyligeneettiset testit syövän hoidon suuntaajina. Laura Lahtinen Molekylibiologi, FT Patologia Keski-Suomen keskussairaala Molekyyligeneettiset testit syövän hoidon suuntaajina Laura Lahtinen Molekylibiologi, FT Patologia Keski-Suomen keskussairaala Perinteisesti kasvaimet on luokiteltu histologian perusteella Samanlainen


Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a

Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a , Tuulivoimahanke Layout 9 x N131 x HH145 Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 km 2 SHADOW - Main Result Assumptions for shadow calculations


Asiakaspalautteen merkitys laboratoriovirheiden paljastamisessa. Taustaa

Asiakaspalautteen merkitys laboratoriovirheiden paljastamisessa. Taustaa Asiakaspalautteen merkitys laboratoriovirheiden paljastamisessa Paula Oja, TtT Laboratorio, Oulun yliopistollinen sairaala Potilasturvallisuustutkimuksen päivät 26. 27.1.2011 1 Taustaa Laboratorion tulee


Rintasyövän uudet täsmälääkehoidot

Rintasyövän uudet täsmälääkehoidot Petri Bono ja Heikki Joensuu RINTASYÖPÄ Ajatus rintasyövän hoidosta täsmälääkkeillä ei ole uusi. Täsmälääkkeenä voidaan jo pitää kohteeseensa (estrogeenireseptoriin) spesifisesti sitoutuvaa, tehokasta



MITEN TOIMIA, KUN KAIKKI YMPÄRILLÄ MUUTTUU? PAULI WAROMA MITEN TOIMIA, KUN KAIKKI YMPÄRILLÄ MUUTTUU? 14.3.2019 PAULI WAROMA 450 400 350 300 250 200 150 100 50 0 2012 2013 2014 2015 2016 2017 450 400 350 300 250 200 150 100 50 0 2012 2013 2014 2015 2016 2017


This notice in TED website:

This notice in TED website: 1 / 6 This notice in TED website: -Vantaa: Health and social work services 2017/S 198-408042 Social and other specific services public contracts


HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism

HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism Final SmPC and PL wording agreed by PhVWP December 2011 SUMMARY OF PRODUCT CHARACTERISTICS New Class Warnings


Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii

Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of


( ,5 1 1,5 2 km

( ,5 1 1,5 2 km Tuulivoimala Rakennukset Asuinrakennus Liikerak. tai Julkinen rak. Lomarakennus Teollinen rakennus Kirkollinen rakennus Varjostus "real case" h/a 1 h/a 8 h/a 20 h/a 4 5 3 1 2 6 7 8 9 10 0 0,5 1 1,5 2 km


Neuroendokriinisten syöpien lääkehoito

Neuroendokriinisten syöpien lääkehoito Page 1 of 5 JULKAISTU NUMEROSSA 3/2015 TEEMAT Neuroendokriinisten syöpien lääkehoito Maija Tarkkanen / Kirjoitettu 16.6.2015 / Julkaistu 13.11.2015 Neuroendokriinisten (NE) syöpien ilmaantuvuus lisääntyy,
