Sukupuolijutut 3. Ihmisen (nisäkkään) seksuaalikromosomi on Y. Y-kromosomi?
|
|
- Pirjo Manninen
- 8 vuotta sitten
- Katselukertoja:
Transkriptio
1 Sukupuolijutut 3 Ihmisen (nisäkkään) seksuaalikromosomi on Y Y-kromosomi?
2 m/nature/focus/ychro mosome/index.html
3 Ihmisen X-kromosomi on normaali kromosomi Y on erikoinen - kooltaan vain kolmannes - geenejä vain sadannes (eli 1%) - silti konjugoituu vielä X:n kanssa meioosissa Kehityksessä erottuu neljä hyppäysvaihetta, joissa X/Y rekombinaatio on estynyt tietyllä alueella todennäköisesti inversion takia ja johtanut Y:n rapautumiseen Miten ihmeessä se voidaan tietää??
4 Lahn ja Page etsivät ja löysivät Y-kromosomista yhdeksäntoista X:n kanssa homologista geeniä, joista osa on ns. pseudogeenejä: oikean näköisiä mutta selvästi rappeutuneita (STOP-kodoneita ja frameshiftejä). Jotkut ovat vielä vanhassa ryhmityksessä. Verrattaessa homologien erilaistumista ne jaettiin 4 ikäkerrostumaan. Vanhimmassa kerroksessa ovat vanhat alleelit SOX3 ja SRY (proteiinissa 29% ero). Ero on tapahtunut noin miljoonaa vuotta sitten, pian lintujen ja nisäkkäiden erottua (silloin tosin molemmat olivat aika lailla dinosauruksia) Y:ssä syntyneet inversiot ovat estäneet rekombinaation X:n kanssa 4 vaiheessa, joista viimeisinkin tapahtui jo miljoonaa vuotta sitten.
5 Muistutus: Parasentrinen inversio Crossing over -juosteissa on 2 tai 0 sentromeeria, joten ne eivät joudu gameetteihin ikinä
6 Monotremata Semmonen on laki, että jos ei ole rekombinaatiota, geenit rappeutuvat
7 Tästä eteenpäin voit selailla kuvia omalla vastuulla. Y-kromosomin erikoislaatu (haploidia, sukupuolirajoittuneisuus) tekevät siitä hyvän, mieshistoriaa syvältä kaivelevan markkerin. Havaintoaineistot eivät vielä ole kovin kattavia maantieteellisesti, mutta tilanne kehittyy koko ajan
8 Science 10 Nov 2000
9 Science 10 Nov 2000
10 Science 10 Nov 2000
11 Vihreä Haplotyyppi Eu18 Keskus Iberian jääkausirefugiossa, niin kuin monilla eläimillä ja kasveilla [mtdna haploryhmät V ja H] Korrelaatio baskien kieleen on selvä Science 10 Nov 2000
12 Vihreä Haplotyyppi Eu18 Keskus Iberian jääkausirefugiossa, niin kuin monilla eläimillä ja kasveilla M173, vihreän ja violetin yhteinen juuri on vuotta vanha, ehkä Aurignacsetlementin ajoilta Science 10 Nov 2000
13 Violetti Haplotyyppi Eu19 Keskus nykyisen Ukrainan seudun glasiaalirefugiossa, josta se on levinnyt Eurooppaan, mutta myös itään (Pohjois- Intia ja Pakistan) Korrelaatit: Yamnaia-kulttuuri ja indoeurooppalainen kieliperhe Science 10 Nov 2000
14 Punainen Haplot Eu9-11 Punaiseksi on väritetty laajan M89-merkityn haaran basaalityyppejä, joiden levinneisyyden painopiste on Lähi- Idässä Turkki Georgia Syyria Libanon Science 10 Nov 2000
15 Sininen Haplot Eu7 ja Eu8 Estimoitu ikä (M170) on vuotta Levinneisyys rajoittunut Eurooppaan (Eu7) Eu8 sisältää uuden mutaation M26 ja löytyy baskeilta ja sardinialaisilta Science 10 Nov 2000
16 TAT -markkerin painopiste on Aasiassa saamelaiset udmurtit marit Science 10 Nov 2000
17 Science 10 Nov 2000:1080
18 Science 10 Nov 2000:1080
19
20
21
22 Genetics Jan 2002
23 Y-kromosomin rakenteesta ja sisällöstä (todella ylimääräistä) Figure 7 Plot of Ks (Supplementary Table 5) versus X-linked gene order for 31 X Y gene (or gene/pseudogene) pairs. Colour highlighting of X-linked gene names indicates whether Y homologues are X-degenerate (yellow), ampliconic (blue) or X-transposed (pink). Within the plot, four yellow rectangles denote four previously defined 'evolutionary strata', or groups of genes26; a small pink rectangle highlights two X-transposed genes. Genes in the X chromosome are ordered according to the NCBI sequence assembly of November 2002; distances between genes are not drawn to scale. Standard errors for Ks values are shown.
24 Figure 6 Molecular evolutionary pathways and processes that gave rise to genes in three MSY euchromatic sequence classes. X-degenerate genes and pseudogenes (yellow background) derived from an autosomal pair that was ancestral to both the X and Y chromosomes (and that was enlarged by subsequent fusion with other autosomes or autosomal segments50). X-transposed genes (pink background) derived from X-linked genes, which in turn derived from the ancestral autosomal pair. Ampliconic genes (blue background) were derived through three converging processes: amplification of X-degenerate genes (for example, RBMY, VCY); transposition and amplification of autosomal genes (DAZ); and retroposition and amplification of autosomal genes (CDY). Boxes enumerate dominant themes in X-degenerate (yellow) and ampliconic (blue) gene evolution. The asterisk indicates that Y Y gene conversion is apparently common in the 61% of ampliconic sequences that exhibit intrachromosomal identities of 99.9%.
25 Figure 5 Sequence similarities within the MSY. a, Triangular dot plot in which the MSY's sequence is compared to itself. Within the plot, each dot represents a match of >65% within a window of 2,000 nucleotides. Green dots represent matches of this quality between LINE1 elements; red dots represent matches between heterochromatic sequences; blue dots represent matches between all other sequences. Direct repeats appear as horizontal lines, inverted repeats as vertical lines, and palindromes as vertical lines that nearly intersect the baseline. Long arrays of tandem repeats appear as pyramids. The inset indicates that the large triangular plot contains two smaller triangles (one revealing sequence similarities within Yp, and one revealing similarities within Yq) and a rectangle (revealing similarities between Yp and Yq). b, MSY schematic, as in Fig. 1b. c, Plot of intrachromosomal sequence similarity, which serves to identify ampliconic sequences (blue). Using a 50-kb sliding window and 1-kb steps, each MSY euchromatic sequence was compared to all other available MSY euchromatic sequences. (Long interspersed repeats were excluded before analysis.) At each point along the length of the MSY, the highest sequence similarity (expressed as per cent nucleotide identity) was identified. All such values >50% are shown. An expanded version of this plot is shown in Fig. 2f.
26 HUMAN Y CHROMOSOME: AN EVOLUTIONARY MARKER COMES OF AGE Mark A. Jobling & Chris Tyler-Smith about the authors Preface Until recently, the Y chromosome seemed to fulfil the role of juvenile delinquent among human chromosomes rich in junk, poor in useful attributes, reluctant to socialize with its neighbours and with an inescapable tendency to degenerate. The availability of the near-complete chromosome sequence, plus many new polymorphisms, a highly resolved phylogeny and insights into its mutation processes, now provide new avenues for investigating human evolution. Y-chromosome research is growing up. Summary The human Y chromosome is male-sex-determining and haploid, and so escapes recombination for most of its length. Haplotypes, which can be defined by the many binary markers and microsatellites that are available, pass down paternal lineages and change only by mutation. A small effective population size and the practice of patrilocality accentuate drift, which leads to the marked geographical differentiation of Y haplotypes. This makes the Y chromosome a powerful tool for investigating events in human genetic history. The study of mutation on the Y chromosome clarifies intra-allelic processes in general, and provides specific information about mutation rates that is useful in estimating the coalescent times of lineages. Intrachromosomal paralogous sequences are plentiful and cause pathogenic and non-pathogenic structural rearrangements. Selection might be important in shaping Y-chromosome diversity in populations, but it has been difficult to identify. Some studies show associations between deleterious phenotypes and particular haplotypes, but these associations are weak; some coalescence times are younger than expected, which indicates recent selection, but these estimates are uncertain, and population phenomena might be an alternative explanation. The phylogeny of binary Y haplogroups is well established, but the dates of branchpoints are uncertain. Many populations have been poorly sampled, and there is ascertainment bias in the set of available binary markers. The recent coalescence time, rooting of the Y phylogeny in Africa and evidence for an 'Out-of-Africa' range expansion, all show that modern Y-chromosome diversity arose recently in Africa and replaced Y chromosomes elsewhere. The pattern of Y-chromosome variation broadly fits a model of a southern migration that reached Australia, and a northern migration into Eurasia. Many features of the patterns of modern Y-chromosome diversity reflect later range expansions and contractions that were driven by changes in climate and lifestyle. Long-term population size, social structures and social selection have also been important. Future developments in the field are likely to include more markers, and a move towards the unbiased resequencing of samples. Other parts of the genome might show a 'haplotype-block' structure that is made up of regions of strong linkage disequilibrium. If this is so, then methods pioneered in the analysis of the Y chromosome could be widely applicable.
27 Nature Genetics 4 April 2006
28
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
Counting quantities 1-3
Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X. Rastita Tick (X) (X) the kummassa box that has laatikossa
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
HARJOITUS- PAKETTI A
Logistiikka A35A00310 Tuotantotalouden perusteet HARJOITUS- PAKETTI A (6 pistettä) TUTA 19 Luento 3.Ennustaminen County General 1 piste The number of heart surgeries performed at County General Hospital
Statistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region
The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region The BaltCICA Project is designed to focus on the most imminent problems that climate change is likely to cause
EUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä
M a t t i K a t t a i n e n O T M 1 1. 0 9. 2 0 1 9 Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä Ympäristöoikeustieteen
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
SSTY:n EMC-seminaari. EMC ja sähköisten lääkintälaitteiden standardit. Ari Honkala SESKO ry
SSTY:n EMC-seminaari EMC ja sähköisten lääkintälaitteiden standardit SESKO ry 2016-10-04 Tässä esityksessä käsitellään Yleistä täydentävistä (collateral, -1 sarja, horisontaaliset) ja eritysvaatimuksia
Ajettavat luokat: SM: S1 (25 aika-ajon nopeinta)
SUPERMOTO SM 2013 OULU Lisämääräys ja ohje Oulun Moottorikerho ry ja Oulun Formula K-125ry toivottaa SuperMoto kuljettajat osallistumaan SuperMoto SM 2013 Oulu osakilpailuun. Kilpailu ajetaan karting radalla
MUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
The Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
Digital Admap Native. Campaign: Kesko supermarket
Digital Admap Native Campaign: Kesko supermarket Digital Admap Native Campaign: Kesko Supermarket Mainosmuoto: Natiivi Media: IS.fi Campaign period: 25 September Date of measurement: 26 September Unique:
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
Tilausvahvistus. Anttolan Urheilijat HENNA-RIIKKA HAIKONEN KUMMANNIEMENTIE 5 B RAHULA. Anttolan Urheilijat
7.80.4 Asiakasnumero: 3000359 KALLE MANNINEN KOVASTENLUODONTIE 46 51600 HAUKIVUORI Toimitusosoite: KUMMANNIEMENTIE 5 B 51720 RAHULA Viitteenne: Henna-Riikka Haikonen Viitteemme: Pyry Niemi +358400874498
Sisällysluettelo Table of contents
Sisällysluettelo Table of contents OTC:n Moodlen käyttöohje suomeksi... 1 Kirjautuminen Moodleen... 2 Ensimmäinen kirjautuminen Moodleen... 2 Salasanan vaihto... 2 Oma käyttäjäprofiili... 3 Työskentely
Tietorakenteet ja algoritmit
Tietorakenteet ja algoritmit Taulukon edut Taulukon haitat Taulukon haittojen välttäminen Dynaamisesti linkattu lista Linkatun listan solmun määrittelytavat Lineaarisen listan toteutus dynaamisesti linkattuna
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto If you are searched for a book by Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice over LTE (VoLTE) in pdf form, then you have come
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
Functional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
1. Liikkuvat määreet
1. Liikkuvat määreet Väitelauseen perussanajärjestys: SPOTPA (subj. + pred. + obj. + tapa + paikka + aika) Suora sanajärjestys = subjekti on ennen predikaattia tekijä tekeminen Alasääntö 1: Liikkuvat määreet
Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia
Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays
Counting quantities 1-3
Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X 2. Rastita Tick (X) (X) the kummassa box that has
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
MEETING PEOPLE COMMUNICATIVE QUESTIONS
Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.
Supporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE
Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE November 7, 2014 Paula Kilpinen 1 7.11.2014 Aalto University
Basic Flute Technique
Herbert Lindholm Basic Flute Technique Peruskuviot huilulle op. 26 Helin & Sons, Helsinki Basic Flute Technique Foreword This book has the same goal as a teacher should have; to make himself unnecessary.
TIEKE Verkottaja Service Tools for electronic data interchange utilizers. Heikki Laaksamo
TIEKE Verkottaja Service Tools for electronic data interchange utilizers Heikki Laaksamo TIEKE Finnish Information Society Development Centre (TIEKE Tietoyhteiskunnan kehittämiskeskus ry) TIEKE is a neutral,
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
Työsuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016. Peter Michelsson Wallstreet Asset Management Oy
Työsuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016 Peter Michelsson Wallstreet Asset Management Oy Wallstreet lyhyesti Perustettu vuonna 2006, SiPa toimilupa myönnetty 3/2014 Täysin kotimainen,
Huom. tämä kulma on yhtä suuri kuin ohjauskulman muutos. lasketaan ajoneuvon keskipisteen ympyräkaaren jänteen pituus
AS-84.327 Paikannus- ja navigointimenetelmät Ratkaisut 2.. a) Kun kuvan ajoneuvon kumpaakin pyörää pyöritetään tasaisella nopeudella, ajoneuvon rata on ympyränkaaren segmentin muotoinen. Hitaammin kulkeva
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
ELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period
1 ELEMET- MOCASTRO Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions Period 20.02-25.05.2012 Diaarinumero Rahoituspäätöksen numero 1114/31/2010 502/10
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto Tämän viestinnän, nykysuomen ja englannin kandidaattiohjelman valintakokeen avulla Arvioidaan viestintävalmiuksia,
Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO
Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO Tomi Kauppinen, Eero Hyvönen, Jari Väätäinen Semantic Computing Research Group (SeCo) http://www.seco.tkk.fi/
Smart specialisation for regions and international collaboration Smart Pilots Seminar
Smart specialisation for regions and international collaboration Smart Pilots Seminar 23.5.2017 Krista Taipale Head of Internaltional Affairs Helsinki-Uusimaa Regional Council Internationalisation
NAO- ja ENO-osaamisohjelmien loppuunsaattaminen ajatuksia ja visioita
NAO- ja ENO-osaamisohjelmien loppuunsaattaminen ajatuksia ja visioita NAO-ENO työseminaari VI Tampere 3.-4.6.2015 Projektisuunnittelija Erno Hyvönen erno.hyvonen@minedu.fi Aikuiskoulutuksen paradigman
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät
PAINEILMALETKUKELA-AUTOMAATTI AUTOMATIC AIR HOSE REEL
MAV4 MAV5 MAV6 PAINEILMALETKUKELA-AUTOMAATTI AUTOMATIC AIR HOSE REEL Käyttöohje Instruction manual HUOMIO! Lue käyttöohjeet huolellisesti ennen laitteen käyttöä ja noudata kaikkia annettuja ohjeita. Säilytä
KMTK lentoestetyöpaja - Osa 2
KMTK lentoestetyöpaja - Osa 2 Veijo Pätynen 18.10.2016 Pasila YHTEISTYÖSSÄ: Ilmailun paikkatiedon hallintamalli Ilmailun paikkatiedon hallintamalli (v0.9 4.3.2016) 4.4 Maanmittauslaitoksen rooli ja vastuut...
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
1.3 Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 811122P (5 op.) 12.12.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? 10.10.01 Tuomo Suortti Ohjelman päällikkö Riina Antikainen Ohjelman koordinaattori 10/11/01 Tilaisuuden teema Kansainvälistymiseen
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
Olet vastuussa osaamisestasi
Olet vastuussa osaamisestasi Ohjelmistoammattilaisuuden uudet haasteet Timo Vehmaro 02-12-2015 1 Nokia 2015 Mitä osaamista tulevaisuudessa tarvitaan? Vahva perusosaaminen on kaiken perusta Implementaatio
RULLARADAT RULLADAT ROLLER TABLES
ROLLER TABLES Roller tables are an important element in an assembly line, where ergonomics and good workflow must be ensured. The roller tables guarantee that the wheels can be fed forward effortlessly
Salasanan vaihto uuteen / How to change password
Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
Valuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
Julkaisun laji Opinnäytetyö. Sivumäärä 43
OPINNÄYTETYÖN KUVAILULEHTI Tekijä(t) SUKUNIMI, Etunimi ISOVIITA, Ilari LEHTONEN, Joni PELTOKANGAS, Johanna Työn nimi Julkaisun laji Opinnäytetyö Sivumäärä 43 Luottamuksellisuus ( ) saakka Päivämäärä 12.08.2010
LUONNOS RT 80260 EN AGREEMENT ON BUILDING WORKS 1 THE PARTIES. May 1998 1 (10)
RT 80260 EN May 1998 1 (10) AGREEMENT ON BUILDING WORKS This agreement template is based on the General Terms and Conditions of Building Contracts YSE 1998 RT 16-10660, LVI 03-10277, Ratu 417-7, KH X4-00241.
OFFICE 365 OPISKELIJOILLE
OFFICE 365 OPISKELIJOILLE Table of Contents Articles... 3 Ohjeet Office 365 käyttöönottoon... 4 One Driveen tallennetun videon palauttaminen oppimisympäristön palautuskansioon... 5 Changing default language
Läpimurto ms-taudin hoidossa?
Läpimurto ms-taudin hoidossa? Läpimurto ms-taudin hoidossa? Kansainvälisen tutkijaryhmän kliiniset kokeet uudella lääkkeellä antoivat lupaavia tuloksia sekä aaltoilevan- että ensisijaisesti etenevän ms-taudin
Accommodation statistics
Transport and Tourism 2011 Accommodation statistics 2011, January Nights spent by foreign tourists in Finland increased by per cent in January The number of recorded nights spent by foreign tourists at
Pricing policy: The Finnish experience
Pricing policy: The Finnish experience Esa Österberg Senior Researcher Alcohol and Drug Research, STAKES, Helsinki, Finland esa.osterberg@stakes.fi Three pillars of traditional Nordic alcohol control Strict
Fraktaalit. Fractals. Riikka Kangaslampi Matematiikan ja systeemianalyysin laitos Aalto-yliopisto. 1 / 8 R. Kangaslampi Fraktaalit
Fraktaalit Fractals Riikka Kangaslampi Matematiikan ja systeemianalyysin laitos Aalto-yliopisto 5.-7.10.2012 1 / 8 R. Kangaslampi Fraktaalit Bottomless wonders spring from simple rules, which are repeated
Finland, Data Sources Last revision: 01-11-2011
Finland, Data Sources Last revision: 01-11-2011 LIVE BIRTHS Live births by age/cohort of mother 1976-1981: Väestö 1976-1981 Osa I, Väestörakenne ja väestönmuutokset, Koko maa ja läänit. Suomen Virallinen
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä. public-procurement
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä https://ec.europa.eu/futurium/en/ public-procurement Julkiset hankinnat liittyvät moneen Konsortio Lähtökohdat ja tavoitteet Every
Eukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
toukokuu 2011: Lukion kokeiden kehittämistyöryhmien suunnittelukokous
Tuula Sutela toukokuu 2011: Lukion kokeiden kehittämistyöryhmien suunnittelukokous äidinkieli ja kirjallisuus, modersmål och litteratur, kemia, maantiede, matematiikka, englanti käsikirjoitukset vuoden
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
Travel Getting Around
- Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL Ville Liljeström, Micha Matusewicz, Kari Pirkkalainen, Jussi-Petteri Suuronen and Ritva Serimaa 13.3.2012
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Exercise 1. (session: )
EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You
Telecommunication Software
Telecommunication Software Final exam 21.11.2006 COMPUTER ENGINEERING LABORATORY 521265A Vastaukset englanniksi tai suomeksi. / Answers in English or in Finnish. 1. (a) Määrittele sovellusviesti, PersonnelRecord,
Hankkeen toiminnot työsuunnitelman laatiminen
Hankkeen toiminnot työsuunnitelman laatiminen Hanketyöpaja LLP-ohjelman keskitettyjä hankkeita (Leonardo & Poikittaisohjelma) valmisteleville11.11.2011 Työsuunnitelma Vastaa kysymykseen mitä projektissa
812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
AYYE 9/ HOUSING POLICY
AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we
PRODUCT CATALOGUE - TUOTEKUVASTO 9/2015 BIRCH CRYSTALS - KOIVUKRISTALLIT
PRODUCT CATALOGUE - TUOTEKUVASTO 9/2015 BIRCH CRYSTALS - KOIVUKRISTALLIT 1. Birch crystal decoration - Koivukristalli-koristeet 3. Himmel mobiles - Himmeli-mobilet 5. Christmas tree star - Joulukuusen
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Supporting information
Supporting information Figure S1. Carotenoid biosynthesis pathway in papaya fruit which is adopted from Blas et al. (2010) (reference 4) and Nisar et al. (2015) (reference 5). Carotenoids are synthesized
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.2017 Life Science Technologies Where Life Sciences meet with Technology