Normaalimikrobiston uusi tuleminen

Koko: px
Aloita esitys sivulta:

Download "Normaalimikrobiston uusi tuleminen"

Transkriptio

1 PEOPLE ARE NOT JUST PEOPLE. THEY ARE AN AWFUL LOT MICROBES, TOO (The Economist 2012) Normaalimikrobiston uusi tuleminen FM Eveliina Munukka Projektitutkija Lee & Mazmanian, Science 2010 NORMAALIMIKROBISTON UUSI TULEMINEN NORMAALIMIKROBISTON UUSI TULEMINEN Ray K. Nature Rev.Gast. & Hepatol Jones S. Nat. Biotechnol

2 MIKROBIT LUONNOSSA SUOLISTOMIKROBISTO Koko elinympäristömme on täynnä mikrobeja Mikrobit ovat välttämättömiä elämälle Ruuansulatuskanavan mikrobisto, suusta suolistoon, on kompleksinen ja erittäin monimutkainen ekosysteemi: ihmisen kehossa 10 x enemmän mikrobeja kuin ihmisen omia soluja paksusuolessa bakteeritiheys jopa 10^11-12 / g suolen sisältöä ns. yhteinen core : 160 lajia oli yleisesti samoja eri yksilöillä 75 lajia >50 %:lla tutkituista Ihminen on kehittynyt yhdessä mikrobien kanssa 57 lajia >90 %:lla (Qin et al. 2010, Nature 2010) Suolistossa arvioidaan olevan eri bakteerilajia, joista viljeltävissä vain murto-osa intensiivisestä tutkimuksesta huolimatta tarkka lajikoostumus edelleen epäselvä Entäpä toiminnallisuus? Mikrobiomi sisältää 100 x enemmän geenejä kuin ihmisen genomi SUOLISTOMIKROBISTO SUOLISTOMIKROBISTON KOOSTUMUS Terveyden kannalta merkittäviä sukuja ja ryhmiä: Aktinobakteerit: Bifidobakteerit, Coriobakteerit Firmikuutit: Klostridi-klusteri XIV, Faecalibacterium prausnitzii (ja muut sen kaltaiset butyraatin tuottajat) Laktobasillit, Basillit, Enterokokit, Streptokokit 90 % lajeista kuuluvat Firmikuutteihin, Aktinobakteereihin sekä Bacteroidetes-ryhmään Bacteroidetes: Bacteroides sp., Prevotella sp. Proteobakteerit: Pääasiassa patogeeneja kuten Salmonella, E. coli Eukarya Esim. Candida Eri mikrobiryhmät, -suvut ja lajit dominoivat eri osissa suolistoa. 2

3 SUOLISTOMIKROBISTON TAKSONOMIAA MIKROBISTO - IHMISEN TUNTEMATTOMIN ELIN PERINTEINEN TAPA MODERNIT MOLEKYYLIBIOLOGISET MENETELMÄT VILJELY viljeltävissä murto-osa, anaerobeja hidasta monimutkaiset kasvu-alustat suolen anaerobiolosuhteet vaativat anerobiviljelyä käsityötä DNA:N MONISTUKSEEN PERUSTUVAT MENETELMÄT PCR, mikrobisto-chipit ym. DNA-eristys aiheuttaa aina vaihtelua tuloksiin tietyt ryhmät yli- tai alikorostuvat IN SITU -HYBRIDISAATIO kokosoluhybridisaatio, ei sisällä DNA:n eristysvaihetta valokuva sekä kuolleet että elävät solut voidaan laskea KVANTITATIIVINEN määritys Vrieze A et al Diabetologia Taksonomia perustuu nykyään suurelta osin ribosomaaliseen 16S geeniin ja molekyyliin NGS MENETELMÄT metagenomiikka metatranskriptomiikka metaproteomiikka IHMINEN ON KÄVELEVÄ MIKROBIEN ELATUSALUSTA Kohdussa ihminen on steriili - mikrobien kolonisaatio tapahtuu synnytyskanavassa ja muissa synnyksen jälkeisissä kontakteissa ns. alkuymppi Elämänsä aikana ihminen elää enemmän tai vähemmän sopuisissa väleissä mikrobien kanssa (commensal microbes) 3

4 MIKROBISTON TERVEYSVAIKUTUKSET SUOLISTOMIKROBISTO JA SAIRAUDET TAUSTALLA DYSBIOOSI? Perinteisesti mikrobeja on pidetty yksinomaan taudinaiheuttajina esim. E. coli, Salmonella, Yersinia, Campylobacteria, Listeria 1.Terve mikrobisto on välttämätön ihmisen terveyden kannalta 2.Kolonisaatioresistenssi suojaa elimistöä erilaisilta taudinaiheuttajilta 3.Fermentoi paksusuolessa ravintoaineita esim. kuidut ja muut monimutkaiset hiilihydraatit 4. Tuottaa välttämättömiä yhdisteitä kuten K- ja B12- vitamiineja sekä erilaisia metaboliitteja esim. butyraattia 5. Osallistuu immuunijärjestelmän kehitykseen & säätelyyn ja ylläpitoon Festi D et al. Dig. Dis SUOLISTOMIKROBISTON EPÄTASAPAINOON ASSOSIOITUJA SAIRAUKSIA Tulehdukselliset suolistosairaudet (IBS, IBD, Crohn) Autoimmuunitaudit (Keliakia, reuma, tyypin 1 diabetes) Ylipaino ja sen liitännäissairaudet Syöpä Allergiat ja astma Psyykkiset sairaudet (depressio, autismi ym) CERF-BENSUSSAN ET AL.NAT. IMMUNOLOGY

5 HYGIENIAHYPOTEESI, ALLERGIA JA MIKROBISTO MIKROBISTO JA SUOLISTOSAIRAUDET Potilaat, joilla kroonisia suolistosairauksia eroavat merkittävästi suolistomikrobiston koostumuksen osalta terveistä verrokeista N Engl J Med, 2002 Qin et al. Nature

6 MIKROBISTO JA TYYPIN 1 DIABETES SUOLEN MIKROBISTO MUOKKAA AIVOJEN KEHITYSTÄ JA KÄYTTÄYTYMISTÄ Bakteerit pääsevät vagushermon kautta aivoihin? (Braak et al. J Neural Transm 2003) GF-hiirten ja verrokkihiirten aivojen toiminnassa on merkittäviä eroja erit. neurotransmittereiden ja synaptisten proteiinien erityksessä, jotka voivat selittää erot hiirten käytöksessä (Diaz Heijtz et al. PNAS 2011) Funktionaalinen GUT-BRAIN-MICROBE -AXIS Mean proportion of the 11 most abundant genera that differ significantly between cases and controls (p value 0.01). Brown CT ET AL. PLoS ONE 2011 MIKROBISTO JA SUOLISTOSYÖPÄ SUOLISTON BAKTEERISTO JA LIHAVUUS Mikrobien käynnistämä suolen seinämän solujen reseptorien aktivointi lisää syövän kasvua Monimutkainen järjestelmä, jossa mikrobeilla on merkittävä osuus GF -hiirille annettu normaalin hiiren suolen sisältö johti rasvakudoksen lisääntymiseen 50%:lla 2 viikossa, vaikka hiiret verrokkeja niukemmalla dieetillä. Lee et al. Nat. Medicine 2010 (Bäckhed et al. PNAS 2004, 2007; Ley RE et al Nature 2006) Vaahtovuo et al. Livestock Sci

7 26 MIKROBISTO, LIHAVUUS JA AINEENVAIHDUNTA LAIHOJEN JA LIHAVIEN MIKROBISTON ERO Bäckhed et al. PNAS 2004 Cani & Delzenne, Pharmacology & therapeutics, 2011 Turnbaugh et al. Nature 2009 MIKROBISTO, MATALA-ASTEINEN TULEHDUS & LIHAVUUS MIKROBISTO JA RASVAMAKSA Rasvoittunut maksa, > 5 % Verrokit MicrObesity Cani & Delzenne, Pharmacology & therapeutics, 2011 Munukka et al. J Hepatol

8 Faecalibacterium prausnitzii Faecalibacterium prausnitzii Yksi yleisimmistä suolistobakteereista Ehdoton anaerobi, haasteellinen viljeltävä! A. Rintala Viimeaikainen tutkimus liittänyt Fpraun hyvään suolistoterveyteen ja suolinukan kuntoon anti-inflammatoriset vaikutukset, voihapon tuotanto (Sokol et al. PNAS, 2008) prof. Zhao Liping laihdutti lähes 20 kg kiinalaisia yrttejä sisältävällä prebioottisella dieetillä Fprau:n määrä lisääntyi hänen suolistossaan nollasta lähes 15%! MIKROBISTOTUTKIMUKSEN TULEVAISUUS Hattori M, and Taylor TD DNA Res

MIKROBILÄÄKKEIDEN KÄYTÖN VIATTOMAT UHRIT. Pentti Huovinen Bakteeriopin professori

MIKROBILÄÄKKEIDEN KÄYTÖN VIATTOMAT UHRIT. Pentti Huovinen Bakteeriopin professori MIKROBILÄÄKKEIDEN KÄYTÖN VIATTOMAT UHRIT Pentti Huovinen Bakteeriopin professori The evolving threat of antimicrobial resistance; Options for action; WHO, 2012 18.3.2013 Macrolide consumption vs. resistance

Lisätiedot

Kliinisesti merkittävien bakteerien jaottelua

Kliinisesti merkittävien bakteerien jaottelua Johdanto kliinisesti merkittäviin bakteereihin Miksi kliininen bakteriologia on tärkeää? Bakteerien luokittelusta Bakteeri-infektiot Patogeeni Tartunnanlähde Ennaltaehkäisy Bakteriologista diagnostiikkaa

Lisätiedot

Ravitsemus, terveys ja Suomen luonnosta saadut tuotteet. Raija Tahvonen

Ravitsemus, terveys ja Suomen luonnosta saadut tuotteet. Raija Tahvonen Ravitsemus, terveys ja Suomen luonnosta saadut tuotteet Raija Tahvonen Terveellinen ruokavalio on kasvivoittoinen Runsaasti: Kasviksia, marjoja ja hedelmiä Viljatuotteet pääosin täysjyväviljaa Kalaa ja

Lisätiedot

Luonto köyhtyy, me sairastumme mitä pitää tehdä?

Luonto köyhtyy, me sairastumme mitä pitää tehdä? Argumenta, Majvik 19.11.203 Luonto köyhtyy, me sairastumme mitä pitää tehdä? Tari Haahtela The striking contrast between Finnish and Russian Karelia von Hertzen L, and the Karelia Group. JACI 2006; Laakkonen

Lisätiedot

Luonnonmarjat ja kansanterveys. Raija Tahvonen MTT/BEL

Luonnonmarjat ja kansanterveys. Raija Tahvonen MTT/BEL Luonnonmarjat ja kansanterveys Raija Tahvonen MTT/BEL 15.8.2013 Jos poimit marjat itse, saat Liikuntaa Luonnossa liikkumisen hyvät vaikutukset aivoille Marjasi tuoreena Varman tiedot, mistä marjat ovat

Lisätiedot

PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter

Lisätiedot

tulehduksellisten suolistosairauksien yhteydessä

tulehduksellisten suolistosairauksien yhteydessä ADACOLUMN -HOITO tulehduksellisten suolistosairauksien yhteydessä www.adacolumn.net SISÄLTÖ Maha-suolikanava...4 Haavainen paksusuolitulehdus...6 Crohnin tauti...8 Elimistön puolustusjärjestelmä ja IBD...10

Lisätiedot

Hyvä tietää biofilmistä

Hyvä tietää biofilmistä Hyvä tietää biofilmistä S a i r a a l a h y g i e n i a p ä i v ä t 2 5. 3. 1 4 K a i s u R a n t a k o k k o - J a l a v a K l i i n i s e n m i k r o b i o l o g i a n e l, T y k s l a b Mitä biofilmit

Lisätiedot

BIOLÄÄKETIETEEN LÄPIMURROT

BIOLÄÄKETIETEEN LÄPIMURROT BIOLÄÄKETIETEEN LÄPIMURROT Jussi Huttunen Tampere 20.4.2016 LÄÄKETIETEEN MEGATRENDIT Väestö vanhenee ja sairauskirjo muuttuu Teknologia kehittyy - HOITOTEKNOLOGIA - tietoteknologia Hoito yksilöllistyy

Lisätiedot

Adacolumn -hoito tulehduksellisten suolistosairauksien yhteydessä

Adacolumn -hoito tulehduksellisten suolistosairauksien yhteydessä Adacolumn -hoito tulehduksellisten suolistosairauksien yhteydessä Hellävarainen vallankumous IBD-tautien hoidossa Sisältö Maha-suolikanava...4 Haavainen paksusuolitulehdus...6 Crohnin tauti...8 Elimistön

Lisätiedot

Vahva suolisto vahva vastustuskyky. Matti Vire 7.9.2013

Vahva suolisto vahva vastustuskyky. Matti Vire 7.9.2013 Ihmisen ruuansulatuksen muodostavat: Suu Mahalaukku Maksa (sappi) Haima Ohutsuoli Paksusuoli Peräsuoli Suun tehtävät: Pureskelu Syljen eritys Entsyymien eritys Mahalaukun tehtävät: Suolahapon eritys Pepsiinin

Lisätiedot

Urheilijan ravitsemus ja vastustuskyky - Valion tuotteet urheilijan ravitsemuksessa

Urheilijan ravitsemus ja vastustuskyky - Valion tuotteet urheilijan ravitsemuksessa Urheilijan ravitsemus ja vastustuskyky - Valion tuotteet urheilijan ravitsemuksessa Infektiot, allergiat ja astma urheilussa sairaudet ja vammat urheilussa UKK-instituutti 5.11.2012 Marika Laaksonen, ETT,

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

Mitä ovat probiootit?

Mitä ovat probiootit? Mitä ovat probiootit? Termi probioottinen merkitsee elämän puolesta. Whole Health -organisaation määritelmän mukaan probiootit ovat eläviä mikro-organismeja, jotka riittävissä määrissä ylläpidettyinä hyödyntävät

Lisätiedot

Ulosteen kalprotektiinimääritys kliinikon näkemys

Ulosteen kalprotektiinimääritys kliinikon näkemys Ulosteen kalprotektiinimääritys kliinikon näkemys SKKYn ja Sairaalakemistit ry:n koulutuspäivät 16.11.2012 Dosentti, sisätautien ja gastroenterologian erikoislääkäri Taina Sipponen 1 Kalprotektiinijulkaisut

Lisätiedot

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat

Lisätiedot

Bakteereja tunnistetaan a) muodon perusteella:

Bakteereja tunnistetaan a) muodon perusteella: Bakteereja tunnistetaan a) muodon perusteella: ja b) värjäytyvyyden perusteella: 1) Gram-positiiviset Soluseinän ulkokalvo värjäytyy 2) Gram negatiiviset Soluseinän ulkokalvo jää värjäytymättä Laborointi

Lisätiedot

KEESHONDIEN MONIMUOTOISUUSKARTOITUS

KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,

Lisätiedot

Jyväskylän yliopisto

Jyväskylän yliopisto SUOLISTON MIKROBISTON KOOSTUMUKSEN EROT JA YHTEYS VISKERAALISEN RASVAKUDOKSEN GEENIEN ILMENTYMISEEN HCR- JA LCR- ROTILLA Tiina Hongisto Liikuntalääketieteen pro gradu -tutkielma Terveystieteiden laitos

Lisätiedot

Suolisto ja vastustuskyky. Lapin urheiluakatemia koonnut: Kristi Loukusa

Suolisto ja vastustuskyky. Lapin urheiluakatemia koonnut: Kristi Loukusa Suolisto ja vastustuskyky Lapin urheiluakatemia koonnut: Kristi Loukusa Suoliston vaikutus terveyteen Vatsa ja suolisto ovat terveyden kulmakiviä -> niiden hyvinvointi heijastuu sekä fyysiseen että psyykkiseen

Lisätiedot

Mitä suoli edellä, sitä aivot perässä. Erkki Eerola Turun yliopisto

Mitä suoli edellä, sitä aivot perässä. Erkki Eerola Turun yliopisto Mitä suoli edellä, sitä aivot perässä Erkki Eerola Turun yliopisto N Engl J Med, Vol. 347, No. 12 September 19, 2002 Päämenetelmät bakteerien osoittamiseen näytteistä Bakteeriviljely Bakteereiden komponenttien

Lisätiedot

Allergia ja astma. Erkki Vartiainen, professori, ylijohtaja. 5.9.2012 Esityksen nimi / Tekijä 1

Allergia ja astma. Erkki Vartiainen, professori, ylijohtaja. 5.9.2012 Esityksen nimi / Tekijä 1 Allergia ja astma Erkki Vartiainen, professori, ylijohtaja 5.9.2012 Esityksen nimi / Tekijä 1 Aikuisväestön sekä lasten ja nuorten astma- ja allergiatutkimukset Pohjois- Karjalassa ja Pitkärannassa 5.9.2012

Lisätiedot

UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA

UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA LIITU-päivä 4.5.2006 FT Helena Rintala Kansanterveyslaitos, Ympäristöterveyden osasto Mihin sisäympäristön mikrobien mittauksia tarvitaan? Rakennusten

Lisätiedot

Ruoka- ja ravintoaineet 12

Ruoka- ja ravintoaineet 12 Sisällys Johdanto (Anna-Maija Tiainen) 9 1 Ruoka- ja ravintoaineet 12 Energia ja energiaravintoaineet (Senja Arffman) 13 Hiilihydraatit 14 Proteiinit 16 Rasvat 17 omega-3 ja -6 -rasvahapot 19 Alkoholi

Lisätiedot

Ihmisen mikrobiomit. Kehon mikrobiomien yleispiirteitä

Ihmisen mikrobiomit. Kehon mikrobiomien yleispiirteitä Anne Salonen KATSAUS Normaalibakteeristo yhä useamman taudin taustalla Ihmisen mikrobiomit Mikrobiomit ovat ihoa ja eri ruuminonteloiden limakalvoja asuttavia monimuotoisia bakteeriyhteisöjä. Kunkin kasvupaikan

Lisätiedot

RUOANSULATUS JA SUOLISTON KUNTO. Iida Elomaa & Hanna-Kaisa Virtanen

RUOANSULATUS JA SUOLISTON KUNTO. Iida Elomaa & Hanna-Kaisa Virtanen RUOANSULATUS JA SUOLISTON KUNTO Iida Elomaa & Hanna-Kaisa Virtanen Edellisen leirin Kotitehtävä Tarkkaile sokerin käyttöäsi kolmen päivän ajalta ja merkkaa kaikki sokeria ja piilosokeria sisältävät ruuat

Lisätiedot

Terveellinen kaura. Lumoudu kaurasta Kaurapäivä 1.10.2013. Kaisa Mensonen Leipätiedotus ry

Terveellinen kaura. Lumoudu kaurasta Kaurapäivä 1.10.2013. Kaisa Mensonen Leipätiedotus ry Terveellinen kaura Lumoudu kaurasta Kaurapäivä 1.10.2013 Kaisa Mensonen Leipätiedotus ry Mikä on Leipätiedotus? Leipomoalan yhteinen tiedotusyksikkö Perustettu 1961 Rahoitus Perusbudjetti jäsenmaksuista

Lisätiedot

Bakteeriston merkitys terveydelle avautuu vähitellen

Bakteeriston merkitys terveydelle avautuu vähitellen Katsaus tieteessä Pentti Huovinen LKT, kliinisen mikrobiologian erikoislääkäri, bakteeriopin professori Turun yliopisto tutkimusprofessori, Terveyden ja hyvinvoinnin laitos pentti.huovinen@utu.fi Bakteeriston

Lisätiedot

KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN

KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN Suomen Ympäristösairauskeskus perustettiin viime vuonna ajantasaisen ympäristösairaustiedon asiantuntijakeskukseksi. Tavoitteena on ajantasaisen,

Lisätiedot

Ihmiskeho. Ruoansulatus. Jaana Ohtonen Kielikoulu/Språkskolan Haparanda. söndag 16 februari 14

Ihmiskeho. Ruoansulatus. Jaana Ohtonen Kielikoulu/Språkskolan Haparanda. söndag 16 februari 14 Ihmiskeho Ruoansulatus Ruoansulatus Keho voi ottaa talteen ja käyttää hyvin pieniä molekyylejä. Useimmat ravintoaineet ovat suuria molekyllejä. Ravintoaineet on hajotettava pieniksi osasiksi ennen kuin

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

VASTASYNTYNEEN SUOLISTOFLOORAN MUODOSTUMINEN JA SIIHEN VAIKUTTAVAT TEKIJÄT

VASTASYNTYNEEN SUOLISTOFLOORAN MUODOSTUMINEN JA SIIHEN VAIKUTTAVAT TEKIJÄT VASTASYNTYNEEN SUOLISTOFLOORAN MUODOSTUMINEN JA SIIHEN VAIKUTTAVAT TEKIJÄT Juho Pitkänen LK Opiskelijanumero: 1979172 Oulu 12.3.2015 Ohjaajat: Matti Uhari prof., Marjo Renko, dosentti OULUN YLIOPISTO Lääketieteellinen

Lisätiedot

Suolistobakteeriston yhteys tauteihin

Suolistobakteeriston yhteys tauteihin Katsaus Erkki eerola Elimistöä suojaavat mikrobit ovat ihmiselle välttämättömiä. Ne varjelevat taudinaiheuttajilta ja vaikuttavat immuniteetin kehittymiseen. Suolistomikrobit vaikuttavat myös suoliston

Lisätiedot

Maito ravitsemuksessa

Maito ravitsemuksessa Maito ravitsemuksessa Sisältö Ravitsemussuositukset kehottavat maidon juontiin Maidon ravintoaineet Mihin kalsiumia tarvitaan? Kalsiumin saantisuositukset Kuinka saadaan riittävä annos kalsiumia? D-vitamiinin

Lisätiedot

Lihavuus ja liitännäissairaudet

Lihavuus ja liitännäissairaudet Rasvahapot valtimotaudin vaaran arvioinnissa Lihavuus ja liitännäissairaudet Antti Jula, ylilääkäri, sisätautiopin dosentti, THL VIII Valtakunnallinen Kansanterveyspäivä 12.12.2011 Lihavuus ja liitännäissairaudet

Lisätiedot

DIABETES JA AIVOT AIVOJEN INSULIINIRESISTENSSI

DIABETES JA AIVOT AIVOJEN INSULIINIRESISTENSSI DIABETES JA AIVOT AIVOJEN INSULIINIRESISTENSSI Outi Heikkilä Valtakunnallinen diabetespäivä 17.11.2015 AIVOJEN INSULIINIRESISTENSSI 1. AIVOJEN INSULIININ FYSIOLOGINEN ROOLI? 2. MITÄ AIVOJEN INSULIINIRESISTENSSI

Lisätiedot

Probiotic 12. PRO12-koostumus saatavana vain LR:ltä! P R O B I OO TT I NEN RAVINTOLISÄ

Probiotic 12. PRO12-koostumus saatavana vain LR:ltä! P R O B I OO TT I NEN RAVINTOLISÄ Probiotic 12 PRO12-koostumus saatavana vain LR:ltä! P R O B I OO TT I NEN RAVINTOLISÄ Probiotic 12 Mitä ovat probiootit? MITÄ OVAT PROBIOOTIT? Ihmisen suolistossa on miljoonittain bakteereja Nämä bakteerit

Lisätiedot

Kuinka entsyymit toimivat?

Kuinka entsyymit toimivat? Mitä ovat entsyymit? Entsyymit ovat proteiineja, jotka toimivat kemiallisten reaktioiden katalysaattorina elimistössä. Niitä voidaan verrata liekin puhaltamiseen tulen sytyttämiseksi. Jos liekkeihin ei

Lisätiedot

Gram-värjäykset. Olli Meurman

Gram-värjäykset. Olli Meurman Gram-värjäykset Olli Meurman 5.2.2010 Gram-värjäys Gram-positiivinen Kiinnitys (kuumennus/alkoholi) Gram-negatiivinen Kristalliviolettivärjäys Kiinnitys jodilla Värinpoisto alkoholilla Safraniinivärjäys

Lisätiedot

Juusto ravitsemuksessa

Juusto ravitsemuksessa Juusto ravitsemuksessa Juusto ravitsemuksessa Rakennusaineita luustolle Hammasystävällistä Sopii erityisruokavalioihin Juustojen koostumus vaihtelee Tuorejuusto valmistustavan mukaan Kypsytetty juusto

Lisätiedot

Bakteeriperäisen turistiripulin diagnostiikka nukleiinihaponosoitusmenetelmillä

Bakteeriperäisen turistiripulin diagnostiikka nukleiinihaponosoitusmenetelmillä Bakteeriperäisen turistiripulin diagnostiikka nukleiinihaponosoitusmenetelmillä Sointu Mero HUSLAB 5.2.2015 Labquality Days Luennon sisältöä: matkailutaustaa ulosteen bakteeriviljely nukleiinihaponosoitusmenetelmät

Lisätiedot

Mikrobiryhmät. Bakteeriviljelmät

Mikrobiryhmät. Bakteeriviljelmät Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset) Hajottajia (lahottajat ja mädättäjät), patogeeneja (taudinaiheuttajia), tuottajia (yhteyttävät),

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

ANALYYTIT JA ANALYYSIN KUVAUS CDSA 2.0 ANALYYTIT

ANALYYTIT JA ANALYYSIN KUVAUS CDSA 2.0 ANALYYTIT MDD Terveyspalvelut Oy Postiosoite: Salomonkatu 17 B 4. krs PL 27, 00101 Helsinki 00100 Helsinki S-posti: info@mdd.fi Puh. (09) 622 4424 www.mdd.fi ANALYYTIT JA ANALYYSIN KUVAUS CDSA 2.0 Ruuansulatusvaivat

Lisätiedot

SIANLIHAN TUOTANTOKETJUN KANNATTAVUUDEN PARANTAMINEN SEKÄ

SIANLIHAN TUOTANTOKETJUN KANNATTAVUUDEN PARANTAMINEN SEKÄ SIANLIHAN TUOTANTOKETJUN KANNATTAVUUDEN PARANTAMINEN SEKÄ YMPÄRISTÖKUORMAN PIENENTÄMINEN JUOMAVEDEN VETYKÄSITTELYLLÄ MMM-projekti Dnro 2056/312/2011 Alimetricsin loppuraportti 26.2.2014 Johtopäätökset:

Lisätiedot

Labquality Kudos- ja märkänäytteiden bakteeriviljely 2006-2010

Labquality Kudos- ja märkänäytteiden bakteeriviljely 2006-2010 Labquality Kudos- ja märkänäytteiden bakteeriviljely 2006-2010 Markku Koskela OYS/Mikrobiologian laboratorio 5-vuotisseurantajakson kertymä 20 bakteeriviljelykierrosta 80 potilasnäytettä 40 Pu-BaktVi2;

Lisätiedot

Ravitsemuksen ABC. Kuopion Reippaan Voimistelijat Ry Ravitsemustieteen opiskelija Noora Mikkonen

Ravitsemuksen ABC. Kuopion Reippaan Voimistelijat Ry Ravitsemustieteen opiskelija Noora Mikkonen Ravitsemuksen ABC Kuopion Reippaan Voimistelijat Ry Ravitsemustieteen opiskelija Noora Mikkonen Tulossa La 25.10. La 8.11. La 15.11. La 22.11. La 29.11. Energiaravintoaineiden kirjo: energian tarve ja

Lisätiedot

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä

Lisätiedot

Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012. Lihavuus kansanterveyden haasteena

Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012. Lihavuus kansanterveyden haasteena Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012 Lihavuus kansanterveyden haasteena Lihavuus kuoleman vaaratekijänä Yli 6000 lihavan keskimäärin 15 vuoden seuranta

Lisätiedot

REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio 1 Oulun kaupungin elintarvike- ja ympäristölaboratorio Oy PL 19 90015 Oulun kaupunki Puh. 044 7036740 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Mikrobit (homeet, hiivat, bakteerit

Lisätiedot

1.1 MIKROBIT ELINTARVIKKEISTA

1.1 MIKROBIT ELINTARVIKKEISTA Kainuun elintarvike- ja ympäristölaboratorio 1. ELINTARVIKKEET Hinta alv 0 % Hinta alv. 24 % 1.1 MIKROBIT ELINTARVIKKEISTA Bacillus cereus 16,58 20,56 Campylobacter spp. 38,53 47,78 Clostridium perfringens

Lisätiedot

TUTKIMUSMAKSUT 1. ELINTARVIKKEET KAINUUN MAAKUNTA -KUNTAYHTYMÄ

TUTKIMUSMAKSUT 1. ELINTARVIKKEET KAINUUN MAAKUNTA -KUNTAYHTYMÄ 1. ELINTARVIKKEET KAINUUN MAAKUNTA -KUNTAYHTYMÄ KAINUUN ELINTARVIKE- JA YMPÄRISTÖLABORATORIO TUTKIMUSMAKSUT 1.1 MIKROBIT ELINTARVIKKEISTA Bacillus cereus 17,00 Campylobacter spp. 39,50 Clostridium perfringens

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Terveillä vasikoilla on terveet mahat

Terveillä vasikoilla on terveet mahat Terveillä vasikoilla on terveet mahat Benfital Plus koska maitojuotto on tärkeää Vetmedica Etusijalla eläinten hyvinvointi Miksi vasikoille tulee ripuli? Miksi on tärkeää ennaltaehkäistä vasikoiden ripulia?

Lisätiedot

Vaihda suun huonot bakteerit hyviin.

Vaihda suun huonot bakteerit hyviin. Vaihda suun huonot bakteerit hyviin. Ien- ja hammasvaivojen taustalla epätasapainoinen mikrobisto kk Annika Mäyrä I annika.mayra@versofinland.fi I +358 40 549 7114 Maailmanlaajuisesti 2.43 miljardia ihmistä

Lisätiedot

Ravinnon hiilihydraatit ystävä vai vihollinen? Mikael Fogelholm, dosentti, ETT Johtaja, Suomen Akatemia, terveyden tutkimuksen yksikkö

Ravinnon hiilihydraatit ystävä vai vihollinen? Mikael Fogelholm, dosentti, ETT Johtaja, Suomen Akatemia, terveyden tutkimuksen yksikkö Ravinnon hiilihydraatit ystävä vai vihollinen? Mikael Fogelholm, dosentti, ETT Johtaja, Suomen Akatemia, terveyden tutkimuksen yksikkö 1 7.4.2011 Ravintoaineiden saantisuositukset Ruoankäyttösuositukset

Lisätiedot

Bentsoehappo akkr Sisäinen menetelmä, perustuu NMKL 124:1987. Bromidi, epäorgaaninen akkr Sisäinen menetelmä, perustuu EN 13191-2:1998

Bentsoehappo akkr Sisäinen menetelmä, perustuu NMKL 124:1987. Bromidi, epäorgaaninen akkr Sisäinen menetelmä, perustuu EN 13191-2:1998 Bentsoehappo Sisäinen menetelmä, perustuu NMKL 124:1987 Bromidi, epäorgaaninen Sisäinen menetelmä, perustuu EN 13191-2:1998 Campylobacter jejuni/coli Sisäinen menetelmä, VIDAS Campylobacter jejuni/coli,

Lisätiedot

Diagnostisten testien arviointi

Diagnostisten testien arviointi Erkki Savilahti Diagnostisten testien arviointi Koe antaa tuloksen pos/neg Laboratoriokokeissa harvoin suoraan luokiteltavissa Testin hyvyys laskettavissa tunnuslukujen avulla Diagnostisten testien arviointi

Lisätiedot

Hevoset käyttävät luonnon- ja laidunolosuhteissa

Hevoset käyttävät luonnon- ja laidunolosuhteissa HEVOSTEN RUOKINTAKOULU, OSA I. 2015 Hevosen ruuansulatuselimistön rakenne ja toiminta Suomen Hevostietokeskus ry, Hevosten terveydeksi -hanke FT Elena Autio Hevostietokeskuksen ruokintakoulun ensimmäisessä

Lisätiedot

Pellavansiemenen. 6/2009 Hyvinvointia pellavasta -hanke

Pellavansiemenen. 6/2009 Hyvinvointia pellavasta -hanke Pellavansiemenen terveysvaikutukset Kooste Lähteenä käytetty artikkelia TarpilaA, WennbergT. TarpilaS: Flaxseedas a functionalfood. Current Topics in Neutraceutical Research 2005 (3);3:167-188 1 Sisällysluettelo

Lisätiedot

Terveelliset elämäntavat

Terveelliset elämäntavat Terveelliset elämäntavat (lyhyt ohje/ Duodecim Terveyskirjasto) Ravinto Kasviksien, hedelmien ja marjojen runsas käyttö Viljatuotteet kuitupitoisia täysjyvävalmisteita Maito- ja lihatuotteet rasvattomina

Lisätiedot

Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.

Lisätiedot

BIOHIT OYJ. Globaaleilla markkinoilla toimiva suomalainen bioteknologiayritys

BIOHIT OYJ. Globaaleilla markkinoilla toimiva suomalainen bioteknologiayritys BIOHIT OYJ Globaaleilla markkinoilla toimiva suomalainen bioteknologiayritys 1 Biohit lyhyesti Biohit Oyj on globaaleilla markkinoilla toimiva suomalainen bioteknologiayritys. Missiomme Innovating for

Lisätiedot

NivelTeho. 120 kaps. 32,90. (ovh. 40,70) 411,25 e/kg

NivelTeho. 120 kaps. 32,90. (ovh. 40,70) 411,25 e/kg NivelTeho Liiku nivelet lempeästi kuntoon. Kuuden tutkitun aktiiviaineen yhdistelmä: MSM, inkivääriuute, glukosamiini, hainrusto, kupari ja C-vitamiini. 120 kaps. 32,90 411,25 e/kg (ovh. 40,70) Luontainen

Lisätiedot

X kestävyysseminaari, Pajulahti 10.12.05 PAINANKO LIIKAA? Dosentti, ETT Mikael Fogelholm Johtaja, UKK-instituutti, Tampere

X kestävyysseminaari, Pajulahti 10.12.05 PAINANKO LIIKAA? Dosentti, ETT Mikael Fogelholm Johtaja, UKK-instituutti, Tampere X kestävyysseminaari, Pajulahti 10.12.05 PAINANKO LIIKAA? Dosentti, ETT Johtaja, UKK-instituutti, Tampere Miten paino, painoindeksi ja rasva-% eroavat eri lajien urheilijoilla? Onko kehon koostumuksella

Lisätiedot

FORMARE 2015. Ravinnon merkitys hyvinvoinnille - ja ohjeet terveelliseen ruokavalioon

FORMARE 2015. Ravinnon merkitys hyvinvoinnille - ja ohjeet terveelliseen ruokavalioon FORMARE 2015 Ravinnon merkitys hyvinvoinnille - ja ohjeet terveelliseen ruokavalioon Sisältö Kalorit ja kulutus Proteiini Hiilihydraatti Rasva Vitamiinit Kivennäis- ja hivenaineet Vesi ja nesteytys Ravintosuositukset

Lisätiedot

Bakteerialtistuminen maatiloilla ja ei-maatiloilla asuvilla lapsilla - yhteys atopiaan ja astmaan

Bakteerialtistuminen maatiloilla ja ei-maatiloilla asuvilla lapsilla - yhteys atopiaan ja astmaan Bakteerialtistuminen maatiloilla ja ei-maatiloilla asuvilla lapsilla - yhteys atopiaan ja astmaan Maria Valkonen, Inge Wouters, Martin Täubel, Helena Rintala, Ritva Vasara, Dick Heederik, Jon Genuneit,

Lisätiedot

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna Ihmisen keho muodostuu miljardeista soluista. Vaikka nämä solut ovat tietyssä mielessä meidän omiamme, ne polveutuvat itsenäisistä yksisoluisista elämänmuodoista, jotka ovat säilyttäneet monia itsenäisen

Lisätiedot

Ohje: Miten haen aineistoa Terveysportin verkkopalvelusta

Ohje: Miten haen aineistoa Terveysportin verkkopalvelusta Ohje: Miten haen aineistoa Terveysportin verkkopalvelusta a) Verkkopalvelun ulkoasu...1 b) Aineiston hakeminen Terveysportissa...5 c) Aineiston tulostaminen Terveysportissa...7 a) Verkkopalvelun ulkoasu

Lisätiedot

Vähän tietoja Renew Life -yhtiöstä

Vähän tietoja Renew Life -yhtiöstä Vähän tietoja Renew Life -yhtiöstä Jos halutaan tietää, miksi Renew Life on erityinen yhtiö, on tunnettava Renew Lifen vuonna 1997 perustaneen Brenda Watsonin tarina. Brenda kärsi huonosta terveydestä

Lisätiedot

Avaimia iloiseen äijäliikuntaan! Liikunta ei ole tärkeää, se on ELINTÄRKEÄÄ 4/19/2013. Suomalaisten onnellisuus ei riipu tulo- ja koulutustasosta,

Avaimia iloiseen äijäliikuntaan! Liikunta ei ole tärkeää, se on ELINTÄRKEÄÄ 4/19/2013. Suomalaisten onnellisuus ei riipu tulo- ja koulutustasosta, Avaimia iloiseen äijäliikuntaan! Suomalaisten onnellisuus ei riipu tulo- ja koulutustasosta, vaan liikunnan määrästä ja ruokavalion terveellisyydestä. Liikkuvat Koen terveyteni hyväksi 8% 29 % Olen tyytyväinen

Lisätiedot

REUMA JA SYDÄN KARI EKLUND HELSINGIN REUMAKESKUS

REUMA JA SYDÄN KARI EKLUND HELSINGIN REUMAKESKUS REUMA JA SYDÄN KARI EKLUND HELSINGIN REUMAKESKUS Sisältö Sydän ja nivelreuma Sydän- ja verisuonitaudit - ateroskleroosi - riskitekijät Nivelreuma ja sydän- ja verisuonitaudit - reumalääkitys ja sydän Kuinka

Lisätiedot

Lisääntymiskauden sairaudet, niiden ennaltaehkäisy ja hoito. ELÄINLÄÄKÄRI HELI NORDGREN Kortesjärvi 9.5.2016

Lisääntymiskauden sairaudet, niiden ennaltaehkäisy ja hoito. ELÄINLÄÄKÄRI HELI NORDGREN Kortesjärvi 9.5.2016 Lisääntymiskauden sairaudet, niiden ennaltaehkäisy ja hoito ELÄINLÄÄKÄRI HELI NORDGREN Kortesjärvi 9.5.2016 Minkki verinen kohtutulehdus Minkeillä kohtutulehdukset ovat harvinaisia. Parituksessa infektioriski

Lisätiedot

ANALYYTIT. 1. Kymotrypsiini (Chymotrypsin)

ANALYYTIT. 1. Kymotrypsiini (Chymotrypsin) MDD Terveyspalvelut Oy Postiosoite: Salomonkatu 17 B 4. krs PL 27, 00101 Helsinki 00100 Helsinki S-posti: info@mdd.fi Puh. (09) 622 4424 www.mdd.fi ANALYYTIT JA ANALYYSIN KUVAUS CDSA Tämä testi analysoi

Lisätiedot

REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio Jyväskylän ympäristölaboratorio Eeronkatu 10 40720 JYVÄSKYLÄ Puh. 014 626650 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Mikrobit (homeet, hiivat, bakteerit ja aktinobakteerit) akkr

Lisätiedot

DairyPilot FlavoVital. Pakkaus koko maidontuotantokaudelle

DairyPilot FlavoVital. Pakkaus koko maidontuotantokaudelle DairyPilot FlavoVital Pakkaus koko maidontuotantokaudelle ESIPUHE: PANSEN-PILOTIN MENESTYSTARINA Tyytyväisyys Pansen-Pilotiin on vahvistunut useiden tilatulosten perusteella vuosien saatossa. Pansen-Pilot

Lisätiedot

Harvinaissairauksien yksikkö. Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta. Taustaa. Alfa-tryptasemia. 21/03/16 /ms

Harvinaissairauksien yksikkö. Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta. Taustaa. Alfa-tryptasemia. 21/03/16 /ms Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta Taustaa EDS potilasyhdistys ja yksittäinen potilas ovat lähestyneet HYKS harvinaissairauksien yksikköä ja pyytäneet lausuntoa, minkälainen sairaus Ehlers-Danlos

Lisätiedot

Virusriskin vähentäminen elintarviketuotannossa

Virusriskin vähentäminen elintarviketuotannossa Virusriskin vähentäminen elintarviketuotannossa Satu Salo, VTT Expert Services Oy Marjaana Rättö, Irina Tsitko ja Hanna Miettinen, VTT 2 Viruskontaminaation riskinhallintakeinojen kehittäminen ja arvioiminen

Lisätiedot

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin?

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? 26.3.2015 Kalaterveyspäivät, Tampere Krister Sundell Akvaattisen patobiologian laboratorio Åbo Akademi Flavobacterium psychrophilum Aiheuttaa

Lisätiedot

Maaperän biologinen monimuotoisuus Tuhannet tuntemattomat jalkojemme alla

Maaperän biologinen monimuotoisuus Tuhannet tuntemattomat jalkojemme alla Maaperän biologinen monimuotoisuus Tuhannet tuntemattomat jalkojemme alla Jari Haimi Bio- ja ympäristötieteiden laitos Jyväskylän yliopisto 24.11.2015 Maaperän monimuotoisuus 2 Maaperässä elää ja vaikuttaa

Lisätiedot

GEENITEKNIIKAN PERUSASIOITA

GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien

Lisätiedot

Hoitokäytännöt muuttuneet. WHO Global Health Report. Makuuttamisesta pompottamiseen, potilaan fyysisen aktiivisuuden lisääminen

Hoitokäytännöt muuttuneet. WHO Global Health Report. Makuuttamisesta pompottamiseen, potilaan fyysisen aktiivisuuden lisääminen Hoitokäytännöt muuttuneet Makuuttamisesta pompottamiseen, potilaan fyysisen aktiivisuuden lisääminen Leikkauksen jälkeisen mobilisaation varhaistaminen Vammojen aktiivisempi hoito Harri Helajärvi, LL (väit.)

Lisätiedot

8 LEIPÄ JA VILJA RAVITSEMUKSESSA. Leipä ja vilja ravitsemuksessa (8)

8 LEIPÄ JA VILJA RAVITSEMUKSESSA. Leipä ja vilja ravitsemuksessa (8) 8 LEIPÄ JA VILJA RAVITSEMUKSESSA Leipä ja vilja ravitsemuksessa (8) Mitä leipä on? Kivennäisaineita Magnesiumia Rautaa Kaliumia Hivenaineita Sinkkiä Seleeniä Vettä Energiaa Hiilihydraatteja Proteiineja

Lisätiedot

REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio Savo-Karjalan Ympäristötutkimus Oy, elintarvikkeet Kuopion laboratorio Yrittäjäntie 24 70150 KUOPIO EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Aerobiset mikro-organismit akkr ISO 4833:2003 Anaerobiset

Lisätiedot

WDC2012 ja hyvinvointi-design. 1. Elämä-design 2. Palvelu-design 3. Ympäristö-design

WDC2012 ja hyvinvointi-design. 1. Elämä-design 2. Palvelu-design 3. Ympäristö-design WDC2012 ja hyvinvointi-design 1. Elämä-design 2. Palvelu-design 3. Ympäristö-design Juha Metso 28.06.2011 1 1. Elämä-design Rakkautta Hoivaa Turvaa Tunteiden jakamista Oppimista Vapaa-aikaa Leikkiä Sääntöjä

Lisätiedot

ALKOHOLINKÄYTTÖ JA MAKSASAIRAUDET. Kalle Jokelainen Gastroenterologi, Peijaksen sairaala Alkoholi- ja huumetutkijain seuran seminaari 11.2.

ALKOHOLINKÄYTTÖ JA MAKSASAIRAUDET. Kalle Jokelainen Gastroenterologi, Peijaksen sairaala Alkoholi- ja huumetutkijain seuran seminaari 11.2. ALKOHOLINKÄYTTÖ JA MAKSASAIRAUDET Kalle Jokelainen Gastroenterologi, Peijaksen sairaala Alkoholi- ja huumetutkijain seuran seminaari 11.2.2010 ALKOHOLINKULUTUS SUOMESSA Lähde: THL ALKOHOLINKULUTUS SUOMESSA

Lisätiedot

Koiran ja kissan ruokailukäyttäytyminen. Rakastammeko lemmikkimme lihaviksi?

Koiran ja kissan ruokailukäyttäytyminen. Rakastammeko lemmikkimme lihaviksi? Koiran ja kissan ruokailukäyttäytyminen Rakastammeko lemmikkimme lihaviksi? Ruokinnan tarkoitus Taata eläimelle sen kasvun, elintoimintojen ja lisääntymisen kannalta välttämättömät ravintoaineet ja täyttää

Lisätiedot

Suomalainen maksa - ja miten se on marinoitu

Suomalainen maksa - ja miten se on marinoitu Suomalainen maksa - ja miten se on marinoitu Helena Isoniemi ylilääkäri, professori Elinsiirto- ja maksakirurgian klinikka Martti Färkkilä ylilääkäri, professori Gastroenterologia HYKS 13.3.2014 Alkoholi

Lisätiedot

Kananmuna sisältää muun muassa D-vitamiina ja runsaasti proteiinia

Kananmuna sisältää muun muassa D-vitamiina ja runsaasti proteiinia Jogurtti luomuhillolla on parempi vaihtoehto kuin puuro tai aamumurot. Tutkijat ovat yhä enenevästi havainneet, mitä näiden viljojen gluteeni aiheuttaa terveydellemme. Gluteeni on syyllinen yli 150 eri

Lisätiedot

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93.

Väärin, Downin oireyhtymä johtuu ylimääräisestä kromosomista n.21 (trisomia) Geeni s. 93. 1 I) Ovatko väittämät oikein (O) vai väärin (V)? Jos väite on mielestäsi väärin, perustele se lyhyesti väittämän alla oleville riveille. O/V 1.2. Downin oireyhtymä johtuu pistemutaatista fenyylialaniinin

Lisätiedot

VALMISTEYHTEENVETO 1. LÄÄKEVALMISTEEN NIMI. MUTAFLOR oraalisuspensio 10 8 CFU/ml 2. VAIKUTTAVAT AINEET JA NIIDEN MÄÄRÄT

VALMISTEYHTEENVETO 1. LÄÄKEVALMISTEEN NIMI. MUTAFLOR oraalisuspensio 10 8 CFU/ml 2. VAIKUTTAVAT AINEET JA NIIDEN MÄÄRÄT VALMISTEYHTEENVETO 1. LÄÄKEVALMISTEEN NIMI MUTAFLOR oraalisuspensio 10 8 CFU/ml 2. VAIKUTTAVAT AINEET JA NIIDEN MÄÄRÄT 1 ml sisältää vaikuttavana aineena: Escherichia coli kanta Nissle 1917 vastaten 10

Lisätiedot

WHO:n Antimikrobinen resistenssi viikko 16-22.11.2015

WHO:n Antimikrobinen resistenssi viikko 16-22.11.2015 WHO:n Antimikrobinen resistenssi viikko 16-22.11.2015 WHO:n Strategia & Tavoitteet Antimikrobisesta resistenssistä (AMR) Bakteerien, loisien, virusten, sienien hoitoon käytettyjen antimikrobisten lääkkeiden

Lisätiedot

PUHDISTAA POISTAA MYRKKYJÄ TUKEE RUOANSULATUS- JÄRJESTELMÄÄ. ATeamSuomi.com merenheimo@gmail.com 1

PUHDISTAA POISTAA MYRKKYJÄ TUKEE RUOANSULATUS- JÄRJESTELMÄÄ. ATeamSuomi.com merenheimo@gmail.com 1 PUHDISTAA POISTAA MYRKKYJÄ TUKEE RUOANSULATUS- JÄRJESTELMÄÄ merenheimo@gmail.com 1 PUHDISTAA KEHOA Tehokas yhdistelmä ravintoaineita tehostavat suoliston toimintaa ja tukevat suolistossa jo olevia hyödyllisiä

Lisätiedot

KandiakatemiA Kandiklinikka

KandiakatemiA Kandiklinikka Kandiklinikka Kandit vastaavat Immunologia Luonnollinen ja hankittu immuniteetti IMMUNOLOGIA Ihmisen immuniteetti pohjautuu luonnolliseen ja hankittuun immuniteettiin. Immunologiasta vastaa lymfaattiset

Lisätiedot

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto

PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA. Robert Winqvist. SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PERINNÖLLISET TEKIJÄT JA NIIDEN MERKITYS RINTASYÖPÄSAIRASTUMISESSA Robert Winqvist SyöpägeneCikan ja tuumoribiologian professori Oulun yliopisto PROFESSORILIITON SYYSSEMINAARI TUTKIMUSTA KAIKKIEN HYÖDYKSI

Lisätiedot

Vähärauma, Teknologiakeskus Pripoli, A-siipi, 3. kerros. Suorat puhelinnumerot: Toimisto 02-621 3342

Vähärauma, Teknologiakeskus Pripoli, A-siipi, 3. kerros. Suorat puhelinnumerot: Toimisto 02-621 3342 1 YHTEYSTIEDOT: AVOINNA: ma - pe klo 8.00-15.30 KÄYNTIOSOITE: POSTIOSOITE: INTERNETOSOITE: SÄHKÖPOSTIOSOITE: Vähärauma, Teknologiakeskus Pripoli, A-siipi, 3. kerros Tiedepuisto 4, 28600 PORI www.pori.fi/porilab

Lisätiedot

Liikunta. Terve 1 ja 2

Liikunta. Terve 1 ja 2 Liikunta Terve 1 ja 2 Käsiteparit: a) fyysinen aktiivisuus liikunta b) terveysliikunta kuntoliikunta c) Nestehukka-lämpöuupumus Fyysinen aktiivisuus: Kaikki liike, joka kasvattaa energiatarvetta lepotilaan

Lisätiedot

Lantioalueenkivut, akupunktiosta apua? 25.9.2015 Fysioterapeutti Maija Häärä Fysios

Lantioalueenkivut, akupunktiosta apua? 25.9.2015 Fysioterapeutti Maija Häärä Fysios Lantioalueenkivut, akupunktiosta apua? 25.9.2015 Fysioterapeutti Maija Häärä Fysios Taustaa Lääkintävoimistelijan tutkinto 1986, elv 1994, fysioterapeutti 1995, akupunktiotutkinto Singapore 2006, FYSIN

Lisätiedot

Vahvasta vasikasta tuottavaksi naudaksi. Vasikoiden kasvatus. jbs portfolio. jbs:n kanssa

Vahvasta vasikasta tuottavaksi naudaksi. Vasikoiden kasvatus. jbs portfolio. jbs:n kanssa Vahvasta vasikasta tuottavaksi naudaksi Vasikoiden kasvatus jbs portfolio jbs:n kanssa jbs kälberpaste - vasikkatahna Lyhyesti taattu korkea taso immunoglobuliinia (johdettu IBR-vapaasta maidosta) sisältää

Lisätiedot