Normaalimikrobiston uusi tuleminen

Koko: px
Aloita esitys sivulta:

Download "Normaalimikrobiston uusi tuleminen"


1 PEOPLE ARE NOT JUST PEOPLE. THEY ARE AN AWFUL LOT MICROBES, TOO (The Economist 2012) Normaalimikrobiston uusi tuleminen FM Eveliina Munukka Projektitutkija Lee & Mazmanian, Science 2010 NORMAALIMIKROBISTON UUSI TULEMINEN NORMAALIMIKROBISTON UUSI TULEMINEN Ray K. Nature Rev.Gast. & Hepatol Jones S. Nat. Biotechnol

2 MIKROBIT LUONNOSSA SUOLISTOMIKROBISTO Koko elinympäristömme on täynnä mikrobeja Mikrobit ovat välttämättömiä elämälle Ruuansulatuskanavan mikrobisto, suusta suolistoon, on kompleksinen ja erittäin monimutkainen ekosysteemi: ihmisen kehossa 10 x enemmän mikrobeja kuin ihmisen omia soluja paksusuolessa bakteeritiheys jopa 10^11-12 / g suolen sisältöä ns. yhteinen core : 160 lajia oli yleisesti samoja eri yksilöillä 75 lajia >50 %:lla tutkituista Ihminen on kehittynyt yhdessä mikrobien kanssa 57 lajia >90 %:lla (Qin et al. 2010, Nature 2010) Suolistossa arvioidaan olevan eri bakteerilajia, joista viljeltävissä vain murto-osa intensiivisestä tutkimuksesta huolimatta tarkka lajikoostumus edelleen epäselvä Entäpä toiminnallisuus? Mikrobiomi sisältää 100 x enemmän geenejä kuin ihmisen genomi SUOLISTOMIKROBISTO SUOLISTOMIKROBISTON KOOSTUMUS Terveyden kannalta merkittäviä sukuja ja ryhmiä: Aktinobakteerit: Bifidobakteerit, Coriobakteerit Firmikuutit: Klostridi-klusteri XIV, Faecalibacterium prausnitzii (ja muut sen kaltaiset butyraatin tuottajat) Laktobasillit, Basillit, Enterokokit, Streptokokit 90 % lajeista kuuluvat Firmikuutteihin, Aktinobakteereihin sekä Bacteroidetes-ryhmään Bacteroidetes: Bacteroides sp., Prevotella sp. Proteobakteerit: Pääasiassa patogeeneja kuten Salmonella, E. coli Eukarya Esim. Candida Eri mikrobiryhmät, -suvut ja lajit dominoivat eri osissa suolistoa. 2

3 SUOLISTOMIKROBISTON TAKSONOMIAA MIKROBISTO - IHMISEN TUNTEMATTOMIN ELIN PERINTEINEN TAPA MODERNIT MOLEKYYLIBIOLOGISET MENETELMÄT VILJELY viljeltävissä murto-osa, anaerobeja hidasta monimutkaiset kasvu-alustat suolen anaerobiolosuhteet vaativat anerobiviljelyä käsityötä DNA:N MONISTUKSEEN PERUSTUVAT MENETELMÄT PCR, mikrobisto-chipit ym. DNA-eristys aiheuttaa aina vaihtelua tuloksiin tietyt ryhmät yli- tai alikorostuvat IN SITU -HYBRIDISAATIO kokosoluhybridisaatio, ei sisällä DNA:n eristysvaihetta valokuva sekä kuolleet että elävät solut voidaan laskea KVANTITATIIVINEN määritys Vrieze A et al Diabetologia Taksonomia perustuu nykyään suurelta osin ribosomaaliseen 16S geeniin ja molekyyliin NGS MENETELMÄT metagenomiikka metatranskriptomiikka metaproteomiikka IHMINEN ON KÄVELEVÄ MIKROBIEN ELATUSALUSTA Kohdussa ihminen on steriili - mikrobien kolonisaatio tapahtuu synnytyskanavassa ja muissa synnyksen jälkeisissä kontakteissa ns. alkuymppi Elämänsä aikana ihminen elää enemmän tai vähemmän sopuisissa väleissä mikrobien kanssa (commensal microbes) 3

4 MIKROBISTON TERVEYSVAIKUTUKSET SUOLISTOMIKROBISTO JA SAIRAUDET TAUSTALLA DYSBIOOSI? Perinteisesti mikrobeja on pidetty yksinomaan taudinaiheuttajina esim. E. coli, Salmonella, Yersinia, Campylobacteria, Listeria 1.Terve mikrobisto on välttämätön ihmisen terveyden kannalta 2.Kolonisaatioresistenssi suojaa elimistöä erilaisilta taudinaiheuttajilta 3.Fermentoi paksusuolessa ravintoaineita esim. kuidut ja muut monimutkaiset hiilihydraatit 4. Tuottaa välttämättömiä yhdisteitä kuten K- ja B12- vitamiineja sekä erilaisia metaboliitteja esim. butyraattia 5. Osallistuu immuunijärjestelmän kehitykseen & säätelyyn ja ylläpitoon Festi D et al. Dig. Dis SUOLISTOMIKROBISTON EPÄTASAPAINOON ASSOSIOITUJA SAIRAUKSIA Tulehdukselliset suolistosairaudet (IBS, IBD, Crohn) Autoimmuunitaudit (Keliakia, reuma, tyypin 1 diabetes) Ylipaino ja sen liitännäissairaudet Syöpä Allergiat ja astma Psyykkiset sairaudet (depressio, autismi ym) CERF-BENSUSSAN ET AL.NAT. IMMUNOLOGY

5 HYGIENIAHYPOTEESI, ALLERGIA JA MIKROBISTO MIKROBISTO JA SUOLISTOSAIRAUDET Potilaat, joilla kroonisia suolistosairauksia eroavat merkittävästi suolistomikrobiston koostumuksen osalta terveistä verrokeista N Engl J Med, 2002 Qin et al. Nature

6 MIKROBISTO JA TYYPIN 1 DIABETES SUOLEN MIKROBISTO MUOKKAA AIVOJEN KEHITYSTÄ JA KÄYTTÄYTYMISTÄ Bakteerit pääsevät vagushermon kautta aivoihin? (Braak et al. J Neural Transm 2003) GF-hiirten ja verrokkihiirten aivojen toiminnassa on merkittäviä eroja erit. neurotransmittereiden ja synaptisten proteiinien erityksessä, jotka voivat selittää erot hiirten käytöksessä (Diaz Heijtz et al. PNAS 2011) Funktionaalinen GUT-BRAIN-MICROBE -AXIS Mean proportion of the 11 most abundant genera that differ significantly between cases and controls (p value 0.01). Brown CT ET AL. PLoS ONE 2011 MIKROBISTO JA SUOLISTOSYÖPÄ SUOLISTON BAKTEERISTO JA LIHAVUUS Mikrobien käynnistämä suolen seinämän solujen reseptorien aktivointi lisää syövän kasvua Monimutkainen järjestelmä, jossa mikrobeilla on merkittävä osuus GF -hiirille annettu normaalin hiiren suolen sisältö johti rasvakudoksen lisääntymiseen 50%:lla 2 viikossa, vaikka hiiret verrokkeja niukemmalla dieetillä. Lee et al. Nat. Medicine 2010 (Bäckhed et al. PNAS 2004, 2007; Ley RE et al Nature 2006) Vaahtovuo et al. Livestock Sci

7 26 MIKROBISTO, LIHAVUUS JA AINEENVAIHDUNTA LAIHOJEN JA LIHAVIEN MIKROBISTON ERO Bäckhed et al. PNAS 2004 Cani & Delzenne, Pharmacology & therapeutics, 2011 Turnbaugh et al. Nature 2009 MIKROBISTO, MATALA-ASTEINEN TULEHDUS & LIHAVUUS MIKROBISTO JA RASVAMAKSA Rasvoittunut maksa, > 5 % Verrokit MicrObesity Cani & Delzenne, Pharmacology & therapeutics, 2011 Munukka et al. J Hepatol

8 Faecalibacterium prausnitzii Faecalibacterium prausnitzii Yksi yleisimmistä suolistobakteereista Ehdoton anaerobi, haasteellinen viljeltävä! A. Rintala Viimeaikainen tutkimus liittänyt Fpraun hyvään suolistoterveyteen ja suolinukan kuntoon anti-inflammatoriset vaikutukset, voihapon tuotanto (Sokol et al. PNAS, 2008) prof. Zhao Liping laihdutti lähes 20 kg kiinalaisia yrttejä sisältävällä prebioottisella dieetillä Fprau:n määrä lisääntyi hänen suolistossaan nollasta lähes 15%! MIKROBISTOTUTKIMUKSEN TULEVAISUUS Hattori M, and Taylor TD DNA Res

MIKROBILÄÄKKEIDEN KÄYTÖN VIATTOMAT UHRIT. Pentti Huovinen Bakteeriopin professori

MIKROBILÄÄKKEIDEN KÄYTÖN VIATTOMAT UHRIT. Pentti Huovinen Bakteeriopin professori MIKROBILÄÄKKEIDEN KÄYTÖN VIATTOMAT UHRIT Pentti Huovinen Bakteeriopin professori The evolving threat of antimicrobial resistance; Options for action; WHO, 2012 18.3.2013 Macrolide consumption vs. resistance


Kliinisesti merkittävien bakteerien jaottelua

Kliinisesti merkittävien bakteerien jaottelua Johdanto kliinisesti merkittäviin bakteereihin Miksi kliininen bakteriologia on tärkeää? Bakteerien luokittelusta Bakteeri-infektiot Patogeeni Tartunnanlähde Ennaltaehkäisy Bakteriologista diagnostiikkaa


RAVINTO JA SUOLISTO. Fit4Life. Folasade A. Adebayo M.Sc., Doctoral Student Division of Nutrition University of Helsinki

RAVINTO JA SUOLISTO. Fit4Life. Folasade A. Adebayo M.Sc., Doctoral Student Division of Nutrition University of Helsinki RAVINTO JA SUOLISTO Fit4Life Folasade A. Adebayo M.Sc., Doctoral Student Division of Nutrition University of Helsinki Ruoansulatus järjestelmä: Lisäelimet Sylkirauhaset Hampaat Maksa Haima Sappirakko Tärkeät


Luonto köyhtyy, me sairastumme mitä pitää tehdä?

Luonto köyhtyy, me sairastumme mitä pitää tehdä? Argumenta, Majvik 19.11.203 Luonto köyhtyy, me sairastumme mitä pitää tehdä? Tari Haahtela The striking contrast between Finnish and Russian Karelia von Hertzen L, and the Karelia Group. JACI 2006; Laakkonen


Ravitsemus, terveys ja Suomen luonnosta saadut tuotteet. Raija Tahvonen

Ravitsemus, terveys ja Suomen luonnosta saadut tuotteet. Raija Tahvonen Ravitsemus, terveys ja Suomen luonnosta saadut tuotteet Raija Tahvonen Terveellinen ruokavalio on kasvivoittoinen Runsaasti: Kasviksia, marjoja ja hedelmiä Viljatuotteet pääosin täysjyväviljaa Kalaa ja


Luonnonmarjat ja kansanterveys. Raija Tahvonen MTT/BEL

Luonnonmarjat ja kansanterveys. Raija Tahvonen MTT/BEL Luonnonmarjat ja kansanterveys Raija Tahvonen MTT/BEL 15.8.2013 Jos poimit marjat itse, saat Liikuntaa Luonnossa liikkumisen hyvät vaikutukset aivoille Marjasi tuoreena Varman tiedot, mistä marjat ovat


Tulehdusta vähentävä ruokavalio. Marja Vanhala FT, laillistettu ravitsemusterapeutti, ODL Liikuntaklinikka

Tulehdusta vähentävä ruokavalio. Marja Vanhala FT, laillistettu ravitsemusterapeutti, ODL Liikuntaklinikka Tulehdusta vähentävä ruokavalio Marja Vanhala FT, laillistettu ravitsemusterapeutti, ODL Liikuntaklinikka Esityksen sisältöä Tulehdus, sen yhteys sairauksiin ja tunnistaminen Tulehdusta vähentävä ruokavalio


PCR - tekniikka elintarvikeanalytiikassa

PCR - tekniikka elintarvikeanalytiikassa PCR - tekniikka elintarvikeanalytiikassa Listerian, Salmonellan ja kampylobakteerien tunnistus elintarvikkeista ja rehuista 29.11.2012 Eva Fredriksson-Lidsle Listeria monocytogenes Salmonella (spp) Campylobacter


tulehduksellisten suolistosairauksien yhteydessä

tulehduksellisten suolistosairauksien yhteydessä ADACOLUMN -HOITO tulehduksellisten suolistosairauksien yhteydessä SISÄLTÖ Maha-suolikanava...4 Haavainen paksusuolitulehdus...6 Crohnin tauti...8 Elimistön puolustusjärjestelmä ja IBD...10


Hyvä tietää biofilmistä

Hyvä tietää biofilmistä Hyvä tietää biofilmistä S a i r a a l a h y g i e n i a p ä i v ä t 2 5. 3. 1 4 K a i s u R a n t a k o k k o - J a l a v a K l i i n i s e n m i k r o b i o l o g i a n e l, T y k s l a b Mitä biofilmit


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian



BIOLÄÄKETIETEEN LÄPIMURROT BIOLÄÄKETIETEEN LÄPIMURROT Jussi Huttunen Tampere 20.4.2016 LÄÄKETIETEEN MEGATRENDIT Väestö vanhenee ja sairauskirjo muuttuu Teknologia kehittyy - HOITOTEKNOLOGIA - tietoteknologia Hoito yksilöllistyy


Mitä ovat probiootit?

Mitä ovat probiootit? Mitä ovat probiootit? Termi probioottinen merkitsee elämän puolesta. Whole Health -organisaation määritelmän mukaan probiootit ovat eläviä mikro-organismeja, jotka riittävissä määrissä ylläpidettyinä hyödyntävät


Vahva suolisto vahva vastustuskyky. Matti Vire 7.9.2013

Vahva suolisto vahva vastustuskyky. Matti Vire 7.9.2013 Ihmisen ruuansulatuksen muodostavat: Suu Mahalaukku Maksa (sappi) Haima Ohutsuoli Paksusuoli Peräsuoli Suun tehtävät: Pureskelu Syljen eritys Entsyymien eritys Mahalaukun tehtävät: Suolahapon eritys Pepsiinin


Urheilijan ravitsemus ja vastustuskyky - Valion tuotteet urheilijan ravitsemuksessa

Urheilijan ravitsemus ja vastustuskyky - Valion tuotteet urheilijan ravitsemuksessa Urheilijan ravitsemus ja vastustuskyky - Valion tuotteet urheilijan ravitsemuksessa Infektiot, allergiat ja astma urheilussa sairaudet ja vammat urheilussa UKK-instituutti 5.11.2012 Marika Laaksonen, ETT,


Adacolumn -hoito tulehduksellisten suolistosairauksien yhteydessä

Adacolumn -hoito tulehduksellisten suolistosairauksien yhteydessä Adacolumn -hoito tulehduksellisten suolistosairauksien yhteydessä Hellävarainen vallankumous IBD-tautien hoidossa Sisältö Maha-suolikanava...4 Haavainen paksusuolitulehdus...6 Crohnin tauti...8 Elimistön


Ulosteen kalprotektiinimääritys kliinikon näkemys

Ulosteen kalprotektiinimääritys kliinikon näkemys Ulosteen kalprotektiinimääritys kliinikon näkemys SKKYn ja Sairaalakemistit ry:n koulutuspäivät 16.11.2012 Dosentti, sisätautien ja gastroenterologian erikoislääkäri Taina Sipponen 1 Kalprotektiinijulkaisut


Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari

Metsäpatologian laboratorio tuhotutkimuksen apuna. Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpatologian laboratorio tuhotutkimuksen apuna Metsätaimitarhapäivät 23. 24.1.2014 Anne Uimari Metsäpuiden vaivat Metsäpuiden eloa ja terveyttä uhkaavat monet taudinaiheuttajat: Bioottiset taudinaiheuttajat


Tilannekatsaus probiootteihin

Tilannekatsaus probiootteihin Tilannekatsaus probiootteihin 29.11.2016 Maria Saarela VTT Technical Research Centre of Finland Ltd. 2 Probioottien historiaa Ilja Metschikoff v. 1907 elävät maitohappobakteerit teoria: mädättävien bakteerien


Mitä suoli edellä, sitä aivot perässä. Erkki Eerola Turun yliopisto

Mitä suoli edellä, sitä aivot perässä. Erkki Eerola Turun yliopisto Mitä suoli edellä, sitä aivot perässä Erkki Eerola Turun yliopisto N Engl J Med, Vol. 347, No. 12 September 19, 2002 Päämenetelmät bakteerien osoittamiseen näytteistä Bakteeriviljely Bakteereiden komponenttien



KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,


Suolisto ja vastustuskyky. Lapin urheiluakatemia koonnut: Kristi Loukusa

Suolisto ja vastustuskyky. Lapin urheiluakatemia koonnut: Kristi Loukusa Suolisto ja vastustuskyky Lapin urheiluakatemia koonnut: Kristi Loukusa Suoliston vaikutus terveyteen Vatsa ja suolisto ovat terveyden kulmakiviä -> niiden hyvinvointi heijastuu sekä fyysiseen että psyykkiseen


FINRISKI terveystutkimuksen mukaan

FINRISKI terveystutkimuksen mukaan Lihavuus ja raskaus Tammikuun kihlaus 27.01.2017 el Jenni Metsälä Taulukko 1. Lihavuuden luokitus painoindeksin (BMI, kg/m 2) perusteella. Normaalipaino Liikapaino (ylipaino) Lihavuus Vaikea lihavuus Sairaalloinen


Ruoka- ja ravintoaineet 12

Ruoka- ja ravintoaineet 12 Sisällys Johdanto (Anna-Maija Tiainen) 9 1 Ruoka- ja ravintoaineet 12 Energia ja energiaravintoaineet (Senja Arffman) 13 Hiilihydraatit 14 Proteiinit 16 Rasvat 17 omega-3 ja -6 -rasvahapot 19 Alkoholi


Allergia ja astma. Erkki Vartiainen, professori, ylijohtaja. 5.9.2012 Esityksen nimi / Tekijä 1

Allergia ja astma. Erkki Vartiainen, professori, ylijohtaja. 5.9.2012 Esityksen nimi / Tekijä 1 Allergia ja astma Erkki Vartiainen, professori, ylijohtaja 5.9.2012 Esityksen nimi / Tekijä 1 Aikuisväestön sekä lasten ja nuorten astma- ja allergiatutkimukset Pohjois- Karjalassa ja Pitkärannassa 5.9.2012


Bakteereja tunnistetaan a) muodon perusteella:

Bakteereja tunnistetaan a) muodon perusteella: Bakteereja tunnistetaan a) muodon perusteella: ja b) värjäytyvyyden perusteella: 1) Gram-positiiviset Soluseinän ulkokalvo värjäytyy 2) Gram negatiiviset Soluseinän ulkokalvo jää värjäytymättä Laborointi



UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA UUDET TEKNIIKAT SISÄYMPÄRISTÖN MIKROBIEN TOTEAMISESSA LIITU-päivä 4.5.2006 FT Helena Rintala Kansanterveyslaitos, Ympäristöterveyden osasto Mihin sisäympäristön mikrobien mittauksia tarvitaan? Rakennusten


RUOANSULATUS JA SUOLISTON KUNTO. Iida Elomaa & Hanna-Kaisa Virtanen

RUOANSULATUS JA SUOLISTON KUNTO. Iida Elomaa & Hanna-Kaisa Virtanen RUOANSULATUS JA SUOLISTON KUNTO Iida Elomaa & Hanna-Kaisa Virtanen Edellisen leirin Kotitehtävä Tarkkaile sokerin käyttöäsi kolmen päivän ajalta ja merkkaa kaikki sokeria ja piilosokeria sisältävät ruuat


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


Jyväskylän yliopisto

Jyväskylän yliopisto SUOLISTON MIKROBISTON KOOSTUMUKSEN EROT JA YHTEYS VISKERAALISEN RASVAKUDOKSEN GEENIEN ILMENTYMISEEN HCR- JA LCR- ROTILLA Tiina Hongisto Liikuntalääketieteen pro gradu -tutkielma Terveystieteiden laitos


Ihmisen mikrobiomit. Kehon mikrobiomien yleispiirteitä

Ihmisen mikrobiomit. Kehon mikrobiomien yleispiirteitä Anne Salonen KATSAUS Normaalibakteeristo yhä useamman taudin taustalla Ihmisen mikrobiomit Mikrobiomit ovat ihoa ja eri ruuminonteloiden limakalvoja asuttavia monimuotoisia bakteeriyhteisöjä. Kunkin kasvupaikan


Bakteeriston merkitys terveydelle avautuu vähitellen

Bakteeriston merkitys terveydelle avautuu vähitellen Katsaus tieteessä Pentti Huovinen LKT, kliinisen mikrobiologian erikoislääkäri, bakteeriopin professori Turun yliopisto tutkimusprofessori, Terveyden ja hyvinvoinnin laitos Bakteeriston


Tulehdusta vähentävä ruokavalio. Marja Vanhala FT, laillistettu ravitsemusterapeutti, ODL Liikuntaklinikka

Tulehdusta vähentävä ruokavalio. Marja Vanhala FT, laillistettu ravitsemusterapeutti, ODL Liikuntaklinikka Tulehdusta vähentävä ruokavalio Marja Vanhala FT, laillistettu ravitsemusterapeutti, ODL Liikuntaklinikka Esityksen sisältöä Tulehdus, sen yhteys sairauksiin ja tunnistaminen Tulehdusta vähentävä ruokavalio



KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN Suomen Ympäristösairauskeskus perustettiin viime vuonna ajantasaisen ympäristösairaustiedon asiantuntijakeskukseksi. Tavoitteena on ajantasaisen,


Suolistobakteeriston yhteys tauteihin

Suolistobakteeriston yhteys tauteihin Katsaus Erkki eerola Elimistöä suojaavat mikrobit ovat ihmiselle välttämättömiä. Ne varjelevat taudinaiheuttajilta ja vaikuttavat immuniteetin kehittymiseen. Suolistomikrobit vaikuttavat myös suoliston


Ihmiskeho. Ruoansulatus. Jaana Ohtonen Kielikoulu/Språkskolan Haparanda. söndag 16 februari 14

Ihmiskeho. Ruoansulatus. Jaana Ohtonen Kielikoulu/Språkskolan Haparanda. söndag 16 februari 14 Ihmiskeho Ruoansulatus Ruoansulatus Keho voi ottaa talteen ja käyttää hyvin pieniä molekyylejä. Useimmat ravintoaineet ovat suuria molekyllejä. Ravintoaineet on hajotettava pieniksi osasiksi ennen kuin





Lihavuus ja liitännäissairaudet

Lihavuus ja liitännäissairaudet Rasvahapot valtimotaudin vaaran arvioinnissa Lihavuus ja liitännäissairaudet Antti Jula, ylilääkäri, sisätautiopin dosentti, THL VIII Valtakunnallinen Kansanterveyspäivä 12.12.2011 Lihavuus ja liitännäissairaudet


vauriotyypit Figure 5-17.mhc.restriktio 9/24/14 Autoimmuniteetti Kudosvaurion mekanismit Petteri Arstila Haartman-instituutti Patogeeniset mekanismit

vauriotyypit Figure 5-17.mhc.restriktio 9/24/14 Autoimmuniteetti Kudosvaurion mekanismit Petteri Arstila Haartman-instituutti Patogeeniset mekanismit vauriotyypit Kudosvaurion mekanismit Autoimmuniteetti Petteri Arstila Haartman-instituutti Antigeenin tunnistus HLA:ssa pitää sisällään autoimmuniteetin riskin: jokaisella on autoreaktiivisia lymfosyyttejä





Probiotic 12. PRO12-koostumus saatavana vain LR:ltä! P R O B I OO TT I NEN RAVINTOLISÄ

Probiotic 12. PRO12-koostumus saatavana vain LR:ltä! P R O B I OO TT I NEN RAVINTOLISÄ Probiotic 12 PRO12-koostumus saatavana vain LR:ltä! P R O B I OO TT I NEN RAVINTOLISÄ Probiotic 12 Mitä ovat probiootit? MITÄ OVAT PROBIOOTIT? Ihmisen suolistossa on miljoonittain bakteereja Nämä bakteerit


Kuinka entsyymit toimivat?

Kuinka entsyymit toimivat? Mitä ovat entsyymit? Entsyymit ovat proteiineja, jotka toimivat kemiallisten reaktioiden katalysaattorina elimistössä. Niitä voidaan verrata liekin puhaltamiseen tulen sytyttämiseksi. Jos liekkeihin ei


Terveellinen kaura. Lumoudu kaurasta Kaurapäivä 1.10.2013. Kaisa Mensonen Leipätiedotus ry

Terveellinen kaura. Lumoudu kaurasta Kaurapäivä 1.10.2013. Kaisa Mensonen Leipätiedotus ry Terveellinen kaura Lumoudu kaurasta Kaurapäivä 1.10.2013 Kaisa Mensonen Leipätiedotus ry Mikä on Leipätiedotus? Leipomoalan yhteinen tiedotusyksikkö Perustettu 1961 Rahoitus Perusbudjetti jäsenmaksuista


Onko poikimavälillä vaikutusta tuotantoon ja terveyteen? Terveydenhuoltoeläinlääkäri Virpi Kurkela ProAgria Oulu

Onko poikimavälillä vaikutusta tuotantoon ja terveyteen? Terveydenhuoltoeläinlääkäri Virpi Kurkela ProAgria Oulu Onko poikimavälillä vaikutusta tuotantoon ja terveyteen? Terveydenhuoltoeläinlääkäri Virpi Kurkela ProAgria Oulu Poikimavälin vaikutus terveyteen vai terveyden vaikutus poikimaväliin? Utaretulehdus PITKÄ


Gram-värjäykset. Olli Meurman

Gram-värjäykset. Olli Meurman Gram-värjäykset Olli Meurman 5.2.2010 Gram-värjäys Gram-positiivinen Kiinnitys (kuumennus/alkoholi) Gram-negatiivinen Kristalliviolettivärjäys Kiinnitys jodilla Värinpoisto alkoholilla Safraniinivärjäys


Suoliston Mikrobisto ja Terveys

Suoliston Mikrobisto ja Terveys Suoliston Mikrobisto ja Terveys Seppo Salminen Functional Foods Forum Lääketieteellinen tiedekunta Turun yliopisto Kahvipensaan tuholaiset? Muovia hajottavat mikrobit suolistossa? Kahvipensaassa menestyvät


Maito ravitsemuksessa

Maito ravitsemuksessa Maito ravitsemuksessa Sisältö Ravitsemussuositukset kehottavat maidon juontiin Maidon ravintoaineet Mihin kalsiumia tarvitaan? Kalsiumin saantisuositukset Kuinka saadaan riittävä annos kalsiumia? D-vitamiinin


1000 ensimmäistä päivää vaikuttavimmat. tulevalle terveydelle Carina Kronberg Kippilä Jyväskylä Sairaus Terveys.

1000 ensimmäistä päivää vaikuttavimmat. tulevalle terveydelle Carina Kronberg Kippilä Jyväskylä Sairaus Terveys. 1000 ensimmäistä päivää vaikuttavimmat tulevalle terveydelle Carina Kronberg Kippilä Jyväskylä 31.8.2016 1000 ensimmäistä päivää vaikuttavimmat Vaikuttavuus Sairaus Terveys -9 kk Syntymä 36 kk Kasvu &


Bakteeriperäisen turistiripulin diagnostiikka nukleiinihaponosoitusmenetelmillä

Bakteeriperäisen turistiripulin diagnostiikka nukleiinihaponosoitusmenetelmillä Bakteeriperäisen turistiripulin diagnostiikka nukleiinihaponosoitusmenetelmillä Sointu Mero HUSLAB 5.2.2015 Labquality Days Luennon sisältöä: matkailutaustaa ulosteen bakteeriviljely nukleiinihaponosoitusmenetelmät


Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve


Yläkouluakatemia viikot 6 ja 7 /2015

Yläkouluakatemia viikot 6 ja 7 /2015 Yläkouluakatemia viikot 6 ja 7 /2015 Suoliston vaikutus terveyteen Vatsa ja suolisto ovat terveyden kulmakiviä -> niiden hyvinvointi heijastuu sekä fyysiseen että psyykkiseen hyvinvointiin Jopa 80% ihmisen



ANALYYTIT JA ANALYYSIN KUVAUS CDSA 2.0 ANALYYTIT MDD Terveyspalvelut Oy Postiosoite: Salomonkatu 17 B 4. krs PL 27, 00101 Helsinki 00100 Helsinki S-posti: Puh. (09) 622 4424 ANALYYTIT JA ANALYYSIN KUVAUS CDSA 2.0 Ruuansulatusvaivat


Labquality Kudos- ja märkänäytteiden bakteeriviljely 2006-2010

Labquality Kudos- ja märkänäytteiden bakteeriviljely 2006-2010 Labquality Kudos- ja märkänäytteiden bakteeriviljely 2006-2010 Markku Koskela OYS/Mikrobiologian laboratorio 5-vuotisseurantajakson kertymä 20 bakteeriviljelykierrosta 80 potilasnäytettä 40 Pu-BaktVi2;


Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012. Lihavuus kansanterveyden haasteena

Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012. Lihavuus kansanterveyden haasteena Terveyden edistämisen professori Tiina Laatikainen Karjalan lääketiedepäivät 14.6.2012 Lihavuus kansanterveyden haasteena Lihavuus kuoleman vaaratekijänä Yli 6000 lihavan keskimäärin 15 vuoden seuranta





Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi

Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Mitä elämä on? Astrobiologian luento 15.9.2015 Kirsi Määritelmän etsimistä Lukemisto: Origins of Life and Evolution of the Biosphere, 2010, issue 2., selaile kokonaan Perintteisesti: vaikeasti määriteltävä


Juusto ravitsemuksessa

Juusto ravitsemuksessa Juusto ravitsemuksessa Juusto ravitsemuksessa Rakennusaineita luustolle Hammasystävällistä Sopii erityisruokavalioihin Juustojen koostumus vaihtelee Tuorejuusto valmistustavan mukaan Kypsytetty juusto


Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen

Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL Juha Partanen Geenisakset (CRISPR)- Geeniterapian vallankumousko? BMOL 19.11.2016 Juha Partanen Geenisakset 2 2 N A T U R E V O L 5 2 2 4 J U N E 2 0 1 5 Sisältö Geenimuokkaus: historiallinen perspektiivi Geenisakset


Luomumaito tutkimuskohteena

Luomumaito tutkimuskohteena Luomumaito tutkimuskohteena Tuomo Tupasela, erikoistutkija, Luke 17.1.2017, Luomumaidon arvoketjutyöryhmän kokous, Helsinki, Viikki, kokoushuone Savotta, Latokartanonkaari 9 Maito-Inno hanke, MMM 2016-2019


REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio 1 Oulun kaupungin elintarvike- ja ympäristölaboratorio Oy PL 19 90015 Oulun kaupunki Puh. 044 7036740 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Mikrobit (homeet, hiivat, bakteerit



1.1 MIKROBIT ELINTARVIKKEISTA Kainuun elintarvike- ja ympäristölaboratorio 1. ELINTARVIKKEET Hinta alv 0 % Hinta alv. 24 % 1.1 MIKROBIT ELINTARVIKKEISTA Bacillus cereus 16,58 20,56 Campylobacter spp. 38,53 47,78 Clostridium perfringens





Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


Suoliston Mikrobisto ja Terveys

Suoliston Mikrobisto ja Terveys Suoliston Mikrobisto ja Terveys Seppo Salminen Functional Foods Forum Lääketieteellinen tiedekunta Turun yliopisto Ihminen ja mikrobit Vuorovaikutus, joka säätelee koko elämäämme Uusin tutkimustieto kertoo


Mikrobiryhmät. Bakteeriviljelmät

Mikrobiryhmät. Bakteeriviljelmät Mikrobit Kuuluvat moneen eri eliökunnan ryhmään (bakteereihin, arkkeihin, alkueliöihin ja sieniin lisäksi virukset) Hajottajia (lahottajat ja mädättäjät), patogeeneja (taudinaiheuttajia), tuottajia (yhteyttävät),


Ravinnon hiilihydraatit ystävä vai vihollinen? Mikael Fogelholm, dosentti, ETT Johtaja, Suomen Akatemia, terveyden tutkimuksen yksikkö

Ravinnon hiilihydraatit ystävä vai vihollinen? Mikael Fogelholm, dosentti, ETT Johtaja, Suomen Akatemia, terveyden tutkimuksen yksikkö Ravinnon hiilihydraatit ystävä vai vihollinen? Mikael Fogelholm, dosentti, ETT Johtaja, Suomen Akatemia, terveyden tutkimuksen yksikkö 1 7.4.2011 Ravintoaineiden saantisuositukset Ruoankäyttösuositukset


Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia

Epigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays


Vesimikrobiologian uudet menetelmät ja standardit

Vesimikrobiologian uudet menetelmät ja standardit Vesimikrobiologian uudet menetelmät ja standardit Erikoistutkija, Dos., FT Tarja Pitkänen 3.10.2016 Ajankohtaista laboratoriorintamalla 2016 / Tarja Pitkänen 1 Veden laadun hallinta ja vesimikrobiologia


Ravitsemuksen ABC. Kuopion Reippaan Voimistelijat Ry Ravitsemustieteen opiskelija Noora Mikkonen

Ravitsemuksen ABC. Kuopion Reippaan Voimistelijat Ry Ravitsemustieteen opiskelija Noora Mikkonen Ravitsemuksen ABC Kuopion Reippaan Voimistelijat Ry Ravitsemustieteen opiskelija Noora Mikkonen Tulossa La 25.10. La 8.11. La 15.11. La 22.11. La 29.11. Energiaravintoaineiden kirjo: energian tarve ja



BI4 IHMISEN BIOLOGIA BI4 IHMISEN BIOLOGIA IHMINEN ON TOIMIVA KOKONAISUUS Ihmisessä on noin 60 000 miljardia solua Solujen perusrakenne on samanlainen, mutta ne ovat erilaistuneet hoitamaan omia tehtäviään Solujen on oltava


Diagnostisten testien arviointi

Diagnostisten testien arviointi Erkki Savilahti Diagnostisten testien arviointi Koe antaa tuloksen pos/neg Laboratoriokokeissa harvoin suoraan luokiteltavissa Testin hyvyys laskettavissa tunnuslukujen avulla Diagnostisten testien arviointi


Bentsoehappo akkr Sisäinen menetelmä, perustuu NMKL 124:1987. Bromidi, epäorgaaninen akkr Sisäinen menetelmä, perustuu EN 13191-2:1998

Bentsoehappo akkr Sisäinen menetelmä, perustuu NMKL 124:1987. Bromidi, epäorgaaninen akkr Sisäinen menetelmä, perustuu EN 13191-2:1998 Bentsoehappo Sisäinen menetelmä, perustuu NMKL 124:1987 Bromidi, epäorgaaninen Sisäinen menetelmä, perustuu EN 13191-2:1998 Campylobacter jejuni/coli Sisäinen menetelmä, VIDAS Campylobacter jejuni/coli,


Terveelliset elämäntavat

Terveelliset elämäntavat Terveelliset elämäntavat (lyhyt ohje/ Duodecim Terveyskirjasto) Ravinto Kasviksien, hedelmien ja marjojen runsas käyttö Viljatuotteet kuitupitoisia täysjyvävalmisteita Maito- ja lihatuotteet rasvattomina


Hevoset käyttävät luonnon- ja laidunolosuhteissa

Hevoset käyttävät luonnon- ja laidunolosuhteissa HEVOSTEN RUOKINTAKOULU, OSA I. 2015 Hevosen ruuansulatuselimistön rakenne ja toiminta Suomen Hevostietokeskus ry, Hevosten terveydeksi -hanke FT Elena Autio Hevostietokeskuksen ruokintakoulun ensimmäisessä


Tiedolla, kokeiluilla ja yhteistyöllä luodaan kestävää kehitystä

Tiedolla, kokeiluilla ja yhteistyöllä luodaan kestävää kehitystä Tiedolla, kokeiluilla ja yhteistyöllä luodaan kestävää kehitystä Eeva Furman Kestävän kehityksen asiantuntijapaneeli Suomen ympäristökeskus SYKE 15.12.2014 Alustukseni rakenne Miksi uusi tutkimustieto


Antibioottiresistenssitilanne Varsinais-Suomessa Kaisu Rantakokko-Jalava

Antibioottiresistenssitilanne Varsinais-Suomessa Kaisu Rantakokko-Jalava Antibioottiresistenssitilanne Varsinais-Suomessa 2015 Kaisu Rantakokko-Jalava 29.2.2016 Stafylokokkien resistenssi (% R) vuonna 2015 kliiniset näytteet (1 kanta/potilas) S. aureus S. epidermidis aikuiset


BIOHIT OYJ. Globaaleilla markkinoilla toimiva suomalainen bioteknologiayritys

BIOHIT OYJ. Globaaleilla markkinoilla toimiva suomalainen bioteknologiayritys BIOHIT OYJ Globaaleilla markkinoilla toimiva suomalainen bioteknologiayritys 1 Biohit lyhyesti Biohit Oyj on globaaleilla markkinoilla toimiva suomalainen bioteknologiayritys. Missiomme Innovating for


X kestävyysseminaari, Pajulahti 10.12.05 PAINANKO LIIKAA? Dosentti, ETT Mikael Fogelholm Johtaja, UKK-instituutti, Tampere

X kestävyysseminaari, Pajulahti 10.12.05 PAINANKO LIIKAA? Dosentti, ETT Mikael Fogelholm Johtaja, UKK-instituutti, Tampere X kestävyysseminaari, Pajulahti 10.12.05 PAINANKO LIIKAA? Dosentti, ETT Johtaja, UKK-instituutti, Tampere Miten paino, painoindeksi ja rasva-% eroavat eri lajien urheilijoilla? Onko kehon koostumuksella


Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.


Bakteerialtistuminen maatiloilla ja ei-maatiloilla asuvilla lapsilla - yhteys atopiaan ja astmaan

Bakteerialtistuminen maatiloilla ja ei-maatiloilla asuvilla lapsilla - yhteys atopiaan ja astmaan Bakteerialtistuminen maatiloilla ja ei-maatiloilla asuvilla lapsilla - yhteys atopiaan ja astmaan Maria Valkonen, Inge Wouters, Martin Täubel, Helena Rintala, Ritva Vasara, Dick Heederik, Jon Genuneit,


Terveillä vasikoilla on terveet mahat

Terveillä vasikoilla on terveet mahat Terveillä vasikoilla on terveet mahat Benfital Plus koska maitojuotto on tärkeää Vetmedica Etusijalla eläinten hyvinvointi Miksi vasikoille tulee ripuli? Miksi on tärkeää ennaltaehkäistä vasikoiden ripulia?


Ohje: Miten haen aineistoa Terveysportin verkkopalvelusta

Ohje: Miten haen aineistoa Terveysportin verkkopalvelusta Ohje: Miten haen aineistoa Terveysportin verkkopalvelusta a) Verkkopalvelun ulkoasu...1 b) Aineiston hakeminen Terveysportissa...5 c) Aineiston tulostaminen Terveysportissa...7 a) Verkkopalvelun ulkoasu


BIOLOGIA 1. kurssi 7. luokka

BIOLOGIA 1. kurssi 7. luokka 1. kurssi 7. luokka Kurssin tavoitteena on ohjata oppilasta ymmärtämään elämän perusilmiöitä ja vesiekosysteemien rakennetta ja toimintaa. Tavoitteena on, että oppilas oppii tunnistamaan ja luokittelemaan


Onko ruokavaliolla merkitystä reumasairauksien hoidossa?

Onko ruokavaliolla merkitystä reumasairauksien hoidossa? Onko ruokavaliolla merkitystä reumasairauksien hoidossa? Ravitsemusterapeutti Nea Kurvinen Ravitsemusterapia Balans Ravitsemuksen merkitys reuman hoidossa Monipuolinen


Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä

Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Molekyylibiologiaan perustuvat mikrobiyhteisömääritykset ja niiden käyttökohteet yhdyskuntajätevesien käsittelyssä Vesihuoltopäivät 10.5.2017, Jyväskylä Jenni Kesulahti Diplomityö Aalto-yliopistossa Hankkeessa



REUMA JA SYDÄN KARI EKLUND HELSINGIN REUMAKESKUS REUMA JA SYDÄN KARI EKLUND HELSINGIN REUMAKESKUS Sisältö Sydän ja nivelreuma Sydän- ja verisuonitaudit - ateroskleroosi - riskitekijät Nivelreuma ja sydän- ja verisuonitaudit - reumalääkitys ja sydän Kuinka


Vaihda suun huonot bakteerit hyviin.

Vaihda suun huonot bakteerit hyviin. Vaihda suun huonot bakteerit hyviin. Ien- ja hammasvaivojen taustalla epätasapainoinen mikrobisto kk Annika Mäyrä I I +358 40 549 7114 Maailmanlaajuisesti 2.43 miljardia ihmistä


ANALYYTIT. 1. Kymotrypsiini (Chymotrypsin)

ANALYYTIT. 1. Kymotrypsiini (Chymotrypsin) MDD Terveyspalvelut Oy Postiosoite: Salomonkatu 17 B 4. krs PL 27, 00101 Helsinki 00100 Helsinki S-posti: Puh. (09) 622 4424 ANALYYTIT JA ANALYYSIN KUVAUS CDSA Tämä testi analysoi


Vähän tietoja Renew Life -yhtiöstä

Vähän tietoja Renew Life -yhtiöstä Vähän tietoja Renew Life -yhtiöstä Jos halutaan tietää, miksi Renew Life on erityinen yhtiö, on tunnettava Renew Lifen vuonna 1997 perustaneen Brenda Watsonin tarina. Brenda kärsi huonosta terveydestä



OMAISLUOVUTUS OHJE MUNUAISLUOVUTTAJALLE. OMAISLUOVUTUS OHJE MUNUAISLUOVUTTAJALLE. Terve ihminen voi luovuttaa toisen munuaisensa omaiselleen ja läheiselle henkilölle. Luovutus perustuu aina vapaaehtoisuuteen ja voimakkaaseen haluun auttaa munuaissairasta


REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio Jyväskylän ympäristölaboratorio Eeronkatu 10 40720 JYVÄSKYLÄ Puh. 014 626650 EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT asumisterveystutkimukset Mikrobit (homeet, hiivat, bakteerit ja aktinobakteerit) akkr


NivelTeho. 120 kaps. 32,90. (ovh. 40,70) 411,25 e/kg

NivelTeho. 120 kaps. 32,90. (ovh. 40,70) 411,25 e/kg NivelTeho Liiku nivelet lempeästi kuntoon. Kuuden tutkitun aktiiviaineen yhdistelmä: MSM, inkivääriuute, glukosamiini, hainrusto, kupari ja C-vitamiini. 120 kaps. 32,90 411,25 e/kg (ovh. 40,70) Luontainen


Harvinaissairauksien yksikkö. Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta. Taustaa. Alfa-tryptasemia. 21/03/16 /ms

Harvinaissairauksien yksikkö. Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta. Taustaa. Alfa-tryptasemia. 21/03/16 /ms Lausunto Ehlers-Danlos tyyppi III:n taudinkuvasta Taustaa EDS potilasyhdistys ja yksittäinen potilas ovat lähestyneet HYKS harvinaissairauksien yksikköä ja pyytäneet lausuntoa, minkälainen sairaus Ehlers-Danlos



PALAUTE BAKTERIOLOGIAN LAADUNARVIOINTIKIERROKSILTA. Markku Koskela OYS/Mikrobiologian laboratorio (OML) PALAUTE BAKTERIOLOGIAN LAADUNARVIOINTIKIERROKSILTA Markku Koskela OYS/Mikrobiologian laboratorio (OML) Bakteriologian kierroksen koostumus 2003 lähtien Näytteet 1 ja 2: Aerobiviljely-> patogeenien tunnistus


Virusriskin vähentäminen elintarviketuotannossa

Virusriskin vähentäminen elintarviketuotannossa Virusriskin vähentäminen elintarviketuotannossa Satu Salo, VTT Expert Services Oy Marjaana Rättö, Irina Tsitko ja Hanna Miettinen, VTT 2 Viruskontaminaation riskinhallintakeinojen kehittäminen ja arvioiminen


DairyPilot FlavoVital. Pakkaus koko maidontuotantokaudelle

DairyPilot FlavoVital. Pakkaus koko maidontuotantokaudelle DairyPilot FlavoVital Pakkaus koko maidontuotantokaudelle ESIPUHE: PANSEN-PILOTIN MENESTYSTARINA Tyytyväisyys Pansen-Pilotiin on vahvistunut useiden tilatulosten perusteella vuosien saatossa. Pansen-Pilot


Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin?

Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? Käänteisestä rokotetutkimuksesta ratkaisu flavobakteeriongelmiin? 26.3.2015 Kalaterveyspäivät, Tampere Krister Sundell Akvaattisen patobiologian laboratorio Åbo Akademi Flavobacterium psychrophilum Aiheuttaa


Hyvinvointia työstä. Muuttuuko ihminen ja jos niin mihin suuntaan? 22.11.2012. Harri Vainio. SALVE-tutkimusohjelman päätösseminaari 21.11.

Hyvinvointia työstä. Muuttuuko ihminen ja jos niin mihin suuntaan? 22.11.2012. Harri Vainio. SALVE-tutkimusohjelman päätösseminaari 21.11. Hyvinvointia työstä Muuttuuko ihminen ja jos niin mihin suuntaan? SALVE-tutkimusohjelman päätösseminaari 21.11.2012 Harri Vainio 1 Miksi nousimme kahdelle jalalle 6-4,2 miljoonaa vuotta sitten? Ihmisapinoiden



GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKAN PERUSASIOITA GEENITEKNIIKKKA ON BIOTEKNIIKAN OSA-ALUE! Biotekniikka tutkii ja kehittää elävien solujen, solun osien, biokemiallisten menetelmien sekä molekyylibiologian uusimpien menetelmien


REKISTERIOTE Hyväksytty laboratorio

REKISTERIOTE Hyväksytty laboratorio Savo-Karjalan Ympäristötutkimus Oy, elintarvikkeet Kuopion laboratorio Yrittäjäntie 24 70150 KUOPIO EVIRAN REKISTERISSÄ OLEVAT MENETELMÄT elintarvikkeet Aerobiset mikro-organismit akkr ISO 4833:2003 Anaerobiset
