Effect of fungal community and diversity on Norway spruce decomposition

Koko: px
Aloita esitys sivulta:

Download "Effect of fungal community and diversity on Norway spruce decomposition"

Transkriptio

1 Effect of fungl community nd diversity on Norwy spruce decomposition Lr Vlentín 1 Tiin Rjl 1, Mikko Peltoniemi 1, Jussi Heinonslo 2, Tin Pennnen 1, Ris Mäkipää 1 1 Metl, Vnt Unit 2 Dpt Food nd Environmentl Sciences, University of Helsinki Seminr on Forest ecology nd chllenges in the forest modelling 15 th December 11, Metl

2 "Succession nd diversity of wood inhbiting fungi during decomposition of ded wood " Does fungl diversity dilution ffect the wood decomposition? Does fungl community composition of different decy stge ffect wood decomposition? How enzyme ctivities chnge in reltion to fungl diversity nd community composition? Wht bout in reltion to decomposition?

3 Wood smples: 46 fllen logs from unmnged Norwy spruce forest from Lpinjärvi

4 Effect of fungl diversity dilution on spruce decomposition Experimentl set up Decy clss of swdust I = erly decy II = medium decy III = lte decy Non sterile Inocul I II III Sterile substrte I II III Microcosm 1 Dilution of swdust I Microcosm 2 Dilution of swdust II Microcosm 3 Dilution of swdust III ND = non diluted inoculum 1 1 = dilution of 1-1 g of inoculum/g of substrte (dm) 1 2 = dilution of 1-2 g of inoculum/g of substrte (dm) Ctrl = sterile substrte (2 times 121 C for min, 3-dy intervl)

5 Fungl functionlity ssessed by mesuring the respirtion ctivity nd wood degrding enzyme ctivities. Erly decy Medium decy Lte decy Anlysis Respirtion ctivity Incubtion t 21 ºC for 17 weeks wood degrding enzymes Incubtion t 21 ºC for 13 weeks 3 microcosms x 4 tretments x 3 replictes = 36 bottles 3 microcosms x 4 tretment x 3 replictes = 36 bottles CO 2 production DNA extrction nd 17 weeks Enzyme nlysis 17 weeks DNA Extrction, 9 nd 13 weeks Enzyme nlysis 4, 6, 9, 11 nd 13 weeks

6 Wood decomposition: Weekly produced CO 2 mesured by gs chromtogrphy. Replcement of ir by evcution system with moist ir to prevent O 2 depletion nd drought. % C loss = (Cumulted CO 2 /Mx CO 2 ) x 1 Mx CO 2 = mss swdust (g) x %C x M CO2 /M C

7 Activities of lignocellulose modifying enzymes: Two cellulose degrding enzymes: glucosidse, cellobiohydrolse. Two hemicellulose degrding enzymes: glucuronidse, xylosidse. Lignin modifying enzyme: lccse. Extrction by filter centrifugtion method. Hydrolytic enzymes mesured by fluorimetric ssy using methylumbelliferone substrtes. Lccse mesured by colorimetric ssy following the oxidtion of ABTS. 5 μl tube filter 2 ml micro centrifuge tube

8 DNA nlysis of fungl community: Totl DNA extrction using commercil kit NucleoSpin 96 Soil Kit. Fungl DNA mplifiction by Polymerse Chin Rection (PCR) with primers pir GC ITS1F nd ITS2. DNA seprtion by denturing grdient gel electrophoresis (DGGE). Bnds in the gel were nlyzed by GelCompr II softwre. A bnd in the gel represents n Opertionl Txonomic Unit (OTU). Source: Mcherey Ngel

9 Results Influence of fungl diversity

10 Fungl diversity decresed by diluting the inoculum with the substrte. Non diluted inocul Control 1 1 diluted inocul 1 2 diluted inocul L LIII II I III II I III L II I III II I

11 OTUs number increses in reltion with decy stge. Grdul reduction of OTUs due to dilution of inoculum. After incubtion fungl diversity increses. C loss nd OTUs increse in reltion with wood decy stge. Diversity t beginning Diversity t end (16 weeks) 4 Crbon loss (16 weeks) OTUs OTUs Crbon loss % ND 1/1 1/1 Ctrl ND 1/1 1/1 Ctrl ND 1/1 1/1 Ctrl Erly decyed swdust Middle decyed swdust Lte decyed swdust Microcosms

12 Influence of decy stge nd inoculum dilution on CO 2 production: No cler dilution effect on decomposition for erly nd lte decyed swdust. Dilution of medium decyed swdust ffects spruce decomposition. Cum CO 2 mg/g Erly decy b b b Medium decy Time (dys) b b c Lte decy b ND = non diluted inoculum 1 1 = dilution of 1 1 of inoculum 1 2 = dilution of 1 2 of inoculum Ctrl = control: sterile substrte CO 2 levels mrked with the sme letter re not different ccording to Tukey s test (P <.5).

13 Totl hydrolytic ctivity in medium decyed swdust: Activities lower thn 3 pkt/g. β glucuronidse ctivity levels were the highest (dt not shown). Downwrd trend towrds the end of incubtion. 25 Medium decy Activity (pkt/g) ND = non diluted inoculum 1 1 = dilution of 1 1 of inoculum 1 2 = dilution of 1 2 of inoculum Ctrl = control: sterile substrte Time (weeks)

14 Reltionship of crbohydrte degrding ctivity nd wood decomposition: Role of hydrolytic enzymes on the initil phse of decomposition Hydrolytic ct/cum CO erly decy middle decy lte decy Time (weeks)

15 Chnges of of fungl community structure long the incubtion

16 Conclusions Decomposition incresed long with number of fungl tx (OTUs) nd decy clss of the wood. Dilution decresed fungl diversity, but number of OTUs recovered long with the incubtion. The effect of fungl diversity reduction on wood decomposition ws only cler for middle decyed swdust. Fungl diversity reduction did not reflect chnges in enzyme production, only lccse ctivity incresed in reltion with decy.

17 Prt 2 Does fungl community composition of different decy stge ffect wood decomposition?

18 Experimentl set up Effect of species composition Microcosm 1 Erly decyed substrte+ different inocul Erly decyed inoculum (I) hs less effect on substrtes decomposition thn medium (II), lte (III) or mix inocul (M) hve. Microcosm 2 Medium decyed substrte + different inocul Microcosm 3 Lte decyed substrte + different inocul Lte decyed substrte Medium decyed substrte Erly decyed substrte

19 Spruce decomposition depending on the community composition Cum CO 2 mg/g Erly decyed subsrte + different inoculum Medium decyed substrte + different inoculum Time (dys) b Lte decyed substrte + different inoculum b Erly decyed inoculum Lte decyed inoculum Medium decyed inoculum Mixture of inocul

20 Contributing to the study: Lbortorimestri Stu Repo (Experimentl set up, CO 2, evcution, enzymes, chemicl nlysis), Krin Pynnönen (preprtion of swdust smples). Trinees: Riikk Mäkelä (Enzymes, CO 2, DNA nlysis), Mtis Häyrynen (DNA nlysis), Srit Nukkrinen (upcoming DNA nlysis). Funding by Acdemy of Finlnd.

21 Kiitos

22 Totl hydrolytic ctivity in diversity dilution experiment: Activities lower thn 3 pkt/g. Similr levels mong swdust clss nd mong dilutions. Exceptions: Inoculum dilution 1 2 of swdust I nd III. Slight downwrd trend towrds the end of incubtion Activity (pkt/g) Time (weeks) Microcosms 1 Dilution of swdust I Time (weeks) Microcosms 2 Dilution of swdust II Time (weeks) Microcosms 3 Dilution of swdust III

23 After 17 weeks of incubtion, number of species nd CO2 production re relted

24 Experiment of funglcommunitycomposition OTUs hd low vrition. OTUs number slightly incresed towrds the end of incubtion in some microcosms. Inoculum from swdust I hd less effect on decomposition si + ii si + iii si + iiii si + im sii + ii sii + iii sii + iiii sii + im siii + ii siii + iii siii + iiii siii + im OTUs C loss % Microcoms

Sienidiversiteetti ja hajoamisprosessi lahopuussa. Raisa Mäkipää, Tiina Rajala, Lara Valentin, Mikko Peltoniemi ja Taina Pennanen

Sienidiversiteetti ja hajoamisprosessi lahopuussa. Raisa Mäkipää, Tiina Rajala, Lara Valentin, Mikko Peltoniemi ja Taina Pennanen Sienidiversiteetti j hjomisprosessi lhopuuss Ris Mäkipää, Tiin Rjl, Lr Vlentin, Mikko Peltoniemi j Tin Pennnen Monimuotoisuustutkimuksen seminri, Metsäntutkimuslitos, Vnt 22.3.2012 Sisältö Tust Lhopuudynmiikn

Lisätiedot

Sieniyhteisön lajiston ja monimuotoisuuden muutos puun lahotessa

Sieniyhteisön lajiston ja monimuotoisuuden muutos puun lahotessa Sieniyhteisön lajiston ja monimuotoisuuden muutos puun lahotessa Metsätieteen päivä 4.11.2010 Tiina Rajala, Mikko Peltoniemi, Taina Pennanen, Raisa Mäkipää Metsäntutkimuslaitos Skogsforskningsinstitutet

Lisätiedot

Gap-filling methods for CH 4 data

Gap-filling methods for CH 4 data Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling

Lisätiedot

Efficiency change over time

Efficiency change over time Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel

Lisätiedot

The CCR Model and Production Correspondence

The CCR Model and Production Correspondence The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls

Lisätiedot

Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)

Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4) Tilasto T1106120-s2012palaute Kyselyn T1106120+T1106120-s2012palaute yhteenveto: vastauksia (4) Kysymys 1 Degree programme: (4) TIK: TIK 1 25% ************** INF: INF 0 0% EST: EST 0 0% TLT: TLT 0 0% BIO:

Lisätiedot

Capacity Utilization

Capacity Utilization Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run

Lisätiedot

Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi

Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi

Lisätiedot

Fungi infecting cultivated moss can also cause diseases in crop plants

Fungi infecting cultivated moss can also cause diseases in crop plants Fungi infecting cultivated moss can also cause diseases in crop plants SEMINAR ON PEST RISK ASSESSMENT 2-3 October 2012, Helsinki, Finland 9.10.2012 1 Fungi infecting cultivated moss can also cause diseases

Lisätiedot

LYTH-CONS CONSISTENCY TRANSMITTER

LYTH-CONS CONSISTENCY TRANSMITTER LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are

Lisätiedot

MALE ADULT FIBROBLAST LINE (82-6hTERT)

MALE ADULT FIBROBLAST LINE (82-6hTERT) Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences

Lisätiedot

Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi

Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi Green Cities and Settlements 18.2.2014 Ville Manninen Writers Project group Sirpa Korhonen, Anna Mari

Lisätiedot

FETAL FIBROBLASTS, PASSAGE 10

FETAL FIBROBLASTS, PASSAGE 10 Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages

Lisätiedot

S SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA

S SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA S-55.1100 SÄHKÖTKNIIKKA JA LKTONIIKKA Tentti 15.5.2006: tehtävät 1,3,5,7,10 1. välikoe: tehtävät 1,2,3,4,5 2. välikoe: tehtävät 6,7,8,9,10 Saat vastata vain neljään tehtävään/koe; ne sinun pitää itse valita!

Lisätiedot

Teknillinen tiedekunta, matematiikan jaos Numeeriset menetelmät

Teknillinen tiedekunta, matematiikan jaos Numeeriset menetelmät Numeeriset menetelmät 1. välikoe, 14.2.2009 1. Määrää matriisin 1 1 a 1 3 a a 4 a a 2 1 LU-hajotelma kaikille a R. Ratkaise LU-hajotelmaa käyttäen yhtälöryhmä Ax = b, missä b = [ 1 3 2a 2 a + 3] T. 2.

Lisätiedot

Results on the new polydrug use questions in the Finnish TDI data

Results on the new polydrug use questions in the Finnish TDI data Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen

Lisätiedot

Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii

Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of

Lisätiedot

Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä

Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Arkkitehtuuritietoisku eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Esikysymys Kuinka moni aikoo suunnitella projektityönsä arkkitehtuurin? Onko tämä arkkitehtuuria?

Lisätiedot

Tree map system in harvester

Tree map system in harvester Tree map system in harvester Fibic seminar 12.6.2013 Lahti Timo Melkas, Metsäteho Oy Mikko Miettinen, Argone Oy Kalle Einola, Ponsse Oyj Project goals EffFibre project 2011-2013 (WP3) To evaluate the accuracy

Lisätiedot

Hyperglycemia Induced Cerebral Hematoma Expansion is Mediated by Plasma Kallikrein

Hyperglycemia Induced Cerebral Hematoma Expansion is Mediated by Plasma Kallikrein Hyperglycemi Induced Cererl Hemtom Expnsion is Medited y Plsm Kllikrein Authors: Ji Liu, Ben-Bo Go, Allen C. Clermont, Price Blir, Tmie J. Chilcote, Suknto Sinh, Roert Flumenhft, Edwrd P. Feener. Supplementry

Lisätiedot

S-55.1100 SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA

S-55.1100 SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA S-55.00 SÄHKÖKNKKA A KONKKA. välikoe 2..2008. Saat vastata vain neljään tehtävään!. aske jännite U. = 4 Ω, 2 = Ω, = Ω, = 2, 2 =, = A, 2 = U 2 2 2 2. ännitelähde tuottaa hetkestä t = t < 0 alkaen kaksiportaisen

Lisätiedot

Kestävä ja älykäs energiajärjestelmä

Kestävä ja älykäs energiajärjestelmä Ilmansuojeluyhdistys syyskokous 23.11.2017 Kestävä ja älykäs energiajärjestelmä Espoon kaukolämpö hiilineutraaliksi 2030 Ilkka Toijala / Head of Heating and Cooling, Finland / 23.11.2017 Kattava kaukolämpöverkko,

Lisätiedot

Määräaikaisen suojelusopimuksen optimaalinen pituus

Määräaikaisen suojelusopimuksen optimaalinen pituus 1 Määräaikaisen suojelusopimuksen optimaalinen pituus Monimuotoisuustutkimuksen seminaari, Metla Vantaa 22.3.2012 2 Tutkijaryhmä Artti Juutinen (Metla, OY, Metsähallitus) Pasi Reunanen (JY) Mikko Mönkkönen

Lisätiedot

Time spent reading magazines NRS 2012

Time spent reading magazines NRS 2012 Time spent reading magazines NRS 2012 Time spent reading magazines Researched in NRS Consumer 2012 survey through an internet questionnaire A customised form: only the magazines which the respondent had

Lisätiedot

Tork Paperipyyhe. etu. tuotteen ominaisuudet. kuvaus. Väri: Valkoinen Malli: Vetopyyhe

Tork Paperipyyhe. etu. tuotteen ominaisuudet. kuvaus. Väri: Valkoinen Malli: Vetopyyhe etu Monikäyttöpaperi hoitaa useimmat pyyhintätehtävät Sopiva lasipintojen pyyhintään Sopii käsien kuivaamiseen Elintarvikekäyttöön hyväksytty Tork Easy Handling, pakkaus, jota on helppo kantaa mukana,

Lisätiedot

Other approaches to restrict multipliers

Other approaches to restrict multipliers Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of

Lisätiedot

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project

Lisätiedot

Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu

Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be

Lisätiedot

7.4 Variability management

7.4 Variability management 7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product

Lisätiedot

Kannustavuus ja ohjauskeinot ilmastopolitiikassa: esimerkkinä hiilinielut metsätaloudessa

Kannustavuus ja ohjauskeinot ilmastopolitiikassa: esimerkkinä hiilinielut metsätaloudessa Kannustavuus ja ohjauskeinot ilmastopolitiikassa: esimerkkinä hiilinielut metsätaloudessa Jussi Uusivuori Metsäntutkimuslaitos (Metla) YMPÄRISTÖTIEDON FOORUMIN AAMUKAHVIT: Suomi, maankäytön muutokset ja

Lisätiedot

Tork Xpress Soft Multifold käsipyyhe. etu

Tork Xpress Soft Multifold käsipyyhe. etu etu Erinomainen imukyky: kuivaa kädet nopeasti Pehmeä: hellävarainen käsille Tork Carry Pack -pakkaus helpottaa käsittelyä ja hävittämistä Lehti kohokuviointi: suunniteltu tekemään kauniin vaikutelman

Lisätiedot

Reading times of magazines

Reading times of magazines Sektorin nimi 1 Reading times of magazines NRS Finland 2012 Sektorin nimi 2 Reading times of magazines Researched in NRS Consumer 2012 survey through an internet questionnaire A customised form: only the

Lisätiedot

Puuntuhkan vaikutus humuskerroksen mikrobistoon kangasmaalla

Puuntuhkan vaikutus humuskerroksen mikrobistoon kangasmaalla Konsortiohnke Puuntuhkn vikutus humuskerroksen mikrobistoon kngsmll Hnnu Fritze Jonn Perkiömäki Metsätehon rportti 82 17.12.1999 Puuntuhkn vikutus humuskerroksen mikrobistoon kngsmll Hnnu Fritze Jonn Perkiömäki

Lisätiedot

Ajettavat luokat: SM: S1 (25 aika-ajon nopeinta)

Ajettavat luokat: SM: S1 (25 aika-ajon nopeinta) SUPERMOTO SM 2013 OULU Lisämääräys ja ohje Oulun Moottorikerho ry ja Oulun Formula K-125ry toivottaa SuperMoto kuljettajat osallistumaan SuperMoto SM 2013 Oulu osakilpailuun. Kilpailu ajetaan karting radalla

Lisätiedot

ELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period

ELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period 1 ELEMET- MOCASTRO Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions Period 20.02-25.05.2012 Diaarinumero Rahoituspäätöksen numero 1114/31/2010 502/10

Lisätiedot

Operatioanalyysi 2011, Harjoitus 2, viikko 38

Operatioanalyysi 2011, Harjoitus 2, viikko 38 Operatioanalyysi 2011, Harjoitus 2, viikko 38 H2t1, Exercise 1.1. H2t2, Exercise 1.2. H2t3, Exercise 2.3. H2t4, Exercise 2.4. H2t5, Exercise 2.5. (Exercise 1.1.) 1 1.1. Model the following problem mathematically:

Lisätiedot

Biojätteen keruu QuattroSelect - monilokerojärjestelmällä. 21.10.2015 Tiila Korhonen SUEZ

Biojätteen keruu QuattroSelect - monilokerojärjestelmällä. 21.10.2015 Tiila Korhonen SUEZ Biojätteen keruu QuattroSelect - monilokerojärjestelmällä 21.10.2015 Tiila Korhonen SUEZ Agenda 1 SITA Suomi on SUEZ 2 QS, mikä se on? 3 QS maailmalla 4 QS Suomessa 5 QS Vaasassa SITA Suomi Oy ja kaikki

Lisätiedot

Metsäbiomassaan perustuvien nestemäisten biopolttoaineiden ilmastovaikutukset

Metsäbiomassaan perustuvien nestemäisten biopolttoaineiden ilmastovaikutukset Metsäbiomassaan perustuvien nestemäisten biopolttoaineiden ilmastovaikutukset FORESTENERGY2020 tutkimusohjelman tutkijaseminaari, VTT, 4.6.2012 Sampo Soimakallio VTT Technical Research Centre of Finland

Lisätiedot

LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet

LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50

Lisätiedot

Osallistujaraportit Erasmus+ ammatillinen koulutus

Osallistujaraportit Erasmus+ ammatillinen koulutus Osallistujaraportit 2016 Erasmus+ ammatillinen koulutus Suomesta lähteneiden ja Suomeen tulleiden vertailu V. 2016 osallistujaraporttien osalta saatavilla myös Suomeen tulleet opiskelijat ja henkilöstö

Lisätiedot

S Sähkön jakelu ja markkinat S Electricity Distribution and Markets

S Sähkön jakelu ja markkinat S Electricity Distribution and Markets S-18.3153 Sähkön jakelu ja markkinat S-18.3154 Electricity Distribution and Markets Voltage Sag 1) Kolmivaiheinen vastukseton oikosulku tapahtuu 20 kv lähdöllä etäisyydellä 1 km, 3 km, 5 km, 8 km, 10 km

Lisätiedot

Innovation Platform Thinking Jukka P. Saarinen Mika M. Raunio Nadja Nordling Taina Ketola Anniina Heinikangas Petri Räsänen

Innovation Platform Thinking Jukka P. Saarinen Mika M. Raunio Nadja Nordling Taina Ketola Anniina Heinikangas Petri Räsänen Innovation Platform Thinking 17.6.2015 Jukka P. Saarinen Mika M. Raunio Nadja Nordling Taina Ketola Anniina Heinikangas Petri Räsänen Motivation for platform thinking... Normal project with different phases:

Lisätiedot

tgg agg Supplementary Figure S1.

tgg agg Supplementary Figure S1. ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt

Lisätiedot

Small Number Counts to 100. Story transcript: English and Blackfoot

Small Number Counts to 100. Story transcript: English and Blackfoot Small Number Counts to 100. Story transcript: English and Blackfoot Small Number is a 5 year-old boy who gets into a lot of mischief. He lives with his Grandma and Grandpa, who patiently put up with his

Lisätiedot

Sienet ovat boreaalisten metsien tärkeimpiä kuolleen

Sienet ovat boreaalisten metsien tärkeimpiä kuolleen Tiina Rajala, Mikko Peltoniemi, Lara Valentin-Carrera, Taina Pennanen ja Raisa Mäkipää Sienidiversiteetin merkitys puiden lahoamisprosessissa ja taimien kasvussa Lahopuu sienten elinympäristönä Sienet

Lisätiedot

Bounds on non-surjective cellular automata

Bounds on non-surjective cellular automata Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective

Lisätiedot

Operatioanalyysi 2011, Harjoitus 4, viikko 40

Operatioanalyysi 2011, Harjoitus 4, viikko 40 Operatioanalyysi 2011, Harjoitus 4, viikko 40 H4t1, Exercise 4.2. H4t2, Exercise 4.3. H4t3, Exercise 4.4. H4t4, Exercise 4.5. H4t5, Exercise 4.6. (Exercise 4.2.) 1 4.2. Solve the LP max z = x 1 + 2x 2

Lisätiedot

Time spent reading magazines NRS 2011

Time spent reading magazines NRS 2011 Time spent reading magazines NRS 2011 Time spent reading magazines Time spent reading magazines Researched in NRS Consumer 2011 survey through an internet questionnaire A customised form: only the magazines

Lisätiedot

Tupakkapoliittisten toimenpiteiden vaikutus. Satu Helakorpi Terveyden edistämisen ja kroonisten tautien ehkäisyn osasto Terveyden edistämisen yksikkö

Tupakkapoliittisten toimenpiteiden vaikutus. Satu Helakorpi Terveyden edistämisen ja kroonisten tautien ehkäisyn osasto Terveyden edistämisen yksikkö Tupakkapoliittisten toimenpiteiden vaikutus Satu Helakorpi Terveyden edistämisen ja kroonisten tautien ehkäisyn osasto Terveyden edistämisen yksikkö Päivittäin tupakoivien osuus (%) 1978 2006 % 50 40 30

Lisätiedot

Älykkäät yhteydet satamatoimijoiden välillä. Älyliikenne 26.3.2013, Markku Koskinen

Älykkäät yhteydet satamatoimijoiden välillä. Älyliikenne 26.3.2013, Markku Koskinen Älykkäät yhteydet satamatoimijoiden välillä Älyliikenne 26.3.2013, Markku Koskinen Port Community System PUBLICATIONS FROM THE CENTRE FOR MARITIME STUDIES UNIVERSITY OF TURKU A 58 2012 E-PORT Improving

Lisätiedot

16. Allocation Models

16. Allocation Models 16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue

Lisätiedot

Curriculum. Gym card

Curriculum. Gym card A new school year Curriculum Fast Track Final Grading Gym card TET A new school year Work Ethic Detention Own work Organisation and independence Wilma TMU Support Services Well-Being CURRICULUM FAST TRACK

Lisätiedot

Satelliittikuvat osana öljypäästövalvontaa

Satelliittikuvat osana öljypäästövalvontaa Öljypäästövalvonta Euroopan meriturvallisuusviraston (EMSA) satelliittikuvilta Kati Tahvonen Suomen ympäristökeskus Kaukokartoituspäivät 2007 Helsinki, 8.11.2007 Satelliittikuvat osana öljypäästövalvontaa

Lisätiedot

HD 6/15 G Classic. Joustavaan, liikkuvaan käyttöön. Helppo liikuteltavuus. Säilytyspaikat pesuvarusteille. Kestävä ja helppo huoltaa

HD 6/15 G Classic. Joustavaan, liikkuvaan käyttöön. Helppo liikuteltavuus. Säilytyspaikat pesuvarusteille. Kestävä ja helppo huoltaa HD 6/15 G Classic Helposti liikuteltava, polttomoottorikäyttöinen painepesuri perustason ammattikäyttöön kohteissa, joissa verkkovirtaa ei ole saatavilla. 1 2 3 4 1 2 Joustavaan, liikkuvaan käyttöön Toimii

Lisätiedot

Land-Use Model for the Helsinki Metropolitan Area

Land-Use Model for the Helsinki Metropolitan Area Land-Use Model for the Helsinki Metropolitan Area Paavo Moilanen Introduction & Background Metropolitan Area Council asked 2005: What is good land use for the transport systems plan? At first a literature

Lisätiedot

The relationship between leisuretime physical activity and work stress with special reference to heart rate variability analyses

The relationship between leisuretime physical activity and work stress with special reference to heart rate variability analyses The relationship between leisuretime physical activity and work stress with special reference to heart rate variability analyses Teisala Tiina, TtM, tohtorikoulutettava Jyväskylän yliopisto Terveystieteiden

Lisätiedot

Alternative DEA Models

Alternative DEA Models Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex

Lisätiedot

TEST REPORT Nro VTT-S Air tightness and strength tests for Furanflex exhaust air ducts

TEST REPORT Nro VTT-S Air tightness and strength tests for Furanflex exhaust air ducts TEST REPORT Nro VTT-S-04515-08 19.5.008 Air tightness and strength tests for Furanflex exhaust air ducts Requested by: Hormex Oy TEST REPORT NRO VTT-S-04515-08 1 () Requested by Order Hormex Oy Linnanherrankuja

Lisätiedot

TT nostoyksikkö / lift unit

TT nostoyksikkö / lift unit TT nostoyksikkö / lift unit Nostoyksikön tuotenro Lift unit code 310206641 Nostoyksikkö/Lift unit TT22 153/ 55X1275 P70 310206643 Nostoyksikkö/Lift unit TT22 173/ 55X1523 P70 310206645 Nostoyksikkö/Lift

Lisätiedot

Opiskelijoiden ajatuksia koulun alkuun liittyen / students thoughts about the beginning of their studies at KSYK

Opiskelijoiden ajatuksia koulun alkuun liittyen / students thoughts about the beginning of their studies at KSYK Opiskelijoiden ajatuksia koulun alkuun liittyen / students thoughts about the beginning of their studies at KSYK Helppoa/mukavaa/palkitsevaa - easy/nice/rewarding - uudet ystävät/ new friends - koulun

Lisätiedot

PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING

PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING Veijalainen O, Kares S, Kujala P, Vuento R, TirKkonen M, Kholová I, Osuala V, Mäenpää J University and University Hospital of Tampere, Finland,

Lisätiedot

1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.

1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The

Lisätiedot

Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes)

Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes) SYLY- päivät 2014 Helsinki 28.11.2014 Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes) Diabeteslääkäri Mikko Honkasalo Nurmijärven terveyskeskus

Lisätiedot

OP1. PreDP StudyPlan

OP1. PreDP StudyPlan OP1 PreDP StudyPlan PreDP The preparatory year classes are in accordance with the Finnish national curriculum, with the distinction that most of the compulsory courses are taught in English to familiarize

Lisätiedot

Ohjelmien kehittämisstudiot varmistavat laadukkaat ja linjakkaat maisteriohjelmat Maire Syrjäkari ja Riikka Rissanen

Ohjelmien kehittämisstudiot varmistavat laadukkaat ja linjakkaat maisteriohjelmat Maire Syrjäkari ja Riikka Rissanen Ohjelmien kehittämisstudiot varmistavat laadukkaat ja linjakkaat maisteriohjelmat 18.8.2016 Maire Syrjäkari ja Riikka Rissanen Miksi ja miten studiot? Todellinen tarve: uudet maisteriohjelmat alkamassa

Lisätiedot

Salasanan vaihto uuteen / How to change password

Salasanan vaihto uuteen / How to change password Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change

Lisätiedot

Teknologiateollisuuden uudet tilaukset* vuosineljänneksittäin New orders of technology industries* by quarters

Teknologiateollisuuden uudet tilaukset* vuosineljänneksittäin New orders of technology industries* by quarters Teknologiateollisuuden uudet tilaukset* vuosineljänneksittäin New orders of technology industries* by quarters 75 7 65 6 55 5 45 4 35 3 25 2 15 1 5 Milj. euroa, nimellisin hinnoin / Mil. euros, in nominal

Lisätiedot

Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija

Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen

Lisätiedot

Ilmasto on jo muuttunut ja muutosnopeus kiihtyy

Ilmasto on jo muuttunut ja muutosnopeus kiihtyy Metsänkasvatusketjut puuntuotannon, hiilitaseen ja monimuotoisuuden näkökulmasta muuttuvassa ilmastossa Raisa Mäkipää 1, Tapio Linkosalo 1, Alexander Komarov 2, Vladimir Shanin 2, Markku Larjavaara 1,

Lisätiedot

Valuation of Asian Quanto- Basket Options

Valuation of Asian Quanto- Basket Options Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta

Lisätiedot

Miehistöjen työ- ja lepoajat

Miehistöjen työ- ja lepoajat Miehistöjen työ- ja lepoajat Taustainfo medialle 26.10.2012 ylijohtaja Pekka Henttu Vastuullinen liikenne. Yhteinen asia. (FTL) Media mukana Komission säädösprosessi EASA Loka-/2012 EASAn esitys komissiolle

Lisätiedot

Euromaat kehittyvät epäyhtenäisesti / Euro Countries Are Developing Unevenly

Euromaat kehittyvät epäyhtenäisesti / Euro Countries Are Developing Unevenly Euromaat kehittyvät epäyhtenäisesti / Euro Countries Are Developing Unevenly Teollisuuden ja palvelualojen ostopäällikköindeksi / Manufacturing and Services Sector Purchasing Magers Index 5 = ei muutosta

Lisätiedot

Efficient regeneration system and Agrobacteriummediated transformation of Vetiver. PT 1

Efficient regeneration system and Agrobacteriummediated transformation of Vetiver. PT   1 Efficient regeneration system and Agrobacteriummediated transformation of Vetiver PT www.acolor.net 1 Outline: Part I: Why (Background) Part II: Some concrete work we have done Part III: Prospects to further

Lisätiedot

HARJOITUS- PAKETTI A

HARJOITUS- PAKETTI A Logistiikka A35A00310 Tuotantotalouden perusteet HARJOITUS- PAKETTI A (6 pistettä) TUTA 19 Luento 3.Ennustaminen County General 1 piste The number of heart surgeries performed at County General Hospital

Lisätiedot

Pricing policy: The Finnish experience

Pricing policy: The Finnish experience Pricing policy: The Finnish experience Esa Österberg Senior Researcher Alcohol and Drug Research, STAKES, Helsinki, Finland esa.osterberg@stakes.fi Three pillars of traditional Nordic alcohol control Strict

Lisätiedot

MEETING PEOPLE COMMUNICATIVE QUESTIONS

MEETING PEOPLE COMMUNICATIVE QUESTIONS Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.

Lisätiedot

Metsät ja ilmastonmuutoksen hillintä

Metsät ja ilmastonmuutoksen hillintä Metsät ja ilmastonmuutoksen hillintä Jari Liski Suomen ympäristökeskus Metsät, metsien käyttö ja ilmastomuutos - seminaari, 21.1.2016 @jariliski Fate of Anthropogenic CO 2 Emissions (2004-2013 average)

Lisätiedot

Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa?

Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa? Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa? Kerro meille datastasi työpaja 10.4.2013 Antti Auer Tietohallintopäällikkö Jyväskylän yliopisto Strateginen kehittäminen Johtamista, tutkimushallintoa

Lisätiedot

Data quality points. ICAR, Berlin,

Data quality points. ICAR, Berlin, Data quality points an immediate and motivating supervision tool ICAR, Berlin, 22.5.2014 Association of ProAgria Centres Development project of Milk Recording Project manager, Heli Wahlroos heli.wahlroos@proagria.fi

Lisätiedot

BOARD PROGRAM Hallitusohjelma

BOARD PROGRAM Hallitusohjelma BOARD PROGRAM Hallitusohjelma Henrikki Soininen AYYH VPJ PROJEKTIT PROJECTS 1.2 Tilaohjelma opiskelijakeskukselle/student center 3.3 Tutoroinnin arvostus/valuation of tutoring 5.1 Kuntavaalitavoitteet/Municipal

Lisätiedot

Läpimurto ms-taudin hoidossa?

Läpimurto ms-taudin hoidossa? Läpimurto ms-taudin hoidossa? Läpimurto ms-taudin hoidossa? Kansainvälisen tutkijaryhmän kliiniset kokeet uudella lääkkeellä antoivat lupaavia tuloksia sekä aaltoilevan- että ensisijaisesti etenevän ms-taudin

Lisätiedot

Asiakaspalautteen merkitys laboratoriovirheiden paljastamisessa. Taustaa

Asiakaspalautteen merkitys laboratoriovirheiden paljastamisessa. Taustaa Asiakaspalautteen merkitys laboratoriovirheiden paljastamisessa Paula Oja, TtT Laboratorio, Oulun yliopistollinen sairaala Potilasturvallisuustutkimuksen päivät 26. 27.1.2011 1 Taustaa Laboratorion tulee

Lisätiedot

Exiting academics in networked knowledge societies, EANKS. Metodifestivaali Projektitutkija Taru Siekkinen, KTL JYU

Exiting academics in networked knowledge societies, EANKS. Metodifestivaali Projektitutkija Taru Siekkinen, KTL JYU Exiting academics in networked knowledge societies, EANKS Metodifestivaali 31.5.2017 Projektitutkija Taru Siekkinen, KTL JYU EANKS Hanke sai Suomen Akatemian rahoituksen keväällä 2016, hanke alkoi 1.9.2016

Lisätiedot

FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting

FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists

Lisätiedot

Pelletizing trials Autum 2008

Pelletizing trials Autum 2008 Pelletizing trials Autum 2008 Simo Paukkunen NKUAS simo.paukkunen@pkamk.fi Raw material Basic information Logging residues from spruce (Picea abies [L.] Karst.) dominant final cuttings, harvested in spring

Lisätiedot

Lähde / Source: Macrobond

Lähde / Source: Macrobond Teollisuustuotanto Yhdysvalloissa kasvanut vahvasti, Suomessa tuotanto jäänyt matalalle tasolle Strong Growth in US Industrial Production, Finnish Production Volumes Remain Low Lähde / Source: Macrobond

Lisätiedot

ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel. Kalle Lehto, Aalto-yliopisto 5.5.

ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel. Kalle Lehto, Aalto-yliopisto 5.5. ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel Kalle Lehto, Aalto-yliopisto 5.5.2011 Otaniemi ReFuel a three year research project (2009-2011) goal utilize the

Lisätiedot

Yhtiön nimi: - Luotu: - Puhelin: - Fax: - Päiväys: -

Yhtiön nimi: - Luotu: - Puhelin: - Fax: - Päiväys: - Positio Laske Kuvaus 1 MAGNA 32-1 N Tuote No.: 98117 Huom.! Tuotteen kuva voi poiketa todellisesta tuotteesta The pump is of the canned rotor type, i.e. pump and motor form an integral unit without shaft

Lisätiedot

RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla

RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua

Lisätiedot

VALERIE CASE STUDY TRIAL - REPORT

VALERIE CASE STUDY TRIAL - REPORT 1 VALERIE CASE STUDY TRIAL - REPORT THE USE OF WOOD ASH FERTILIZATION ON MINERAL SOIL FORESTS Photos from the trial excursion on 19 th May 2017. Fig. 1 The stakeholders got to know the forest renewal area

Lisätiedot

Integrating full climate change impacts balances and management

Integrating full climate change impacts balances and management Integrating full climate change impacts balances and management Frank Berninger and the Henvi Forest team. 1 The Matryoshka analogy is carbon balance a matter of scale 2 The Full picture 3 I am a little

Lisätiedot

La a d u l l in en in d ik a a t t o r i

La a d u l l in en in d ik a a t t o r i La a d u l l in en in d ik a a t t o r i Ei o l e mit a t t a v issa v a a n a in a a r v io in n in t u l o s O n l u o t et t a v a jos A r v io in t ik ysymyk set o n su u n n it el t u ja su u n n

Lisätiedot

Sähköjärjestelmän käyttövarmuus & teknologia Käyttövarmuuspäivä 25.11.2014

Sähköjärjestelmän käyttövarmuus & teknologia Käyttövarmuuspäivä 25.11.2014 Sähköjärjestelmän käyttövarmuus & teknologia Käyttövarmuuspäivä 25.11.2014 Jarmo Partanen, professori, Lappeenrannan yliopisto jarmo.partanen@lut.fi +358 40 5066 564 Electricity Market, targets Competitive

Lisätiedot

Export Demand for Technology Industry in Finland Will Grow by 2.0% in 2016 GDP growth 2016/2015, %

Export Demand for Technology Industry in Finland Will Grow by 2.0% in 2016 GDP growth 2016/2015, % Russia Rest of Eastern Europe Brazil America Middle East and Africa Export Demand for Technology Industry in Finland Will Grow by 2.% in 216 GDP growth 216/215, % 9 8 7 6 5 4 3 2 1-1 -2-3 -4 Average growth:

Lisätiedot

2017/S Contract notice. Supplies

2017/S Contract notice. Supplies Supplies 153936 2017 25/04/2017 S80 - - Supplies - Contract notice - Open procedure I. II. III. IV. VI. -: Medical equipments, pharmaceuticals and personal care products 2017/S 080-153936 Contract notice

Lisätiedot

Johdanto LoM-tarkasteluihin

Johdanto LoM-tarkasteluihin Johdanto LoM-tarkasteluihin Lauri Kumpulainen Vaasan yliopisto 19.9.2017 LoM-tutkimuskysymyksiä (tutkimussuunnitelmassa) Mitä LoM-menetelmiä on yleisesti käytössä ja mikä on niiden suorituskyky? Miten

Lisätiedot

Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland

Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research

Lisätiedot

FP3: Research task of UTA

FP3: Research task of UTA FP3: Research task of UTA Task 1.5.1 Acceptability The objective is to study arguments regarding bio-ccs in the Finnish print media. Research questions: How bio-ccs is perceived by different actors? Which

Lisätiedot

Calisto USB-kaiutinpuhelin. Käyttöopas

Calisto USB-kaiutinpuhelin. Käyttöopas Calisto 7200 USB-kaiutinpuhelin Käyttöopas Sisällysluettelo Yleiskatsaus 3 Connect to PC 4 Päivittäinen käyttö 5 Power 5 Äänenvoimakkuus 5 Mykistys / mykistyksen poisto 5 Puheluun vastaaminen tai puhelun

Lisätiedot