Efficient regeneration system and Agrobacteriummediated transformation of Vetiver. PT 1
|
|
- Pirkko Järvinen
- 6 vuotta sitten
- Katselukertoja:
Transkriptio
1 Efficient regeneration system and Agrobacteriummediated transformation of Vetiver PT 1
2 Outline: Part I: Why (Background) Part II: Some concrete work we have done Part III: Prospects to further this research PT 2
3 Part I Research Background PT 3
4 PT 4
5 PT 5
6 Water and soil erosion The quantity of soil and water erosion in china is above 8 billion tons annually. (Peng Keshan,2004) PT 6
7 Desertification Water contamination Deforestation PT 7
8 PT 8
9 Magical Plant -- Vetiver PT 9
10 Slope protection and stabilization PT 10
11 Pollution rehabilitation PT 11
12 Poor tolerance to low temperature PT 12
13 Application distributing map of vetiver in China Beijing PT 13
14 Research objective To enhance cold tolerance, a coldresistant gene is introduced into vetiver cells using molecular technology of gene transformation, and as a result, make this excellent grass play a more positive role in environment restoration in North China and other parts of the world. PT 14
15 Establishment of regeneration system Establishment of transformation system Construction of plant expression vector Agrobacterium-mediated transformation Molecular analysis cold stress tolerance assays PT 15
16 Trehalose-6-phosphate synthase gene otsa gene PT 16
17 lamb Outer membrane 2x glucose TreA trehalose EIICB Glc EIICB Tre Inner membrane EIIA Glc EIIA Glc OtsA OtsB Glucose-6-phosphate Trehalose-6-phosphate trehalose + UDP-glucose Ots A TreC Glucose + glucose-6-phosphate Glk glucose-6-phosphate glycolysis Metabolic Pathway of trehalose in E.Coli (Crowe et al., 1990; Strom et al., 1993) PT 17
18 Trehalose Protectant of protein and membrane Osmoprotectant ---Crowe et al., 1990; Strom et al., PT 18
19 otsa gene Tobacco Potato ---Goddijn et al., 1997; Yeo et al., 2000; Wang et al., 2003 Sugarcane PT 19
20 bp A PCR amplification and restriction analysis of otsa gene 100 bp ladder: 5,000, 3,000, 2,000, 1,500, 1,000, 900, 800, 700, 600, 500, 400, 300, 200, 100 PT 20
21 Part II What concrete work have we done? 2.1 Establishment of an efficient regeneration system of vetiver PT 21
22 B PT 22
23 Induction medium: MS mg /L 2,4-D mg /L KT Differentiation medium : MS mg/ L 6BA Rooting medium: ½ MS + 0.1mg/L IBA mg/ L PP333 PT 23
24 Development process of a somatic embryo of Vetiver PT 24
25 2.2 Establishment of genetic transformation system for vetiver grass PT 25
26 Con. of Agr.tumefaciens OD Con. of acetosyringone (AS) 200 µm Co-cultivation temperature Duration of co-cultivation 3-4 d PT 26
27 2.3 Construction of plant expression vector p1301un-otsa PT 27
28 ots A Ap pwy 4200bp Sal 1 otsa PT 28
29 ots A PT 29
30 Construction of plant expression vector p1301un-otsa otsa pwy1 -otsa 4200bp SmaI/SacI Sac I PT 30
31 PCR amplification Restriction digestion Ligation Transformation PT 31
32 ,517 bp a b c 1500 bp a b c (a) PCR amplification and restriction analysis of otsa gene (b) Restriction analysis of plasmid p1301un (c) Restriction analysis of recombinant plasmid p1301un-otsa PT 32
33 UBI tttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgtta cttctgcaggtcgactctagaggatccccgggccggtaccatgaggatcagccgctaaaaaaggtgaaa aaaggtaacattacgtgggcctcttttaacctcagcgaacaggaccttgacgaatactacaaccaattctc caatgccgttctctggcccgcttttcattatcggctcgatctggtgcaatttcagcgtcctgcctgggacggct atctacgcgtaaatgcgttgctggcagataaattactgccgctgttgcaagacgatgacattatctggatcc acgattatcacctgtt(c)gccatttgcgcatgaattacgcaaacggggagtgaataatcgcattggtttctt tctgcatattcctttcccgacaccggaaatcttcaacgcgctgccgacatatgacaccttgcttgaacagctt tgtgattatgatttgctgggtttccagacagaaaacgatcgtctggcgttcctggattgtctttctaacctgac ccgcgtcacgacacgtagcgcaaaaagccatacagcctggggcaaagcatttcgaacagaagtctaccc gatcggcattgaaccgaaagaaatagccaaacaggctgccgggccactgccgccaaaactggcgcaac ttaaagcggaactgaaaaacgtacaaaatatcttttctgtcgaacggctggattattccaaaggtttgcca gagcgttttctcgcctatgaagcgttgctggaaaaatatccgcagcatcatggtaaaattcgttatacccag attgcaccaacgtcgcgtggtgatgtgcaagcctatcaggatattcgtcatcagctcgaaaatgaagctgg acgaattaatggtaaatacgggcaattaggctggacgccgctttattatttgaatcagcattttgaccgtaa attactgatgaaaatattccgctactctgacgtgggcttagtgacgccactgcgtgacgggatgaacctgg tagcaaaagagtatgttgctgctcaggacccagccaatccgggcgttcttgttctttcgcaatttgcgggag cggcaaacgagttaacgtcggcgttaattgttaacccctacgatcgtgacgaagttgcagctgcgctggat cgtgcattgactatgtcgctggcggaacgtatttcccgtcatgcagaaatgctggacgttatcgtgaaaaa cgatattaaccactggcaggagtgcttcattagcgacctaaagcagatagttccgcgaagcgcggaaag ccagcagcgcgataaagttgctacctttccaaagcttgcgtaggagctcgaatttccccgatcgttcaaac atttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaat tacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcc cgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgc ggtgtcatctatgttactagatcgggaattc OTSA NOS DNA sequence analysis of p1301un-otsa (Ubi-otsA-Nos) PT 33
34 Plant expression vector p1301un-otsa PT 34
35 2.4 Genetic transformation mediated by EHA105/p1301UN-otsA PT 35
36 Co-cultivation Resistance selection Molecular analysis Cold stress tolerance assays PT 36
37 GUS assay Calli co-cultivation after 3 days A PT 37
38 hyg B resistant calli B Calli selection after 4 weeks PT 38
39 PT 39
40 Hyg B resistant buds A: Resistant buds cultivation after 4 weeks B: Control PT 40
41 Hyg B resistant plantlets Resistant plantlets after 2 months PT 41
42 Part III Further research plan Southern analysis of the putative transformants Cold tolerance analysis of transgenic plants PT 42
43 Research goal To screen a new cultivar of vetiver with cold tolerance or other resistance ability by gene engineering, and make this excellent grass playing more effective role in environment restoration and protection in the world. PT 43
44 My dream PT 44
45 A new beginning PT 45
46 Acknowledgments This research was supported by the Natural Science Foundation of China and the Wallace Genetic Foundation through the Vetiver Network. This paper was conferred the Innovation Prize by the Vetiver Network, so we wish to thank the Vetiver Network for encouragement to us. Mr. Frank Mason from Australia provided me with parts of expenses for attending the conference, thereby I would like to express my heartfelt thanks for his generosity and kindness. PT 46
47
48 PT 48
Supporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
ProAgria. Opportunities For Success
ProAgria Opportunities For Success Association of ProAgria Centres and ProAgria Centres 11 regional Finnish ProAgria Centres offer their members Leadership-, planning-, monitoring-, development- and consulting
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
Rikasta Pohjoista 2019 Uudistuva teollisuus Teollisten innovaatioiden tulevaisuus
Rikasta Pohjoista 2019 Uudistuva teollisuus Teollisten innovaatioiden tulevaisuus Harri Haapasalo Tuotantotalouden professori Tuotannollisen yrityksen johtaminen, tuotekehitys ja innovaatiotoiminta harri.haapasalo@oulu.fi
Technische Daten Technical data Tekniset tiedot Hawker perfect plus
Technische Daten Technical data Tekniset tiedot Hawker perfect plus PzS-Zellen Hawker perfect plus, mit Schraubverbindern, Abmessungen gemäß DIN/EN 60254-2 und IEC 254-2 Serie L PzS-cells Hawker perfect
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? 10.10.01 Tuomo Suortti Ohjelman päällikkö Riina Antikainen Ohjelman koordinaattori 10/11/01 Tilaisuuden teema Kansainvälistymiseen
Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds
PhD Anne Hemmi 14.2.2013 RRR 2013 Conference in Greifswald, Germany Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds Eutrophication in surface waters High nutrient
Building Information Model (BIM) promoting safety in the construction site process. SafetyBIM research project 10/2007 2/2009. (TurvaBIM in Finnish)
Building Information Model (BIM) promoting safety in the construction site process research project 10/2007 2/2009 (TurvaBIM in Finnish) Building Information Model (BIM) promoting safety in the construction
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
Matchsaver on jalkapallokentän peitejärjestelmiin erikoistunut yritys ja sijaitsee Englannissa North Yorkshiren maakunnassa.!
Matchsaver on jalkapallokentän peitejärjestelmiin erikoistunut yritys ja sijaitsee Englannissa North Yorkshiren maakunnassa. Matchsaver kentänpeite on työkalu jolla säästetään niin kentän ylläpito- ja
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
SUORITUSTASOILMOITUS
SUORITUSTASOILMOITUS DOP10/NG081 Yksilöllinen tuotetunniste GEO PP 1NG/08 Suodatinkangas N1 Käyttötarkoitukset: EN 13249:2000+A1:2005 : Toiminnalliset vaatimukset teiden ja muiden liikennöityjen alueiden
Supporting information
Supporting information Figure S1. Carotenoid biosynthesis pathway in papaya fruit which is adopted from Blas et al. (2010) (reference 4) and Nisar et al. (2015) (reference 5). Carotenoids are synthesized
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
Stormwater filtration unit
Stormwater filtration unit Background, concept and applied design work Olli Hakala 2018 WSP Finland Aalto university Kyttä ym. 2014. Veden äärellä kysely, ENTJUSTESS-hanke. Aalto yliopisto. STORMWATER
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
FROM VISION TO CRITERIA: PLANNING SUSTAINABLE TOURISM DESTINATIONS Case Ylläs Lapland
FROM VISION TO CRITERIA: PLANNING SUSTAINABLE TOURISM DESTINATIONS Case Ylläs Lapland Tiina Merikoski, Landscape Architect (M.Sc) Aalto University School of Science and Technology Department of Architecture
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
Tekes the Finnish Funding Agency for Technology and Innovation. Copyright Tekes
Tekes the Finnish Funding Agency for Technology and Innovation DM 607668 03-2011 Expertise and networks for innovations Tekes services Funding for innovative R&D and business Networking Finnish and global
Indoor Environment 2011-2015
Indoor Environment 2011-2015 18.4.2013 Risto Kosonen Ohjelma on investointinäkökulmasta edennyt pääosin suunnitelman mukaisesti Työpaketti Kumulatiiviset kustannukset 1.5.2011 31.8.2012 Kumulatiiviset
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
Lapin Rovaniemen moduuli 2 verkko-opiskelijoiden kysymyksiä tetoimiston virkailijoiden tapaamiseen AC-huoneessa:
Lapin Rovaniemen moduuli 2 verkko-opiskelijoiden kysymyksiä tetoimiston virkailijoiden tapaamiseen AC-huoneessa: Koulutukseen ja Te-toimiston rooliin liittyviä kysymykset: 1. Olen yli 30-vuotias mutta
Research plan for masters thesis in forest sciences. The PELLETime 2009 Symposium Mervi Juntunen
Modelling tree and stand characteristics and estimating biomass removals and harvesting costs of lodgepole pine (Pinus contorta) plantations in Iceland Research plan for masters thesis in forest sciences
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
Ostamisen muutos muutti myynnin. Technopolis Business Breakfast 21.8.2014
Ostamisen muutos muutti myynnin Technopolis Business Breakfast 21.8.2014 Taking Sales to a Higher Level Mercuri International on maailman suurin myynnin konsultointiyritys. Autamme asiakkaitamme parantamaan
Exercise 1. (session: )
EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You
Katri Vala heating and cooling plant - Eco-efficient production of district heating and cooling
Katri Vala heating and cooling plant - Eco-efficient production of district heating and cooling Marko Riipinen Helsingin Energia Aalto University District heating excursion 14.11.2012 Location of Katri
Data quality points. ICAR, Berlin,
Data quality points an immediate and motivating supervision tool ICAR, Berlin, 22.5.2014 Association of ProAgria Centres Development project of Milk Recording Project manager, Heli Wahlroos heli.wahlroos@proagria.fi
Functional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä
Arkkitehtuuritietoisku eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Esikysymys Kuinka moni aikoo suunnitella projektityönsä arkkitehtuurin? Onko tämä arkkitehtuuria?
Strain or plasmid Description a Reference or source b. 168 trpc2 Laboratory. 1A780 trpc2 sigb::spc BGSC
TABLE S1 Bacterial strains and plasmids Strain or plasmid Description a Reference or source b B. subtilis 168 trpc2 Laboratory stock 1A780 trpc2 sigb::spc BGSC BM1010 trpc2 htpx::pgs1582; Em r BM1302 trpc2
Flexbright Oy Embedded software/hardware engineer
Flexbright Oy Embedded software/hardware engineer Half or full time employees Thesis/ summer workers Location Haukipudas - LED matrix display and sensor system architectural design, component selection,
ENE-C2001 Käytännön energiatekniikkaa. Aloitustapaaminen 11.4.2016. Osa II: Projekti- ja tiimityö
ENE-C2001 Käytännön energiatekniikkaa Aloitustapaaminen 11.4.2016 Osa II: Projekti- ja tiimityö Sisältö Projektityö Mitä on projektityö? Projektityön tekeminen: ositus, aikatauluhallinta, päätöksenteon
TietoEnator Pilot. Ari Hirvonen. TietoEnator Oyj. Senior Consultant, Ph. D. (Economics) presentation TietoEnator 2003 Page 1
TietoEnator Pilot Ari Hirvonen Senior Consultant, Ph. D. (Economics) TietoEnator Oyj presentation TietoEnator 2003 Page 1 Sallikaa minun kysyä, mitä tietä minun tulee kulkea? kysyi Liisa. Se riippuu suureksi
THE NEW SHELTER PROJECT. PRO ANIMALS ROMANIA & PRO ANIMALS FINLAND The project continues as soon as funds are collected to do so
The new shelter area of Pro Animals Romania in April 2011 Pro Animals Romanian uuden tarhan aluetta huhtikuussa 2011 THE NEW SHELTER PROJECT PRO ANIMALS ROMANIA & PRO ANIMALS FINLAND 2011-2012 The project
TÄUBLER OY. Vuorimiehenkatu Helsinki Finland. Puh: Fax:
TÄUBLER OY Vuorimiehenkatu 21 00140 Helsinki Finland Puh: 09-175 491 Fax: 09-175 735 TÄUBLER OY Perustettu vuonna 1990 Itsenäinen suomalainen yritys Myy ja markkinoi edustamiaan tuotteita; SIEMENS H+H
Improving advisory services through technology. Challenges for agricultural advisory after 2020 Jussi Juhola Warsaw,
Improving advisory services through technology Challenges for agricultural advisory after 2020 Jussi Juhola Warsaw, 22.2.2018 ProAgria in a nutshell Provides farm-and-agriculture entrepreneurs with services
Expression of interest
Expression of interest Avoin hakemus tohtorikoulutettavaksi käytäntö Miksi? Dear Ms. Terhi virkki-hatakka I am writing to introduce myself as a volunteer who have the eagerness to study in your university.
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä. public-procurement
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä https://ec.europa.eu/futurium/en/ public-procurement Julkiset hankinnat liittyvät moneen Konsortio Lähtökohdat ja tavoitteet Every
BRUTTO PINTA- ALA (M 2 ) KEHYKSEN MATERIAAL I. EA-HP-1500/47-18 Super heat ALUMIINI 1,98 108 0,172 506 1320*1680*110 59
TYHJIÖPUTKIKERÄIMET 1. EA-HP HEAT PIPE TYHJIÖPUTKIKERÄIMEN HINTA JA TEKNISET TIEDOT KUVA MALLI KERÄIN MENETELMÄ KEHYKSEN MATERIAAL I BRUTTO PINTA- ALA (M 2 ) MAX. LÄMMITETT ÄVÄ VESIMÄÄRÄ / KERÄIME N TILAVUU
Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)
Tilasto T1106120-s2012palaute Kyselyn T1106120+T1106120-s2012palaute yhteenveto: vastauksia (4) Kysymys 1 Degree programme: (4) TIK: TIK 1 25% ************** INF: INF 0 0% EST: EST 0 0% TLT: TLT 0 0% BIO:
Älykäs erikoistuminen. Kristiina Heiniemi-Pulkkinen
Älykäs erikoistuminen Kristiina Heiniemi-Pulkkinen 9.6.2015 Miksi? Perimmäisenä ajatuksena on EU rahoituksesta saatavan hyödyn kasvattaminen; kullakin alueella on omat vahvuutensa ja päällekkäisen työn
Diaari Luokka AP RP 3 CB41 HealthAccess / Access to Distant Markets in Health and Wellness Nähtävänäolo Tallinn Science Park Tehnopol
1 Head of Managing Authority Merike Niitepõld Päätöspvm 25.08.2017 150 / 2017 AP RP 3 CB41 HealthAccess / Access to Distant Markets in Health and Wellness Nähtävänäolo 28.8.2017 Tallinn Science Park Tehnopol
BIOENV Laitoskokous Departmental Meeting
BIOENV Laitoskokous Departmental Meeting 4.4.2014 Asialista/Agenda Uudet tohtoriohjelman ohjeet Laitoksen pelastussuunnitelma Tiloihin liittyviä asioita Kehityskeskustelut keväällä 2014 koko henkilökunnan
Computer based team play analysis in ice hockey coaching - an objective way to have feedback. Jouko Lukkarila
Computer based team play analysis in ice hockey coaching - an objective way to have feedback Jouko Lukkarila TEAM PLAY ANALYSIS Background of the software development Principles of Collecting Data Reading
BDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET.
BDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET. Pekka Ollikainen Open Source Microsoft CodePlex bio Verkkosivustovastaava Suomen Sarjakuvaseura
MUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
23.5.2012 1 Rakentamisen näkymät EU-alueella ja Suomessa
23.5.2012 1 Rakentamisen näkymät EU-alueella ja Suomessa Pekka Pajakkala Senior Advisor, VTT President of EUROCONSTRUCT 2012 23.5.2012 2 Rakentamisen näkymät EU, CEE, SUOMI 1. VTT 2. TALOUDEN JA RAKENTAMISEN
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
Huleveden pitoisuuksien ajallinen ja alueellinen vaihtelu Maija Taka University of Helsinki 1
Huleveden pitoisuuksien ajallinen ja alueellinen vaihtelu 8.12.2014 Maija Taka University of Helsinki 1 Pienvesitutkimus pääkaupunkiseudulla 1. Alueellisesti kattava aineisto 2. Aikasarjatutkimus 3. Muu
Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE
Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE November 7, 2014 Paula Kilpinen 1 7.11.2014 Aalto University
ICES: 110 vuotta tiedettä ja merentutkimusta: Mitä ja miksi? Dr. Kai Myrberg ICES Delegaatti Helsinki 18.03.2014
ICES: 110 vuotta tiedettä ja merentutkimusta: Mitä ja miksi? Dr. Kai Myrberg ICES Delegaatti Helsinki 18.03.2014 Mikä ihmeen ICES? Mikä on ICES? (International Council for the Exploration of the Sea) (Kansainvälinen
Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa. Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio
Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio Päättääkö opettaja ohjelmasta? Vai voisivatko opiskelijat itse suunnitella
Windows Phone. Module Descriptions. Opiframe Oy puh. +358 44 7220800 eero.huusko@opiframe.com. 02600 Espoo
Windows Phone Module Descriptions Mikä on RekryKoulutus? Harvassa ovat ne työnantajat, jotka löytävät juuri heidän alansa hallitsevat ammatti-ihmiset valmiina. Fiksuinta on tunnustaa tosiasiat ja hankkia
Helsinki Region Infoshare 2013
Helsinki Region Infoshare 2013 Apps4Finland 2012 Ville Meloni & Petri Kola Forum Virium Helsinki 1 Suomalainen tietoyhteiskunta 2012? Tietoyhteiskunnan kehittäminen Kansalaiset vaativat avoimuutta Rohkeita
Helsinki Metropolitan Area Council
Helsinki Metropolitan Area Council Current events at YTV The future of YTV and HKL On the initiative of 4 city mayors the Helsinki region negotiation consortiums coordinating group have presented that:
Reliable sensors for industrial internet
Reliable sensors for industrial internet 21.5.2015 Anu Kärkkäinen, PhD Research Team Leader VTT Technical Research Centre of Finland anu.karkkainen@vtt.fi Click to edit Master Contents title style Click
Computer based team play analysis in ice hockey coaching - an objective way to have feedback. Jouko Lukkarila
Computer based team play analysis in ice hockey coaching - an objective way to have feedback Jouko Lukkarila TEAM PLAY ANALYSIS Background of the software development Principles of Collecting Data Reading
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
Export Demand for Technology Industry in Finland Will Grow by 2.0% in 2016 GDP growth 2016/2015, %
Russia Rest of Eastern Europe Brazil America Middle East and Africa Export Demand for Technology Industry in Finland Will Grow by 2.% in 216 GDP growth 216/215, % 9 8 7 6 5 4 3 2 1-1 -2-3 -4 Average growth:
Poistuvat kurssit ja korvaavuudet (RRT ja YYT)
Poistuvat kurssit ja korvaavuudet 2016-2017 (RRT ja YYT) Rakenne- ja rakennustuotantotekniikka Rak-43.3001 Rakennuksen rungon suunnittelu I CIV-E1030 Fundamentals of Structural Design Rak-43.3111 Prestressed
Skene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene
Skene Muokkaa perustyyl. Games Refueled napsautt. @Games for Health, Kuopio Muokkaa alaotsikon perustyyliä napsautt. 2013 kari.korhonen@tekes.fi www.tekes.fi/skene 10.9.201 3 Muokkaa Skene boosts perustyyl.
Pricing policy: The Finnish experience
Pricing policy: The Finnish experience Esa Österberg Senior Researcher Alcohol and Drug Research, STAKES, Helsinki, Finland esa.osterberg@stakes.fi Three pillars of traditional Nordic alcohol control Strict
Kansainväliset verkostot ja säätiöt varainhankinnan kehittämisessä
Kansainväliset verkostot ja säätiöt varainhankinnan kehittämisessä 27.4.2018 Pia Tornikoski, www.vala.fi VaLa on Suomen kolmannen sektorin yhteistyöverkosto, jonka tavoitteena on, että:! yleishyödylliset
Co-Design Yhteissuunnittelu
Co-Design Yhteissuunnittelu Tuuli Mattelmäki DA, associate professor Aalto University School of Arts, Design and Architecture School of Arts, Design and Architecture design with and for people Codesign
Table S2. S. thermophilus CRISPR spacer sequence analysis.
Table S2. S. thermophilus CRISPR analysis. 001_1_01 TGTTTGACAGCAAATCAAGATTCGAATTGT 30 AF115103 Streptococcus thermophilus bacteriophage Sfi21, compl 40 93 28 2 0 3 30 38304 38331 1 001_1_02 AATGACGAGGAGCTATTGGCACAACTTACA
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
Harjavallan sulaton raskasmetallipäästöt
Mg vuodessa 25 2 15 Harjavallan sulaton raskasmetallipäästöt Cu Ni Zn Pb 1 5 1985 1988 1991 1994 1997 2 23 Outokumpu Oy Keskimääräinen vuosilaskeuma Harjavallan tutkimusgradientilla vuosina 1992-1998 7
Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi
Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi Green Cities and Settlements 18.2.2014 Ville Manninen Writers Project group Sirpa Korhonen, Anna Mari
momo Car-Sharing sharing smart solutions for urban transport
more options for energy efficient mobility through Car-Sharing momo Car-Sharing sharing smart solutions for urban transport Michael Glotz-Richter, Senior Project Manager Sustainable Mobility, Free Hanseatic
ATLAS-kartan esittely - Peli palveluiden yhteiskehittämisen menetelmistä Päivi Pöyry-Lassila, Aalto-yliopisto
ATLAS-kartan esittely - Peli palveluiden yhteiskehittämisen menetelmistä Päivi Pöyry-Lassila, Aalto-yliopisto Serve Research Brunch 24.10.2013 Esityksen sisältö ATLAS-hanke lyhyesti ATLAS-kartan kehittäminen:
JA CHALLENGE 18.-19.4.2013. Anna-Mari Sopenlehto Central Administration The City Development Group Business Developement and Competence
JA CHALLENGE 18.-19.4.2013 Anna-Mari Sopenlehto Central Administration The City Development Group Business Developement and Competence 12.11.2014 Challenges of the City of Turku What kind of city you would
Basic Flute Technique
Herbert Lindholm Basic Flute Technique Peruskuviot huilulle op. 26 Helin & Sons, Helsinki Basic Flute Technique Foreword This book has the same goal as a teacher should have; to make himself unnecessary.
ESITTELY. Valitse oppilas jonka haluaisit esitellä luokallesi ja täytä alla oleva kysely. Age Grade Getting to school. School day.
ESITTELY Valitse oppilas jonka haluaisit esitellä luokallesi ja täytä alla oleva kysely NOTES ON McMath student s name Age Grade Getting to school School day Favorite subjects Least favorite subjects Electives
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Hankkeiden vaikuttavuus: Työkaluja hankesuunnittelun tueksi
Ideasta projektiksi - kumppanuushankkeen suunnittelun lähtökohdat Hankkeiden vaikuttavuus: Työkaluja hankesuunnittelun tueksi Erasmus+ -ohjelman hakuneuvonta ammatillisen koulutuksen kumppanuushanketta
SFS/SR315 Tekoäly Tekoälyn standardisointi
SFS/SR315 Tekoäly Tekoälyn standardisointi Meri Seistola Toiminnanjohtaja, Mediakasvatuskeskus Metka ry SR 315 Tekoäly - Puheenjohtaja: Jarkko Vesa 1 SC42 Artificial Intelligence ISO/IEC JTC1 SC42 Artificial
Kansainvälisiä tutkimus- ja kehitysprojekteja ekotehokkaan rakennetun ympäristön tuottamiseen, käyttöön ja ylläpitoon
Kansainvälisiä tutkimus- ja kehitysprojekteja ekotehokkaan rakennetun ympäristön tuottamiseen, käyttöön ja ylläpitoon ICT & ympäristönäkökulma rakennus- ja kiinteistöklusteri Pekka Huovila VTT Rakennus-
SUOJAVYÖHYKEILMANVAIHTO ESTÄMÄÄN EPÄPUHTAUKSIEN LEVIÄMISTÄ SISÄTILOISSA
SUOJAVYÖHYKEILMANVAIHTO ESTÄMÄÄN EPÄPUHTAUKSIEN LEVIÄMISTÄ SISÄTILOISSA Guangyu Cao 1, Jorma Heikkinen 2, Simo Kilpeläinen 3, Kai Sirén 3 1 Department of Energy and Process Engineering, Norwegian University
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
Miehittämätön meriliikenne
Rolls-Royce & Unmanned Shipping Ecosystem Miehittämätön meriliikenne Digimurros 2020+ 17.11. 2016 September 2016 2016 Rolls-Royce plc The 2016 information Rolls-Royce in this plc document is the property
Transport and Infrastructure what about the future? Professor Jorma Mäntynen Tampere University of Technology
Transport and Infrastructure what about the future? Professor Jorma Mäntynen Tampere University of Technology 1 Finland as a part of the World Kuva: NASA Globalisation and the structural change of trade
ISEB/ISTQB FOUNDATION CERTIFICATE IN SOFTWARE TESTING III
KOULUTUSTIEDOTE 1(5) ISEB/ISTQB FOUNDATION CERTIFICATE IN SOFTWARE TESTING III Kuvaus ja tavoite ISEB/ISTQB Foundation Certificate in Software Testing -sertifikaattiin valmentava koulutus (2,5 pv) ja sertifikaattikoe
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
VUOSI 2015 / YEAR 2015
VUOSI 2015 / YEAR 2015 Kansainvälisen opetuksen ja tutkimustoiminnan kehittäminen Developing international teaching and research activities Rehtorin strateginen rahoitus vuosille 2014-2016 / Strategic
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
Informaatioteknologia vaikuttaa ihmisten käyttäytymiseen ja asenteisiin
Infotech Seminar, Oulu, November 11, 2005 Informaatioteknologia vaikuttaa ihmisten käyttäytymiseen ja asenteisiin Prof. Harri Oinas-Kukkonen Dept. Information Processing Science University of Oulu Outline
Julkaisun laji Opinnäytetyö. Sivumäärä 43
OPINNÄYTETYÖN KUVAILULEHTI Tekijä(t) SUKUNIMI, Etunimi ISOVIITA, Ilari LEHTONEN, Joni PELTOKANGAS, Johanna Työn nimi Julkaisun laji Opinnäytetyö Sivumäärä 43 Luottamuksellisuus ( ) saakka Päivämäärä 12.08.2010
Collaborative & Co-Creative Design in the Semogen -projects
1 Collaborative & Co-Creative Design in the Semogen -projects Pekka Ranta Project Manager -research group, Intelligent Information Systems Laboratory 2 Semogen -project Supporting design of a machine system
VALTION MAATALOUSKONEIDEN TUTKIMUSLAITOS. Test report
VAKOLA Rukkila 401 Helsinki 10 Helsinki 441 61 Pitäjänmäki VALTION MAATALOUSKONEIDEN TUTKIMUSLAITOS Finnish Research Institute of Engineering Agriculture and Forestry 1970 Koetusselostus 750 Test report
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
LANSEERAUS LÄHESTYY AIKATAULU OMINAISUUDET. Sähköinen jäsenkortti. Yksinkertainen tapa lähettää viestejä jäsenille
tiedote 2 / 9.3.2017 LANSEERAUS LÄHESTYY AIKATAULU 4.3. ebirdie-jäsenkortti esiteltiin Golfliiton 60-vuotisjuhlaseminaarissa 17.3. ebirdie tulee kaikkien ladattavaksi Golfmessuilla 17.3. klo 12:00 alkaen
The role of 3dr sector in rural -community based- tourism - potentials, challenges
The role of 3dr sector in rural -community based- tourism - potentials, challenges Lappeenranta, 5th September 2014 Contents of the presentation 1. SEPRA what is it and why does it exist? 2. Experiences
Digitally signed by Hans Vadbäck DN: cn=hans Vadbäck, o, ou=fcg Suunnittelu ja Tekniikka Oy, email=hans.vadback@fcg.fi, c=fi Date: 2016.12.20 15:45:35 +02'00' Jakob Kjellman Digitally signed by Jakob Kjellman