Biosimilars for Doctors - Introduction
|
|
- Lotta Parviainen
- 8 vuotta sitten
- Katselukertoja:
Transkriptio
1 Biosimilar Medicines 12 th EGA International Conference Biosimilars for Doctors - Introduction Pekka Kurki Finnish Medicines Agency, Fimea EMA The views and opinions expressed in the following presentation are based on the experience of the individual presenter and should not be attributed to any regulatory authority Biosimilars for doctors 2 1
2 What is a biosimilar? Biosimilar = similar biological medicinal product (EU) Current regulatory definition of a biosimilar in the EU: A biosimilar is a biological medicinal product that contains a version of the active substance of an already authorised original biological medicinal product (reference medicinal product). A biosimilar demonstrates similarity to the reference medicinal product in terms of quality characteristics, biological activity, safety and efficacy based on a comprehensive comparability exercise Biosimilars for doctors 3 Comparability Similar but not the same? Biosimilars for doctors 4 2
3 Biotechnological manufacturing process pexpression Biosimilars for doctors 5 Change of the manufacturing process leads to a new version of the active substance The manufacturer has to demonstrate the comparability of the versions from the old and the new manufacturing process (ICH guideline Q5E) similar but not the same Biosimilars for doctors 6 3
4 The extent of the comparability exercise depends of the type of the change The change has an impact on in-process controls but not on the specifications of the product The change has an impact on the specifications but not on safety or efficacy An impact on safety and efficacy is possible Physicochemical& biological testing Additional (non) clinical tests The development of biosimilars is based on this scenario Biosimilars for doctors 7 Production batches of biotechnology-derived proteins are not identical Change in the manufacturing process This change was approved without any clinical data Schiestl et al, Nat Biotech Biosimilars for doctors 8 4
5 Changes of the manufacturing process are common (by 2013) Mabthera > 6 Remicade > 35 Enbrel > 20 Humira > Biosimilars for doctors 9 How to create a biosimilar? Tailoring Analysis of several batches of the reference product for key characteristics. The range of variation in these characteristics defines the target ranges for the biosimilar product Fitting The manufacturing process will be adjusted to produce a protein that fits into the desired target ranges Comparison Extensive head-to-head comparisons to the reference by physico-chemical and in vitro biological tests Confirmation Comparable pharmacokinetics Comparable efficacy and safety Biosimilars for doctors 10 5
6 Comparable efficacy and safety (biosimilar infliximab as an example) Biosimilars for doctors 11 Biosimilar infliximab 1 Clinical development (871 patients) Bioequivalence study (250 patients) for 54 weeks Parallel group design (biosimilar vs Remicade ) Ankylosing spondylitis Kinetics primary and clinical endpoints secondary Safety and efficacy study (N 606) for weeks Rheumatoid arthritis Biosimilar vs. Remicade, equivalence design Primary efficacy endpoint ACR20 Secondary endpoints (ACR50, ACR70, DAS28, ADL etc.) 1 European Public Assessment Reports: Biosimilars for doctors 12 6
7 Mean (±SD) serum concentrations (μg/ml) of infliximab vs time (h) by treatment for dose 5; PK population Biosimilars for doctors 13 Biosimilar infliximab Efficacy (ACR20 at week 30) 1 Treatment arm n/n (%) Estimate of Treatment Difference All-randomised Population 95% CI of Treatment Difference Biosimilar Remicade 184/302 (60.9) 178/304 (58.6) 0.02 (-0.06, 0.10) The primary analysis was supported by the secondary efficacy endpoints. Comparable safety profile, including immunogenicity. 1 European Public Assessment Reports: Biosimilars for doctors 14 7
8 Extrapolation of safety and efficacy (an old concept with regard to healthy individuals-patients, adultsadolescents-children, foreign data, ethnic groups, organ dysfunction, mild-severe etc) Biosimilars for doctors 15 Extrapolation of safety and efficacy Development of biosimilars Identical primary-, secondary, and tertiary structure Comparable post-translational profile Comparable in vitro functional characteristics Comparable pharmacokinetics Equivalent efficacy and comparable safety and immunogenicity Can two comparable versions of an active substance behave differently in different therapeutic indications? Have we ever seen such a case? Biosimilars for doctors 16 8
9 Situations where the safety and efficacy might differ between different therapeutic indications Different receptors involved in different indications More than one active site in the active substance (mabs) Different concomitant medications (e.g. immunosuppression) Different populations with specific safety/immunogenicity concerns Biosimilars for doctors 17 Biosimilar infliximab Therapeutic indications: Rheumatoid arthritis Crohn s disease (adults and children) Ulcerative colitis Ankylosing spondylitis Psoriasis (skin and joints) Biosimilars for doctors 18 9
10 Biosimilar infliximab: Physico-chemical analysis Main areas of investigation Amino acid sequence Higher order structure Protein isoforms Glycoforms Purity and stability A difference in the proportion of afucosylated glycoforms fucosylated afucosylated Drug Information Association Biosimilar infliximab Functional studies A difference in % of afucosylated glycoforms A difference in Fc RIIIa/bbinding A difference in ADCC (Jurkat) Impact on extrapolation? (to IBD) Biosimilars for doctors 20 10
11 Difference in ADCC PBMC NK cells Neutrophils Fc RIIIA-VV Fc RIIIA-VF Fc RIIIA-FF Fc RIIIA-VV/VF + serum Mixture of Fc Rpositive cells The difference in the ADCC-activity is not seen in more physiological conditions Biosimilars for doctors 21 Additional testing, possibly be relevant to IBD Blocking of TNFα effects on epithelial cells Suppression of cytokine secretion in epithelial cell line by blocking soluble TNFα Suppression of apoptosis in epithelial cell line cells by blocking soluble TNFα Biosimilars for doctors 22 11
12 Additional testing for possible IBD-related mechanisms Evaluation of Regulatory Macrophage Function Suppression of T cell proliferation by induced regulatory macrophages in mixed lymphocyte reaction (MLR) assay Quantitation of the induced regulatory macrophages by FACS Induced regulatory macrophage-mediated wound healing of colorectal epithelium cells The function of the biosimilar and the reference products are comparable, i.e. extrapolation to IBD is possible Biosimilars for doctors 23 Extrapolation The totality of evidence Different receptors involved in different indications Different function of one of the active sites Different concomitant medications (e.g. immunosuppression) Different populations with specific safety/immunogenicity concerns The current data indicate that extrapolation to IBD is possible Biosimilars for doctors 24 12
13 Thank you for your attention! Biosimilars for doctors 25 Extrapolation of safety and efficacy A consideration for all new medicinal products Patient group & disease With regard to maturation, age, sex, pregnancy, co-morbidities Patients with or without impaired organ function Between ethnic populations Different stages of the disease Etc REFLECTION PAPER ON THE EXTRAPOLATION OF RESULTS FROM CLINICAL STUDIES CONDUCTED OUTSIDE THE EU TO THE EU-POPULATION (CHMP/EWP/692702/08) NOTE FOR GUIDANCE ON ETHNIC FACTORS IN THE ACCEPTABILITY OF FOREIGN CLINICAL DATA (CPMP/ICH/289/95) NOTE FOR GUIDANCE ON CLINICAL INVESTIGATION OF MEDICINAL PRODUCTS IN THE PAEDIATRIC POPULATION (CPMP/ICH/2711/99) Biosimilars for doctors 26 13
Guideline on Similar biological medicinal products containing biotechnology-derived proteins as active substance: non-clinical and clinical issues
Guideline on Similar biological medicinal products containing biotechnology-derived proteins as active substance: non-clinical and clinical issues EMA Workshop on Biosimilars, 31 October 2014 Pekka Kurki
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli. Lataa
Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli Lataa Kirjailija: Pekka Rapeli ISBN: 9789523022232 Sivumäärä: 173 Formaatti: PDF Tiedoston koko: 11.54 Mb Opioid substitution
Development and approval of biosimilars in Europe
Development and approval of biosimilars in Europe LIS TNF/BIO seminar 20 March 2018, Scandic Nidelven, Trondheim Niklas Ekman, Ph.D. Head of the Biological Division, Senior Researcher, Finnish Medicine
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
Tutkimuslääkkeiden GMP. Fimea Pirjo Hänninen
Tutkimuslääkkeiden GMP Fimea 17.1.2017 Pirjo Hänninen Kliinisiä lääketutkimuksia koskeva EU:n asetus Regulation (EU) No 536/2014 Hyväksytty 16.4.2014 (voimaan 28.5. 2016) Kumoaa nykyisen lääketutkimusdirektiivin
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
Ajankohtaista GMP:stä. Ritva Haikala
Ajankohtaista GMP:stä Ritva Haikala 16.1.2018 EU GMP oppaan päivitystilanne GMP Guide: Introductions Comments To provide the European Commission with a final text in view of recent changes to the legal
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
EU Regulatory Perspectives on Biosimilars
EU Regulatory Perspectives on Biosimilars IFPAC Annual Meeting January 19, 2011 Baltimore, MD, USA Niklas Ekman, Ph.D Senior Researcher Finnish Medicines Agency Helsinki, Finland niklas.ekman@fimea.fi
Benchmarking Controlled Trial - a novel concept covering all observational effectiveness studies
Benchmarking Controlled Trial - a novel concept covering all observational effectiveness studies Antti Malmivaara, MD, PhD, Chief Physician Centre for Health and Social Economics National Institute for
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
Certification of quality and/or non-clinical data for ATMPs
Certification of quality and/or non-clinical data for ATMPs GLP Seminar, Helsinki 16.9.2014 Lääkealan turvallisuus- ja kehittämiskeskus 17.9.2014 Paula Salmikangas 1 Advanced Therapy Medicinal Products
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
Collaborative & Co-Creative Design in the Semogen -projects
1 Collaborative & Co-Creative Design in the Semogen -projects Pekka Ranta Project Manager -research group, Intelligent Information Systems Laboratory 2 Semogen -project Supporting design of a machine system
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä. public-procurement
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä https://ec.europa.eu/futurium/en/ public-procurement Julkiset hankinnat liittyvät moneen Konsortio Lähtökohdat ja tavoitteet Every
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Hankkeiden vaikuttavuus: Työkaluja hankesuunnittelun tueksi
Ideasta projektiksi - kumppanuushankkeen suunnittelun lähtökohdat Hankkeiden vaikuttavuus: Työkaluja hankesuunnittelun tueksi Erasmus+ -ohjelman hakuneuvonta ammatillisen koulutuksen kumppanuushanketta
Biosimilaarit Kliiniset tutkimukset
Reumahoitajat Seminaari ja vuosikokous Biosimilaarit Kliiniset tutkimukset Tampere 10.2.2017 PK Biosimilaarin kehitys etenee vaiheittain 1 Viitevalmisteen ominaisuuksien selvitys Analyytinen vertailu Biologinen
Statistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
Tilausvahvistus. Anttolan Urheilijat HENNA-RIIKKA HAIKONEN KUMMANNIEMENTIE 5 B RAHULA. Anttolan Urheilijat
7.80.4 Asiakasnumero: 3000359 KALLE MANNINEN KOVASTENLUODONTIE 46 51600 HAUKIVUORI Toimitusosoite: KUMMANNIEMENTIE 5 B 51720 RAHULA Viitteenne: Henna-Riikka Haikonen Viitteemme: Pyry Niemi +358400874498
Plant protection of cereals current situation
Plant protection of cereals current situation PesticideLife Opening seminar 19.2.2010, Jokioinen Pertti Rajala Cereals, total 1 203,1 Winter wheat 16,4 Spring wheat 201,9 Winter rye 11,3 Sring rye 5,1
7. Product-line architectures
7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software
JA CHALLENGE 18.-19.4.2013. Anna-Mari Sopenlehto Central Administration The City Development Group Business Developement and Competence
JA CHALLENGE 18.-19.4.2013 Anna-Mari Sopenlehto Central Administration The City Development Group Business Developement and Competence 12.11.2014 Challenges of the City of Turku What kind of city you would
EBM ja laboratorio. Kristina Hotakainen HY ja HUSLAB
EBM ja laboratorio Kristina Hotakainen HY ja HUSLAB EBLM Arvioidaan laboratoriokokeiden vaikutuksia kliiniseen päätöksentekoon ja potilaan hoitotuloksiin mm. kliinistä epidemiologiaa, tilastotiedettä,
Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)
Tilasto T1106120-s2012palaute Kyselyn T1106120+T1106120-s2012palaute yhteenveto: vastauksia (4) Kysymys 1 Degree programme: (4) TIK: TIK 1 25% ************** INF: INF 0 0% EST: EST 0 0% TLT: TLT 0 0% BIO:
ATMP-valmisteet ja Fimean rooli ATMP-valvonnassa Suomessa ja EU:ssa
ATMP-valmisteet ja Fimean rooli ATMP-valvonnassa Suomessa ja EU:ssa Heli Suila, FT Erikoistutkija, BIO-jaosto Farmaseuttis-biologinen-yksikkö Lääkevalmisteiden arviointi Fimea Pitkälle kehitetyn terapian
NAO- ja ENO-osaamisohjelmien loppuunsaattaminen ajatuksia ja visioita
NAO- ja ENO-osaamisohjelmien loppuunsaattaminen ajatuksia ja visioita NAO-ENO työseminaari VI Tampere 3.-4.6.2015 Projektisuunnittelija Erno Hyvönen erno.hyvonen@minedu.fi Aikuiskoulutuksen paradigman
3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ
Puhe ja kieli, 27:4, 141 147 (2007) 3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ Soile Loukusa, Oulun yliopisto, suomen kielen, informaatiotutkimuksen ja logopedian laitos & University
Aiming at safe performance in traffic. Vastuullinen liikenne. Rohkeasti yhdessä.
Aiming at safe performance in traffic Vastuullinen liikenne. Rohkeasti yhdessä. Medical doctors promoting traffic safety Jukka Terttunen Traffic Medicine Unit Finnish Traffic Safety Agency Vastuullinen
Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä
Arkkitehtuuritietoisku eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Esikysymys Kuinka moni aikoo suunnitella projektityönsä arkkitehtuurin? Onko tämä arkkitehtuuria?
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
Hankkeen toiminnot työsuunnitelman laatiminen
Hankkeen toiminnot työsuunnitelman laatiminen Hanketyöpaja LLP-ohjelman keskitettyjä hankkeita (Leonardo & Poikittaisohjelma) valmisteleville11.11.2011 Työsuunnitelma Vastaa kysymykseen mitä projektissa
LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet
LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
TIEKE Verkottaja Service Tools for electronic data interchange utilizers. Heikki Laaksamo
TIEKE Verkottaja Service Tools for electronic data interchange utilizers Heikki Laaksamo TIEKE Finnish Information Society Development Centre (TIEKE Tietoyhteiskunnan kehittämiskeskus ry) TIEKE is a neutral,
ProAgria. Opportunities For Success
ProAgria Opportunities For Success Association of ProAgria Centres and ProAgria Centres 11 regional Finnish ProAgria Centres offer their members Leadership-, planning-, monitoring-, development- and consulting
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.2017 Life Science Technologies Where Life Sciences meet with Technology
HITSAUKSEN TUOTTAVUUSRATKAISUT
Kemppi ARC YOU GET WHAT YOU MEASURE OR BE CAREFUL WHAT YOU WISH FOR HITSAUKSEN TUOTTAVUUSRATKAISUT Puolitetaan hitsauskustannukset seminaari 9.4.2008 Mikko Veikkolainen, Ratkaisuliiketoimintapäällikkö
Somaattinen sairaus nuoruudessa ja mielenterveyden häiriön puhkeamisen riski
+ Somaattinen sairaus nuoruudessa ja mielenterveyden häiriön puhkeamisen riski LINNEA KARLSSON + Riskitekijöitä n Ulkonäköön liittyvät muutokset n Toimintakyvyn menetykset n Ikätovereista eroon joutuminen
ELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period
1 ELEMET- MOCASTRO Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions Period 20.02-25.05.2012 Diaarinumero Rahoituspäätöksen numero 1114/31/2010 502/10
Miehittämätön meriliikenne
Rolls-Royce & Unmanned Shipping Ecosystem Miehittämätön meriliikenne Digimurros 2020+ 17.11. 2016 September 2016 2016 Rolls-Royce plc The 2016 information Rolls-Royce in this plc document is the property
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
Lääkkeiden hyvät jakelutavat estämässä lääkeväärennösten pääsyä laillisiin jakelukanaviin. Sidosryhmätilaisuus Fimea Anne Junttonen
Lääkkeiden hyvät jakelutavat estämässä lääkeväärennösten pääsyä laillisiin jakelukanaviin Sidosryhmätilaisuus Fimea 6.5.2013 Anne Junttonen Lääkkeiden hyvät jakelutavat Lääkeaineiden hyvät jakelutavat
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
Skene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene
Skene Muokkaa perustyyl. Games Refueled napsautt. @Games for Health, Kuopio Muokkaa alaotsikon perustyyliä napsautt. 2013 kari.korhonen@tekes.fi www.tekes.fi/skene 10.9.201 3 Muokkaa Skene boosts perustyyl.
Security server v6 installation requirements
CSC Security server v6 installation requirements Security server version 6.4-0-201505291153 Pekka Muhonen 8/12/2015 Date Version Description 18.12.2014 0.1 Initial version 10.02.2015 0.2 Major changes
Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO
Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO Tomi Kauppinen, Eero Hyvönen, Jari Väätäinen Semantic Computing Research Group (SeCo) http://www.seco.tkk.fi/
TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015
1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? 10.10.01 Tuomo Suortti Ohjelman päällikkö Riina Antikainen Ohjelman koordinaattori 10/11/01 Tilaisuuden teema Kansainvälistymiseen
AYYE 9/ HOUSING POLICY
AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we
Kansainvälisiä tutkimus- ja kehitysprojekteja ekotehokkaan rakennetun ympäristön tuottamiseen, käyttöön ja ylläpitoon
Kansainvälisiä tutkimus- ja kehitysprojekteja ekotehokkaan rakennetun ympäristön tuottamiseen, käyttöön ja ylläpitoon ICT & ympäristönäkökulma rakennus- ja kiinteistöklusteri Pekka Huovila VTT Rakennus-
Asiakaspalautteen merkitys laboratoriovirheiden paljastamisessa. Taustaa
Asiakaspalautteen merkitys laboratoriovirheiden paljastamisessa Paula Oja, TtT Laboratorio, Oulun yliopistollinen sairaala Potilasturvallisuustutkimuksen päivät 26. 27.1.2011 1 Taustaa Laboratorion tulee
MUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
Copernicus, Sentinels, Finland. Erja Ämmälahti Tekes,
Copernicus, Sentinels, Finland Erja Ämmälahti Tekes, 24.5.2016 Finnish Space industry in the European context European Space industry has been constantly growing and increasing its direct employment in
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
Capacity utilization
Mat-2.4142 Seminar on optimization Capacity utilization 12.12.2007 Contents Summary of chapter 14 Related DEA-solver models Illustrative examples Measure of technical capacity utilization Price-based measure
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL Ville Liljeström, Micha Matusewicz, Kari Pirkkalainen, Jussi-Petteri Suuronen and Ritva Serimaa 13.3.2012
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds
PhD Anne Hemmi 14.2.2013 RRR 2013 Conference in Greifswald, Germany Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds Eutrophication in surface waters High nutrient
Increase of opioid use in Finland when is there enough key indicator data to state a trend?
Increase of opioid use in Finland when is there enough key indicator data to state a trend? Martta Forsell, Finnish Focal Point 28.9.2015 Esityksen nimi / Tekijä 1 Martta Forsell Master of Social Sciences
Security server v6 installation requirements
CSC Security server v6 installation requirements Security server version 6.x. Version 0.2 Pekka Muhonen 2/10/2015 Date Version Description 18.12.2014 0.1 Initial version 10.02.2015 0.2 Major changes Contents
Rekisteröiminen - FAQ
Rekisteröiminen - FAQ Miten Akun/laturin rekisteröiminen tehdään Akun/laturin rekisteröiminen tapahtuu samalla tavalla kuin nykyinen takuurekisteröityminen koneille. Nykyistä tietokantaa on muokattu niin,
Land-Use Model for the Helsinki Metropolitan Area
Land-Use Model for the Helsinki Metropolitan Area Paavo Moilanen Introduction & Background Metropolitan Area Council asked 2005: What is good land use for the transport systems plan? At first a literature
Reliable diagnostic support Ultra-light design
EN Powerful illumination Intelligent charging management Reliable diagnostic support Ultra-light design VISIOMED Optima UV original scale 1:1 VISIOMED Optima Quality Made Easy and an illumination close
Asiantuntijoiden osaamisen kehittäminen ja sen arviointi. Anne Sundelin Capgemini Finland Oy
Asiantuntijoiden osaamisen kehittäminen ja sen arviointi Anne Sundelin Capgemini Finland Oy Urapolkumalli ja suorituksen johtaminen ovat keskeisiä prosesseja asiantuntijoiden ja organisaation kehittämisessä
HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism
HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism Final SmPC and PL wording agreed by PhVWP December 2011 SUMMARY OF PRODUCT CHARACTERISTICS New Class Warnings
GLP for biologicals and advanced therapies
GLP for biologicals and advanced therapies Tiina Palomäki Finnish medicines agency 16.9.2014 Biological medicinal product A biological medicinal product is a product, the active substance of which is a
CASE POSTI: KEHITYKSEN KÄRJESSÄ TALOUDEN SUUNNITTELUSSA KETTERÄSTI PALA KERRALLAAN
POSTI GROUP CASE POSTI: KEHITYKSEN KÄRJESSÄ TALOUDEN SUUNNITTELUSSA KETTERÄSTI PALA KERRALLAAN TIINA KATTILAKOSKI POSTIN TALOUDEN SUUNNITTELU Mistä lähdettiin liikkeelle? Ennustaminen painottui vuosisuunnitteluun
GLP-vaatimukset ATMP-valmisteiden turvallisuustutkimuksille
GLP-vaatimukset ATMP-valmisteiden turvallisuustutkimuksille Tiina Palomäki Fimea 2.9.2015 Advanced therapy medicinal products (ATMPs) Somatic cell therapy medicinal products Tissue engineered products
BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
KANSALLINEN REUMAREKISTERI (ROB-FIN)
KANSALLINEN REUMAREKISTERI (ROB-FIN) Prospektiivinen kohorttitutkimus tulehduksellisia reumasairauksia sairastavista potilaista Suomen reumatologisen yhdistyksen (SRY) vuonna 1999 perustama Tiedonkeruu
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto If you are searched for a book by Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice over LTE (VoLTE) in pdf form, then you have come
Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes)
SYLY- päivät 2014 Helsinki 28.11.2014 Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes) Diabeteslääkäri Mikko Honkasalo Nurmijärven terveyskeskus
Lataa Legislating the blind spot - Nikolas Sellheim. Lataa
Lataa Legislating the blind spot - Nikolas Sellheim Lataa Kirjailija: Nikolas Sellheim ISBN: 9789524849012 Sivumäärä: 292 Formaatti: PDF Tiedoston koko: 22.52 Mb For decades the Canadian seal hunt has
Co-Design Yhteissuunnittelu
Co-Design Yhteissuunnittelu Tuuli Mattelmäki DA, associate professor Aalto University School of Arts, Design and Architecture School of Arts, Design and Architecture design with and for people Codesign
SSTY:n EMC-seminaari. EMC ja sähköisten lääkintälaitteiden standardit. Ari Honkala SESKO ry
SSTY:n EMC-seminaari EMC ja sähköisten lääkintälaitteiden standardit SESKO ry 2016-10-04 Tässä esityksessä käsitellään Yleistä täydentävistä (collateral, -1 sarja, horisontaaliset) ja eritysvaatimuksia
EUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
AKKREDITOITU SERTIFIOINTIELIN ACCREDITED CERTIFICATION BODY
S017 Liite 1.09 / Appendix 1.09 Sivu / Page 1(5) AKKREDITOITU SERTIFIOINTIELIN ACCREDITED CERTIFICATION BODY EUROFINS EXPERT SERVICES OY EUROFINS EXPERT SERVICES LTD. Tunnus Code Yksikkö tai toimintoala
Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi
Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi Green Cities and Settlements 18.2.2014 Ville Manninen Writers Project group Sirpa Korhonen, Anna Mari
LUONNOS RT 80260 EN AGREEMENT ON BUILDING WORKS 1 THE PARTIES. May 1998 1 (10)
RT 80260 EN May 1998 1 (10) AGREEMENT ON BUILDING WORKS This agreement template is based on the General Terms and Conditions of Building Contracts YSE 1998 RT 16-10660, LVI 03-10277, Ratu 417-7, KH X4-00241.
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
Läpimurto ms-taudin hoidossa?
Läpimurto ms-taudin hoidossa? Läpimurto ms-taudin hoidossa? Kansainvälisen tutkijaryhmän kliiniset kokeet uudella lääkkeellä antoivat lupaavia tuloksia sekä aaltoilevan- että ensisijaisesti etenevän ms-taudin
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto Tämän viestinnän, nykysuomen ja englannin kandidaattiohjelman valintakokeen avulla Arvioidaan viestintävalmiuksia,
Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen
The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project
The role of 3dr sector in rural -community based- tourism - potentials, challenges
The role of 3dr sector in rural -community based- tourism - potentials, challenges Lappeenranta, 5th September 2014 Contents of the presentation 1. SEPRA what is it and why does it exist? 2. Experiences
Teacher's Professional Role in the Finnish Education System Katriina Maaranen Ph.D. Faculty of Educational Sciences University of Helsinki, Finland
Teacher's Professional Role in the Finnish Education System Katriina Maaranen Ph.D. Faculty of Educational Sciences University of Helsinki, Finland www.helsinki.fi/yliopisto This presentation - Background
GMP päivä Kari Lönnberg
GMP päivä 17.1.2017 Kari Lönnberg Vaikuttavien aineiden valmistus Vaikuttavien aineiden valmistukseen sovelletaan vaikuttavia aineita koskevaa hyvää tuotantotapaa riippumatta siitä, onko vaikuttavat aineet
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
1 in Avril Cutler, Development Officer, Lanarkshire Recovery Network Rosie Line, Support Officer, Lanarkshire Movement for Change
Avril Cutler, Development Officer, Lanarkshire Recovery Network Rosie Line, Support Officer, Lanarkshire Movement for Change March 2017 1 in 4 1 background Period of listening (kuultiin yli 200 henkilöä,
Ohjelmien kehittämisstudiot varmistavat laadukkaat ja linjakkaat maisteriohjelmat Maire Syrjäkari ja Riikka Rissanen
Ohjelmien kehittämisstudiot varmistavat laadukkaat ja linjakkaat maisteriohjelmat 18.8.2016 Maire Syrjäkari ja Riikka Rissanen Miksi ja miten studiot? Todellinen tarve: uudet maisteriohjelmat alkamassa
Työsuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016. Peter Michelsson Wallstreet Asset Management Oy
Työsuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016 Peter Michelsson Wallstreet Asset Management Oy Wallstreet lyhyesti Perustettu vuonna 2006, SiPa toimilupa myönnetty 3/2014 Täysin kotimainen,