rapid evolution in copy number, location and sequence, with diverse turnover mechanisms.
|
|
|
- Anton Laaksonen
- 4 vuotta sitten
- Katselukertoja:
Transkriptio
1 Repetitive DNA and its evolution: genomic strategies to understand the processes and exploit biodiversity rapid evolution in copy number, location and sequence, with diverse turnover mechanisms. often mark the major differences between closely related species Sym038: Plant genomes: not just for models anymore 38A: 28 July 2011 Pat Heslop-Harrison and Trude Schwarzacher Farah Badakshi, Ana Claudia Guerra, Guto Kuhn, Faisal Nouroz, Mateus Mondin Twitter: #IBC18
2
3 Peanut, Arachis hypogaea, 2n=4x=40 AABB genome constitution Ana Claudia Guerra Araujo, EMBRAPA, Brazil
4 BAC in situ individual BACs have various repetitive sequences with
5 Many of the repetitive sequences are retrotransposons and DNA transposons Some are microsatellite motifs Some are satellites including the most rapidly evolving sequences
6
7 ancestral High-copy number High-copy number High-copy number Low-copy number Low-copy number High copy spp: homogenized, amplification from a limited number of master copies Low copy spp: much variation
8 120bp repeat unit family in Triticum, Aegilops and Secale species Homology between sequences % in Triticum/Aegilops and Secale species Afacer T.mono106/42!133pt1 T.mono106/42!155pt1 996 Ae.umb106/208!1911 Ae.umb106/208! Ae.umb106/208!2012 S.vav147!259pt1 Pet w 25/208! Pet w 25/208!077 S.vav42! S.vav106/208!215pt1 S.vav106/208!204pt2 915 S.vav106/208!215pt2 S.vav25/208!182 S.mon42!136 Pet /42!3324 Pet /42! CS/325/208!1820 Pet !315 S.vav25/208! T.tau25/147!2524pt2 CS/325/147!2322pt2 L.moll25/42!156 Pet w25/147!123 CS/325/208! CS/325/147!2120 Pet w25/147! Ae.umb25/147!124 Ae.umb25/208!168 L.moll25/42! Repeat2 Pet w 25/208!099 S.mon147!1811 S.vav106/208!204pt Repeat3 S.vav147!2711pt1 S.mon25/147!081 T.mono25/208! Repeat1 S.vav42!237pt1 S.vav42!237pt2 T.tau25/147!2625 T.tau25/147!2726 Ae.umb25/208!157 T.tau25/208!1517 T.tau106/42!177 Ae.umb25/42!091 L.moll25/42! CS/325/208!1618 T.tau25/147!2524pt1 CS/325/147!2322pt1 Pet /208!2325 Pet /147!1918 Pet /208!2426 T.tau25/208! T.tau25/208!1416 Ae.umb25/147!135 Ae.umb25/147!146 Ae.umb25/208!179 Ae. tauschii (D genome) Irrespective of copy number in the genome S. cereale (R genome)
9 ancestral High-copy number High-copy number High-copy number High-copy number Low-copy number Low-copy number High copy and low copy spp: no significant homogenization
10 Brassica nigra (BB) 2n=16 Brassica carinata (BBCC) 2n=34 Brassica juncea (AABB) 2n=36 Brassica oleracea (CC) 2n=18 Brassica napus (AACC) 2n=38 Brassica rapa (AA) 2n=20 10
11 Genome Specificity of a CACTA (En/Spm) Transposon B. napus (AACC, 2n=4x=38) hybridized with C-genome CACTA element red B. oleracea (CC, 2n=2x=18) B. rapa (AA, 2n=2x=20) Alix et al. The CACTA transposon Bot1 played a major role in Brassica genome divergence and gene proliferation. Plant Journal
12 Genome Specificity of a CACTA (En/Spm) Transposon B. napus AJ AC B. rapa AC AC AC B ot1-1 large insertion specific of Bot1-1 B. oleracea B ot1-2 large insertion in common between Bot1-2 and Bot1-3 B ot1-3 Bo6L bp Rearrangement specific of Bot1-3
13 Sequence level at scale of 100s to 10000s of bp analysis by dotplot Faisal Nouroz
14 Dot-plots of genomic sequence from homologous pairs of BACs Region of high homology between A and C sequence kb Brassica rapa (A genome) sequence Region of low homology 4kb Insertion-gap pair: present in C genome 500bp Insertion-gap pair: present in A Microsatellite Transposed (moved) sequence Sequence level at scale of 100s to 1000s of bp analysis by dotplot Dotter plot of Brassica oleracea var. alboglabra clone BoB028L01 x Brassica rapa subsp. pekinensis An inversion clone KBrB073F16 with transposable elements. 28/07/ gi vs. gi Brassica oleracea (C genome) sequence
15
16 AAGTGAATGGATGCTCGCATTAGTTACTATGAGCCGATTCTCGCTCTTGCGAAAGCTAAAGAGGAAAAGGCCTTCGCATTGCAGAAG AGCTGGCTGCCAGCGAGCAAGAGGTTTTCAATATTGGCTTGTGGAAAATTTGTTGCCACTTTTGCTTTACTAAGGAATGAAATAATAC TTGTTTTTTTTTTTCATGGTTAATATTAGAAGATATAATTTCCTTTGAAGTTAGATTACGTTTCTTTATGTCGACGAAGTGAAGAAATATT GTCTTGTTTATGGTTCCTTCTAGTCCCAACCTTTTTTCAAGAAGGTACAGTACGTGTCAGGATTTATATGGATATACACA TATCCTATTGCGCAATTGTCAATAATAGCACTTTTTGAAGTTTATGTCTCAAAATAGCACTAGAAGGAGAAAGTCACAAAAATGATATT CATTAAAGGGTAAAATATCTCTTATATCCTTGGTTTAAAATTAAATAAACAAACAAAAATAAATAAAAATAAATAAAAAAAATGAAAAAA AAGAAATTTTTTTTATAGTTTCAGATTATATGTTTTCAGATTCGATTTTTTTTTTATTTTTTTATTTTTTTCGAAATTTTTTTTTTATTTTTTTTCA AATTTTCTTTTTATAATTTAAAAATACTTTTTGAAACTGTTTTTTTAATTTTTATTTTTTATTTTAGTATTTATTTTTTATAAAATTTTAAACCCT AATTCCTAAACCCCCACCCCTTAACTCTAAACCCTAAGGTTTGGATTAATTAACCCAATGGATATAAGTGTATATTTACCTCTTTAATGA AACCTATTTTTGTGACTTTGAATCTTGAGTGCTACTTTGGGAACAAAAACTTGGTTTGGTGCTATCCTAGTCTTTTTCTCTATCCTATT 28/07/2011 TACCACCCTTCTTTGTTCAATACTTTTTACAGTTTTTGGAAAGGACATGTTTCTTCTATCATCACTTAATGGTTATATATGTATGAGAAG TTTGAAAGAGATTACACTGTTTTGGAATATTAAAAAAAAAAGATATTACAAGATCTGATTTTGTTTGTATTTTAAAATTCTACCAAATC TCTCCTCAAAATCTTGGTCAAAGTCCAAAAATCCAAATATCTCAGTTAAATTCCACCAAATATGAAATCCTAAAACTTTTCCAAAATA GTTCAATAAGCCCTTAGTGTTTGGTG TSD TIR 551-bp BART1 TE 9-bp TSD (TATCCTATT) 6-bp TIR and 66-bp imperfect sub-tir TIR TSD Brassica rapa with inserted 542bp sequence not present in B. oleracea. 9bp TSD (red letters and arrow) and TIR (blue). Flanking primers used in PCR as blue arrows on sequence Faisal Nouroz
17 B. rapa AA 2n=20 B. juncea AABB 2n=36 B. nigra BB 2n=16 B. carinata BBCC 2n=34 B. oleracea CC 2n=18 B. napus AACC 2n=38
18 GACACTCTTCCCAATCGTTCATTCCTGACGTCATTAGGCAACCACCTCTGTTTTTCCCCACCACAAACAGTGAATACATCTCTCCTATCTCTC TCAGAATCGTCAGTGTTTGCTCTCCGTTGCTTACTCGCTTCTCTATGAATCCAACTTGCCCCGTCGTTACAAATCTGCCAAAAATAAACCAAA ACCAGTCCGGTCAATGAAAAAAATGCCAATGTTTCAGGTCTAGAAATTATCCACAACCCTAGTACTAAGATCTGAAATTTATGAGGGAGATAA ACATTTTTAGGTTAATTGTAAGAAAAAATATTTATAATTTTTGGGCCATGCAGCAAATACATAATATTTCCTTAAAATTTGGATTGTAAGAC TAATAGTGTTTGAGTATTTGATATTTGATATCTTTTAAAAAAGGAAACAAAATTGAATTTCTAAATAAGATTATATTTTTAAAATAAAACAAT AAAAATACATAAAAATAGTTACAAAAAAAAATATATATATTGTTAAACCGTTAGCAAATTAAATACTAAATCCTATACCCTAAATCCTAAACT CCAAACCCTAAATGATAAACCTTAAATCTTGGATAAACCGTAAACCATTGGAAAATTTTAAAACCTAATCATACATTAAAAACTAAAATTTAA TAACACTAAACCCTAAACCCTAATCACTAAACCCTAAACCCTTAGATAAATCATGAACCCTTGGATAAATCATAAACTCTAAATCAAAAATAT TTAAAATTAAACCCTAAAATATATAATTTATCCAAGGGCTCAGAGTTTACCCAAGGGTTTAGGGTTTAGTGATTAGGATTTAGGGTTTAGTGT TATTAAAATTTAGTTTTTAATGTATGATCTAAGGTTTAAGAGTTTCCAATGGTTTAGAGTTTATCCAAAGTTTAAGGTTTAACGTTTAGGGTT TAGGATTTAGGATTTAAGGTATAGGGTTTAGTATTTTGCTGAAGATTTAACAATATTAATTAATTTATTTTTTGTAACTATTTTTATATATTT TTATTATTTTATTTTTAAAATATAATATAATTTGGATATTCAATTTTATTTTCTTTTTTAAAAAATATCAAATATCAAATACTCAAACACTAT GGTTGGTGAACTTCTAGGTGTGAACCCAAGAATTACTCTTAATGTTTCATCCGATTGTGCTCAAAACCTTTCATGAACTGGCTAAAGCTGGAA ACATAGGATTAGTAAGAAGTAGAATCTTGTAAAGTACCTGTTATAGTATTCCTCTAAGAAAGTTCGATCAGTTTCGTCGTTTGTCTGATCGTT ACCAACAATCTCCATCAAAACATCGTTGTTTTCTTTGGTCACCGCGTCTCCGACAAGATTCTCTGTCTCCGAGCCATAAGCGACAAACTGTAT GATAGTGAGGTGAATCTGAGAGTTATTGATAAGCCACTGGCACAAGGACAGAGCCTCTCGATCATCAGGACCACCAAAGAACAATGCAGCGAC GTGTTGTACCGACTCAAACCCGTGAAGCTGGTGGAACCCGGTTATGTTTCTATCCACATAGATACCGATCG 28/07/ bp TE TAAT, 4-bp TSD AGTGT/ACTCT, 5-bp TIRs & 370-bp IR Insertion sequence present in B. oleracea, missing from B. rapa. TSD (red); green and blue boxes shows remarkable internal structure with 370-bp inverted repeat near-filling the insert. 18
19 Rapa141F Rapa185F Rapa8002 Rapa177R B. rapa ( ) B. oleracea (66, ) TSD TIR 542-bp TE TIR TSD /07/2011 B. rapa (AA) B. juncea (AABB) B. napus (AACC) Hexaploid Brassica (carinata x rapa) B. nigra (BB) B. oleracea (CC) B. carinata (BBCC) B. oleracea (GK97361) =A =T =C =G Schematic representation of insertion in Brassica rapa and other Brassica genomes. Green, red, blue and black boxes showing DNA motifs. 19
20 28/07/2011 Dotplot of 790bp insertion element showing inverted repeat structure. 20
21 Terminal LTR retrotransposon in B.oleracea and B.napus. b) B. juncea with mariner like transposon e)
22 524 bp SINE670 bp hat 2781 bp MuDR Like 216 bp SINE Brassica oleracea (C genome; EU ) TEs in B. oleracea Brassica rapa (A genome; AC ) 505 bp Unknown 1655 bp in B.rapa Microsatellite 1189 bp Mariner 380 in B.rapa Like 700 bp hat 715 bp hat 914 bp LINE 1016 bp in LINE 3869 bp TE 402 bp hat 1080 bp LINE 1284 bp 258 MITE Unknown 819 bp Unknown 237 bp Mariner Like Inversion 242, 644 & 274 bp SINEs
23 Whole genome analysis From morphology, cytology, repeats, genes and whole genome sequences The most abundant transposable elements identified in XXX, LTR retrotransposons of the Copia and Gypsy superfamilies, were found to occur 50-fold and 25-fold less frequently in assembled reads than in shotgun reads, respectively... Because only predicted protein homologies were used to identify transposable elements and because all transposable elements contain extensive noncoding DNA, we expect that the vast majority of the transposable element related DNA in the XXX genome assembly was missed by this approach
24 Repetitive DNA and its evolution: genomic strategies to understand the processes and exploit biodiversity Repeats are the greatest part of most genomes Repeats amplify, homogenize, move and deleted They are the most rapidly changing genome component They drive genome evolution, diversification and chromatin structure Sym038: Plant genomes: not just for models anymore 38A: 28 July 2011 Pat Heslop-Harrison and Trude Schwarzacher Farah Badakshi, Ana Claudia Guerra, Guto Kuhn, Faisal Nouroz, Mateus Mondin
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
Functional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Eukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
7. Product-line architectures
7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
Supporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
Enseigner l'évolution
AATTTTCGTATCTGTTGGAGTTAGATAAGCCTACGCTTGATGGACCGTTGGGTGGCTTTCTAAGTGAGCTCGTGCCATCACAATTAATATAAGGAATTGTAGATGTTTCTTTCGTTATAGGTATTTCAAAAT TTATAAGAACCTACGCCCTCGTCTTTCTCCATTGGAACAGTTGCCGTTTTCGCAGTTCTTTTTGGTTCAGTCCTCATATCATGTGATTCCCCTGGCTCTCCTGATCTTTTTATACTTACTTTGAAATCGTCA
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
6.4. Genomin koon evoluutio Genomin koko vaihtelee
6.4. Genomin koon evoluutio 6.4.1. Genomin koko vaihtelee C-arvo: genomin haploidi koko pg:na 1 pg = 0.98 x 10 9 bp = 1 milj. kb = 1000 Mb (ero: geneettinen genomin koko (cm)) Missäkohtaa genomiaon kokoeroja?
Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)
Tilasto T1106120-s2012palaute Kyselyn T1106120+T1106120-s2012palaute yhteenveto: vastauksia (4) Kysymys 1 Degree programme: (4) TIK: TIK 1 25% ************** INF: INF 0 0% EST: EST 0 0% TLT: TLT 0 0% BIO:
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks. David R. Kelley
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks David R. Kelley DNA codes for complex life. How? Kundaje et al. Integrative analysis of 111 reference
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Genome 373: Genomic Informatics. Professors Elhanan Borenstein and Jay Shendure
Genome 373: Genomic Informatics Professors Elhanan Borenstein and Jay Shendure Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis
Bioinformatics. Sequence Analysis: Part III. Pattern Searching and Gene Finding. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Sequence Analysis: Part III. Pattern Searching and Gene Finding Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? 10.10.01 Tuomo Suortti Ohjelman päällikkö Riina Antikainen Ohjelman koordinaattori 10/11/01 Tilaisuuden teema Kansainvälistymiseen
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
Underpinning Phage Arbitrium Communication Systems
Molecular Cell, Volume 74 Supplemental Information Deciphering the Molecular Mechanism Underpinning Phage Arbitrium Communication Systems Francisca Gallego del Sol, José R. Penadés, and Alberto Marina
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
State of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
Naisnäkökulma sijoittamiseen. 24.3.2007 Vesa Puttonen
Naisnäkökulma sijoittamiseen 24.3.2007 Vesa Puttonen Miten sukupuolella voi olla mitään tekemistä sijoittamisen kanssa??? Naiset elävät (keskimäärin) pidempään kuin miehet Naiset saavat (keskimäärin) vähemmän
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Supporting Information for Electrophoresis DOI /elps Sunil Archak, Vemireddy Lakshminarayanareddy and Javaregowda Nagaraju
ELECTROPHORESIS Supporting Information for Electrophoresis DOI 10.1002/elps.200600646 Sunil Archak, Vemireddy Lakshminarayanareddy and Javaregowda Nagaraju High-throughput multiplex microsatellite marker
Supporting information
Supporting information Figure S1. Carotenoid biosynthesis pathway in papaya fruit which is adopted from Blas et al. (2010) (reference 4) and Nisar et al. (2015) (reference 5). Carotenoids are synthesized
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
Sukupuolijutut 3. Ihmisen (nisäkkään) seksuaalikromosomi on Y. Y-kromosomi?
Sukupuolijutut 3 Ihmisen (nisäkkään) seksuaalikromosomi on Y Y-kromosomi? http://www.nature.co m/nature/focus/ychro mosome/index.html Ihmisen X-kromosomi on normaali kromosomi Y on erikoinen - kooltaan
The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region
The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region The BaltCICA Project is designed to focus on the most imminent problems that climate change is likely to cause
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
Counting quantities 1-3
Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X 2. Rastita Tick (X) (X) the kummassa box that has
HOITAJAN ROOLI TEKNOLOGIAVÄLITTEISESSÄ POTILASOHJAUKSESSA VÄITÖSKIRJATUTKIJA JENNI HUHTASALO
HOITAJAN ROOLI TEKNOLOGIAVÄLITTEISESSÄ POTILASOHJAUKSESSA VÄITÖSKIRJATUTKIJA JENNI HUHTASALO Tutkimusintressit Asiantuntijuus ja teknologia: Hoitajan rooli teknologiavälitteisessä potilasohjauksessa Opettajan
Eija Lahtinen Uudet kelikamerat Kaakkois-Suomen tiepiiri
Eija Lahtinen Uudet kelikamerat Kaakkois-Suomen tiepiiri VIKING Eija Lahtinen Uudet kelikamerat Kaakkois-Suomen tiepiiri Tiehallinto Kaakkois-Suomen tiepiiri Liikenteen palvelut Kouvola 2001 Raportin
Business Opening. Arvoisa Herra Presidentti Very formal, recipient has a special title that must be used in place of their name
- Opening Finnish Norwegian Arvoisa Herra Presidentti Very formal, recipient has a special title that must be used in place of their name Hyvä Herra, Formal, male recipient, name unknown Hyvä Rouva Formal,
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
CIO muutosjohtajana yli organisaatiorajojen
CIO muutosjohtajana yli organisaatiorajojen 03.06.2009 Antti Koskelin CIO Konecranes Group 2009 Konecranes Plc. All rights Konecranes overview Business Agenda CIO Agenda Mindset for modern CIO Konecranes
The Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
Counting quantities 1-3
Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X. Rastita Tick (X) (X) the kummassa box that has laatikossa
ELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period
1 ELEMET- MOCASTRO Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions Period 20.02-25.05.2012 Diaarinumero Rahoituspäätöksen numero 1114/31/2010 502/10
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.2017 Life Science Technologies Where Life Sciences meet with Technology
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
Changes in the drawing are allowed only by the permission of the authorities who have granted the certificate Muutokset sallittu vain sertifikaatin my
Changes in the drawing are allowed only by the permission of the authorities who have granted the certificate Muutokset sallittu vain sertifikaatin myöntäjän luvalla The drawing is a valid document only
Data quality points. ICAR, Berlin,
Data quality points an immediate and motivating supervision tool ICAR, Berlin, 22.5.2014 Association of ProAgria Centres Development project of Milk Recording Project manager, Heli Wahlroos heli.wahlroos@proagria.fi
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy
Predicting evolutionarily conserved regions (ECRs) in the Xenopus tropicalis genome using a MultiPipMaker-based bioinformatic strategy OVERVIEW- Method updated and written by Sarah Louie (6/19/08) Initially
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä
CSC:n käyttäjätunnukset - myös opiskelijoille
CSC:n käyttäjätunnukset - myös opiskelijoille http://www.csc.fi/asiakkaaksi/korkeakoulut/kayttol upahakemukset/index_html Ohjaajan nimeksi Petri Törönen Perusteluiksi opiskelu ja luentokurssin nimi (Geneettisen
Changes in the drawing are allowed only by the permission of the authorities who have granted the certificate Muutokset sallittu vain sertifikaatin my
Changes in the drawing are allowed only by the permission of the authorities who have granted the certificate Muutokset sallittu vain sertifikaatin myöntäjän luvalla The drawing is a valid document only
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
MUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
lpar1 IPB004065, IPB002277, and IPB Restriction Enyzme Differences from REBASE Gained in Variant Lost from Reference
lpar1 IPB465, IPB2277, and IPB5385 Genomic Sequence Coding Sequence For help interpreting these results, view the PARSENP Introduction page. # View On Sequence Nucleotide Change Effect Restriction Enyzme
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
Table S2. S. thermophilus CRISPR spacer sequence analysis.
Table S2. S. thermophilus CRISPR analysis. 001_1_01 TGTTTGACAGCAAATCAAGATTCGAATTGT 30 AF115103 Streptococcus thermophilus bacteriophage Sfi21, compl 40 93 28 2 0 3 30 38304 38331 1 001_1_02 AATGACGAGGAGCTATTGGCACAACTTACA
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät
Tilausvahvistus. Anttolan Urheilijat HENNA-RIIKKA HAIKONEN KUMMANNIEMENTIE 5 B RAHULA. Anttolan Urheilijat
7.80.4 Asiakasnumero: 3000359 KALLE MANNINEN KOVASTENLUODONTIE 46 51600 HAUKIVUORI Toimitusosoite: KUMMANNIEMENTIE 5 B 51720 RAHULA Viitteenne: Henna-Riikka Haikonen Viitteemme: Pyry Niemi +358400874498
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
Research plan for masters thesis in forest sciences. The PELLETime 2009 Symposium Mervi Juntunen
Modelling tree and stand characteristics and estimating biomass removals and harvesting costs of lodgepole pine (Pinus contorta) plantations in Iceland Research plan for masters thesis in forest sciences
Travel Getting Around
- Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?
OP1. PreDP StudyPlan
OP1 PreDP StudyPlan PreDP The preparatory year classes are in accordance with the Finnish national curriculum, with the distinction that most of the compulsory courses are taught in English to familiarize
Strain or plasmid Description a Reference or source b. 168 trpc2 Laboratory. 1A780 trpc2 sigb::spc BGSC
TABLE S1 Bacterial strains and plasmids Strain or plasmid Description a Reference or source b B. subtilis 168 trpc2 Laboratory stock 1A780 trpc2 sigb::spc BGSC BM1010 trpc2 htpx::pgs1582; Em r BM1302 trpc2
Supplementary Material : Baker et al. 1
Supplementary Material : Baker et al. 1 Supplementary Material Title: Species identity and human consumption of beaked whales in the Gilbert Islands, Republic of Kiribati Authors: C. Scott Baker, Al Hutt,
Data Quality Master Data Management
Data Quality Master Data Management TDWI Finland, 28.1.2011 Johdanto: Petri Hakanen Agenda 08.30-09.00 Coffee 09.00-09.30 Welcome by IBM! Introduction by TDWI 09.30-10.30 Dario Bezzina: The Data Quality
Enterprise Architecture TJTSE Yrityksen kokonaisarkkitehtuuri
Enterprise Architecture TJTSE25 2009 Yrityksen kokonaisarkkitehtuuri Jukka (Jups) Heikkilä Professor, IS (ebusiness) Faculty of Information Technology University of Jyväskylä e-mail: jups@cc.jyu.fi tel:
MEETING PEOPLE COMMUNICATIVE QUESTIONS
Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.
Efficient regeneration system and Agrobacteriummediated transformation of Vetiver. PT 1
Efficient regeneration system and Agrobacteriummediated transformation of Vetiver PT www.acolor.net 1 Outline: Part I: Why (Background) Part II: Some concrete work we have done Part III: Prospects to further
Viral DNA as a model for coil to globule transition
Viral DNA as a model for coil to globule transition Marina Rossi Lab. of complex fluids and molecular biophysics LITA (Segrate) UNIVERSITA DEGLI STUDI DI MILANO - PhD Workshop October 14 th, 2013 Temperature
Basic Flute Technique
Herbert Lindholm Basic Flute Technique Peruskuviot huilulle op. 26 Helin & Sons, Helsinki Basic Flute Technique Foreword This book has the same goal as a teacher should have; to make himself unnecessary.
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel. Kalle Lehto, Aalto-yliopisto 5.5.
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel Kalle Lehto, Aalto-yliopisto 5.5.2011 Otaniemi ReFuel a three year research project (2009-2011) goal utilize the
Digital Admap Native. Campaign: Kesko supermarket
Digital Admap Native Campaign: Kesko supermarket Digital Admap Native Campaign: Kesko Supermarket Mainosmuoto: Natiivi Media: IS.fi Campaign period: 25 September Date of measurement: 26 September Unique:
RAIN RAKENTAMISEN INTEGRAATIOKYVYKKYYS
RAIN RAKENTAMISEN INTEGRAATIOKYVYKKYYS Loppuseminaari 11.12.2018 YIT:n pääkonttori, Helsinki RAIN hankkeen loppuseminaari 11.12.2018 Käyttäjälähtöinen tiedonhallinta (WP 4) Professori Harri Haapasalo OY
Copernicus, Sentinels, Finland. Erja Ämmälahti Tekes,
Copernicus, Sentinels, Finland Erja Ämmälahti Tekes, 24.5.2016 Finnish Space industry in the European context European Space industry has been constantly growing and increasing its direct employment in
Lataa Legislating the blind spot - Nikolas Sellheim. Lataa
Lataa Legislating the blind spot - Nikolas Sellheim Lataa Kirjailija: Nikolas Sellheim ISBN: 9789524849012 Sivumäärä: 292 Formaatti: PDF Tiedoston koko: 22.52 Mb For decades the Canadian seal hunt has
MCV 1,5/ 3-G-3,81. Poimi online-katalogista. Tilausnumero:
Poimi online-katalogista MCV 1,5/ 3-G-3,81 Tilausnumero: 1803439 The figure shows a 10-position version of the product Header, Nominal current:, Nom. voltage: 160 V, Pitch: 3.81 mm, Number of positions:
Pricing policy: The Finnish experience
Pricing policy: The Finnish experience Esa Österberg Senior Researcher Alcohol and Drug Research, STAKES, Helsinki, Finland esa.osterberg@stakes.fi Three pillars of traditional Nordic alcohol control Strict
Plasmid construction PCR reactions were carried out with Pfu or Pfu turbo polymerases (Stratagene) unless otherwise stated.
Expanding the Genetic Code of Yeast for Incorporation of Diverse Unnatural Amino Acids via a Pyrrolysyl-tRNA Synthetase/tRNA Pair Susan M. Hancock 1, Rajendra Uprety 2, Alexander Deiters 2 & Jason W. Chin
I. Principles of Pointer Year Analysis
I. Principles of Pointer Year Analysis Fig 1. Maximum (red) and minimum (blue) pointer years. 1 Fig 2. Principle of pointer year calculation. Fig 3. Skeleton plot graph created by Kinsys/Kigraph programme.
Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen
Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen Who we are FIN-CLARIN University of Helsinki The Language Bank of Finland CSC - The Center for
Hyppylentäjille tiedoksi ja asiaa lentotoimintamääräyksistä
Hyppylentäjille tiedoksi ja asiaa lentotoimintamääräyksistä Tietoja vuoden 2017 2018 Ramp tarkastuksista Tarkastaja Harry Karlsson Ilmailun lupakirjat yksikkö Taustaa Syyt vierailuille PART-SPO asetuksen
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Guidebook for Multicultural TUT Users
1 Guidebook for Multicultural TUT Users WORKPLACE PIRKANMAA-hankkeen KESKUSTELUTILAISUUS 16.12.2010 Hyvää käytäntöä kehittämässä - vuorovaikutusopas kansainvälisille opiskelijoille TTY Teknis-taloudellinen
Mitä tarjolla Energiatyöohjelmassa, vinkkejä tuleviin hakuihin
Mitä tarjolla Energiatyöohjelmassa, vinkkejä tuleviin hakuihin Pia Salokoski Tekes Näin onnistut Horisontti 2020 -ohjelman Smart City- hauissa! Vuoden 2017 haut Topic: Publication date: SCC-1-2016-2017:
MC 1,5/10-G-3,81. Poimi online-katalogista. Tilausnumero:
Poimi online-katalogista MC 1,5/10-G-3,81 Tilausnumero: 1803358 The figure shows a 10-position version of the product Header, Nominal current:, Nom. voltage: 160 V, Pitch: 3.81 mm, Number of positions:
RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla
TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
SAGA 150. Asennusohjeet. Mittaa oven korkeus. Piirrä seinään oven kiinni -päätyyn seinäkannattimen kohdalle vaakaviiva korkeudelle ovi + 75mm + 20 mm.
SAGA 150 Asennusohjeet 500 1 2 Mittaa oven korkeus. Piirrä seinään oven kiinni -päätyyn seinäkannattimen kohdalle vaakaviiva korkeudelle ovi + 75mm + 20 mm. 3 Piirrä vesivaa an avulla viiva myös kiskon
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
RULLARADAT RULLADAT ROLLER TABLES
ROLLER TABLES Roller tables are an important element in an assembly line, where ergonomics and good workflow must be ensured. The roller tables guarantee that the wheels can be fed forward effortlessly
Satelliittikuvat osana öljypäästövalvontaa
Öljypäästövalvonta Euroopan meriturvallisuusviraston (EMSA) satelliittikuvilta Kati Tahvonen Suomen ympäristökeskus Kaukokartoituspäivät 2007 Helsinki, 8.11.2007 Satelliittikuvat osana öljypäästövalvontaa
Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE
Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE November 7, 2014 Paula Kilpinen 1 7.11.2014 Aalto University