The Viking Battle - Part Version: Finnish

Koko: px
Aloita esitys sivulta:

Download "The Viking Battle - Part Version: Finnish"
  • Aki Aro
  • 5 vuotta sitten
  • Katselukertoja:


1 The Viking Battle - Part Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman joukon A n alkion summana. (Alkioiden ei välttämättä tarvitse olla erisuuria.) Tehtävä Määritellään funktio f : (0, 1) (0, 1) asettamalla { x + 1, x < 1 f(x) = x, x 1 Olkoot a 0 ja b 0 kaksi reaalilukua, joille 0 < a 0 < b 0 < 1. Määritellään jonot a n ja b n asettamalla a n = f(a n 1 ) ja b n = f(b n 1 ) kaikille n = 1,, 3,.... Osoita, että on olemassa positiivinen kokonaisluku n, jolle (a n a n 1 ) (b n b n 1 ) < 0. Tehtävä 3 Oletetaan, että teräväkärkisessä kolmiossa ABC pätee AB > BC. Olkoon Ω kolmion ABC ympäripiirretty ympyrä, ja olkoon O ympyrän Ω keskipiste. Kulman ABC kulmanpuolittaja leikkaa ympyrän Ω pisteessä M B. Olkoon Γ se ympyrä, jonka eräs halkaisija on BM. Kulman AOB puolittaja leikkaa ympyrää Γ pisteessä P, ja kulman BOC puolittaja leikkaa ympyrää Γ pisteessä Q. Suoralta P Q on valittu piste R siten, että BR = MR. Osoita, että BR AC. (Tässä oletamme aina, että kulmanpuolittaja on puolisuora.) 1

2 Solution to problem 1 Answer: M n = (n ) n + 1. Part 1. First we prove that every integer greater than (n ) n +1 can be represented as such a sum. This is achieved by induction on n. For n =, the set A n = {, 3}. Every positive integer m except 1 can be represented as a sum of elements of A n : as m = if m is even, and as m = if m is odd. Now consider some n > and assume the induction hypothesis holds for n 1. Take an integer m > (n ) n + 1. If m is even, then Hence by the induction hypothesis m > (n )n 1 > ((n 1) ) n m = (n 1 k 1 ) + ( n 1 k ) + + ( n 1 kr ) for some k i, with 0 k i < n 1. It follows that m = ( n k 1+1 ) + ( n k +1 ) + + ( n kr+1 ), giving us the desired representation as a sum of elements of A n. If m is odd, we consider m ( n 1) > (n )n + 1 ( n 1) = (n 3) n By the induction hypothesis there is a representation of the form m ( n 1) = ( n 1 k 1 ) + ( n 1 k ) + + ( n 1 kr ) for some k i, with 0 k i < n 1. It follows that m = ( n k 1+1 ) + ( n k +1 ) + + ( n kr+1 ) + ( n 1), giving us the desired representation of m once again. Part. It remains to prove that there is no representation of M n = (n ) n + 1. Let N be the smallest positive integer that satisfies N 1 (mod n ), and which can be represented as a sum of elements of A n. Consider the representation of N, i.e. N = ( n k 1 ) + ( n k ) + + ( n kr ), where 0 k 1, k,..., k r < n. If k i = k j = n 1, then we can simply remove these two terms from the sum to get a representation for N ( n n 1 ) = N n as a sum

3 of elements of A n, which contradicts our choice of N. If k i = k j = k < n 1, replace the two terms by n k+1, which is also an element of A n, to get a representation for N ( n k )+ n k+1 = N n. This is a contradiction once again. Therefor, all k i have to be distinct, which means that k 1 + k + + kr n 1 = n 1. On the other hand ( ) k 1 + k + + kr ( n k 1 )+( n k )+ +( n kr ) = N 1 (mod n ) Thus we must have k 1 + k + + kr = n 1, which is only possible if each element of {0, 1,,..., n 1} occurs as one of the k i. This gives us N = n n ( n 1 ) = (n 1) n + 1. In particular this means that (n ) n +1 cannot be represented as a sum of elements of A n. 3

4 Solution to problem Note that f(x) x = 1 > 0 if x < 1 f(x) x = x x < 0 if x 1. We consider the interval (0, 1) divided into the two subintervals I 1 I = [ 1, 1). The inequality = (0, 1 ) and 0 > (a n a n 1 ) (b n b n 1 ) = (f(a n 1 ) a n 1 )(f(b n 1 b n 1 ) holds if and only if a n 1 and b n 1 lie in distinct subintervals. Let us now assume, to the contrary, that a k and b k always lie in the same subinterval. Consider the distance d k = a k b k. If both a k and b k lie in I 1, then d k+1 = a k+1 b k+1 = a k + 1 ( b k + 1 ) = dk. If, on the other hand, a k and b k both lie in I, then a k + b k d k = 1 + d k, which implies d k+1 = a k+1 b k+1 = a k b k = (a k b k )(a k + b k ) d k (1 + d k ). This means that the difference d k is non-decreasing, and particular d k d 0 > 0 for all k. If a k and b k lie in I, then d k+ d k+1 d k (1 + d k ) d k (1 + d 0 ). If a k and b k lie in I 1, then a k+1 and b k+1 both lie in I, and so we have d k+ d k+1 (1 + d k+1 ) d k+1 (1 + d 0 ) d k (1 + d 0 ). In either case, d k+ d k (1 + d 0 ), and inductively we get d m d 0 (1 + d 0 ) m. For sufficiently large m, the right-hand side is greater than 1, a contradiction. Thus there must be a positive integer n such that a n 1 and b n 1 do not lie in the same subinterval, which proves the desired statement. 4

5 Solution to problem 3 Let K be the midpoint of BC, i.e. the centre of Γ. Notice that AB BC implies that K O. Clearly the lines OM and OK are perpendicular bisectors of AC and BM, respectively. Therefore, R is the intersection point of P Q and OK. Let N be the second point of intersection of Γ with the line OM. Hence BN AC, and it suffices to prove that BN passes trough R. Our plan for doing this is to interpret the lines BN, OK and P Q as the radical axes of three appropriate circles. Let ω be the circle with diameter BO. Since BNO = BKO = 90, the points N and K lie on ω. Next we show that the points O, K, P, and Q are concyclic. To this end, let D and E be the midpoints of BC and AB, respectively. By our assumption of triangle ABC, the points B, E, O, K, and D lie on ω is this order. It follows that EOR = EBK = KBD = KOD, so the line KO externally bisects the angle P OQ. Since the point K is the centre of Γ, it also lies on the perpendicular bisector of P Q. So K coincides with the midpoint of the arc P OQ of the circumcircle γ of triangle P OQ. Thus the lines OK, BN, and P Q are pairwise radical axis of the circles ω, γ and Γ. Hence they are concurrent at R, as required. R P N B γ E D Q Ω A O K ω C Γ M 5

Capacity Utilization

Capacity Utilization Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run


The CCR Model and Production Correspondence

The CCR Model and Production Correspondence The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls


Bounds on non-surjective cellular automata

Bounds on non-surjective cellular automata Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective


1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.

1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The


Efficiency change over time

Efficiency change over time Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel


4x4cup Rastikuvien tulkinta

4x4cup Rastikuvien tulkinta 4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,


anna minun kertoa let me tell you

anna minun kertoa let me tell you anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta


On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs


Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)

Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen


16. Allocation Models

16. Allocation Models 16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue


Huom. tämä kulma on yhtä suuri kuin ohjauskulman muutos. lasketaan ajoneuvon keskipisteen ympyräkaaren jänteen pituus

Huom. tämä kulma on yhtä suuri kuin ohjauskulman muutos. lasketaan ajoneuvon keskipisteen ympyräkaaren jänteen pituus AS-84.327 Paikannus- ja navigointimenetelmät Ratkaisut 2.. a) Kun kuvan ajoneuvon kumpaakin pyörää pyöritetään tasaisella nopeudella, ajoneuvon rata on ympyränkaaren segmentin muotoinen. Hitaammin kulkeva


2 1/ /2 ; (a) Todista, että deg P (x)q(x) = deg P (x) + deg Q(x). (b) Osoita, että jos nolla-polynomille pätisi. deg 0(x) Z, Z 10 ; Z 10 [x];

2 1/ /2 ; (a) Todista, että deg P (x)q(x) = deg P (x) + deg Q(x). (b) Osoita, että jos nolla-polynomille pätisi. deg 0(x) Z, Z 10 ; Z 10 [x]; 802656S ALGEBRALLISET LUVUT Harjoituksia 2017 1. Näytä, että (a) (b) (c) (d) (e) 2 1/2, 3 1/2, 2 1/3 ; 2 1/2 + 3 1/2 ; 2 1/3 + 3 1/2 ; e iπ/m, m Z \ {0}; sin(π/m), cos(π/m), tan(π/m), m Z \ {0}; ovat algebrallisia


Counting quantities 1-3

Counting quantities 1-3 Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X. Rastita Tick (X) (X) the kummassa box that has laatikossa


Alternative DEA Models

Alternative DEA Models Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex


Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu

Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be


Results on the new polydrug use questions in the Finnish TDI data

Results on the new polydrug use questions in the Finnish TDI data Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen


MRI-sovellukset. Ryhmän 6 LH:t (8.22 & 9.25)

MRI-sovellukset. Ryhmän 6 LH:t (8.22 & 9.25) MRI-sovellukset Ryhmän 6 LH:t (8.22 & 9.25) Ex. 8.22 Ex. 8.22 a) What kind of image artifact is present in image (b) Answer: The artifact in the image is aliasing artifact (phase aliasing) b) How did Joe


Choose Finland-Helsinki Valitse Finland-Helsinki

Choose Finland-Helsinki Valitse Finland-Helsinki Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun


On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs


make and make and make ThinkMath 2017

make and make and make ThinkMath 2017 Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus


A DEA Game II. Juha Saloheimo S ysteemianalyysin. Laboratorio. Teknillinen korkeakoulu

A DEA Game II. Juha Saloheimo S ysteemianalyysin. Laboratorio. Teknillinen korkeakoulu A DEA Game II Juha Salohemo 12.12.2007 Content Recap of the Example The Shapley Value Margnal Contrbuton, Ordered Coaltons, Soluton to the Example DEA Mn Game Summary Home Assgnment Recap of the Example


Toppila/Kivistö 10.01.2013 Vastaa kaikkin neljään tehtävään, jotka kukin arvostellaan asteikolla 0-6 pistettä.

Toppila/Kivistö 10.01.2013 Vastaa kaikkin neljään tehtävään, jotka kukin arvostellaan asteikolla 0-6 pistettä. ..23 Vastaa kaikkin neljään tehtävään, jotka kukin arvostellaan asteikolla -6 pistettä. Tehtävä Ovatko seuraavat väittämät oikein vai väärin? Perustele vastauksesi. (a) Lineaarisen kokonaislukutehtävän


Exercise 1. (session: )

Exercise 1. (session: ) EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You


Akateemiset fraasit Tekstiosa

Akateemiset fraasit Tekstiosa - Väitteen hyväksyminen Broadly speaking, I agree with because Samaa mieltä jostakin näkökulmasta One is very much inclined to agree with because Samaa mieltä jostakin näkökulmasta Yleisesti ottaen olen


Operatioanalyysi 2011, Harjoitus 4, viikko 40

Operatioanalyysi 2011, Harjoitus 4, viikko 40 Operatioanalyysi 2011, Harjoitus 4, viikko 40 H4t1, Exercise 4.2. H4t2, Exercise 4.3. H4t3, Exercise 4.4. H4t4, Exercise 4.5. H4t5, Exercise 4.6. (Exercise 4.2.) 1 4.2. Solve the LP max z = x 1 + 2x 2


4x4cup Rastikuvien tulkinta. 4x4cup Control point picture guidelines

4x4cup Rastikuvien tulkinta. 4x4cup Control point picture guidelines 4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen, että rastikuvissa näkyy selvästi että kilpailija koskee


FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL

FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...





Counting quantities 1-3

Counting quantities 1-3 Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X 2. Rastita Tick (X) (X) the kummassa box that has


Other approaches to restrict multipliers

Other approaches to restrict multipliers Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of


A DEA Game I Chapters

A DEA Game I Chapters A DEA Game I Chapters 5.-5.3 Saara Tuurala 2.2.2007 Agenda Introducton General Formulaton Assumpton on the Game and Far Dvson Coalton and Characterstc Functon Summary Home Assgnment Introducton /5 A DEA


Kvanttilaskenta - 1. tehtävät

Kvanttilaskenta - 1. tehtävät Kvanttilaskenta -. tehtävät Johannes Verwijnen January 9, 0 edx-tehtävät Vastauksissa on käytetty edx-kurssin materiaalia.. Problem False, sillä 0 0. Problem False, sillä 0 0 0 0. Problem A quantum state


National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007

National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its


Kansainväliset matematiikkaolympialaiset 2012

Kansainväliset matematiikkaolympialaiset 2012 Kansainväliset matematiikkaolympialaiset 01 Tehtävien ratkaisuja 1. Olkoot kolmion kulmat α, β ja γ ja olkoon ω ympyrä, jonka halkaisija on AJ. Koska kulmat JKA ja JLA ovat suoria, niin K ja L ovat tällä


Kvanttilaskenta - 2. tehtävät

Kvanttilaskenta - 2. tehtävät Kvanttilaskenta -. tehtävät Johannes Verwijnen January 8, 05 edx-tehtävät Vastauksissa on käytetty edx-kurssin materiaalia.. Problem The inner product of + and is. Edelleen false, kts. viikon tehtävä 6..


Guidebook for Multicultural TUT Users

Guidebook for Multicultural TUT Users 1 Guidebook for Multicultural TUT Users WORKPLACE PIRKANMAA-hankkeen KESKUSTELUTILAISUUS 16.12.2010 Hyvää käytäntöä kehittämässä - vuorovaikutusopas kansainvälisille opiskelijoille TTY Teknis-taloudellinen


812336A C++ -kielen perusteet, 21.8.2010

812336A C++ -kielen perusteet, 21.8.2010 812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys


Tietorakenteet ja algoritmit

Tietorakenteet ja algoritmit Tietorakenteet ja algoritmit Taulukon edut Taulukon haitat Taulukon haittojen välttäminen Dynaamisesti linkattu lista Linkatun listan solmun määrittelytavat Lineaarisen listan toteutus dynaamisesti linkattuna


1. Liikkuvat määreet

1. Liikkuvat määreet 1. Liikkuvat määreet Väitelauseen perussanajärjestys: SPOTPA (subj. + pred. + obj. + tapa + paikka + aika) Suora sanajärjestys = subjekti on ennen predikaattia tekijä tekeminen Alasääntö 1: Liikkuvat määreet



S SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA S-55.00 SÄHKÖTKNKKA JA LKTONKKA. välikoe 3.0.2006. Saat vastata vain neljään tehtävään!. Laske jännite U. = =4Ω, 3 =2Ω, = =2V, J =2A, J 2 =3A + J 2 + J 3 2. Kondensaattori on aluksi varautunut jännitteeseen


Mat Seminar on Optimization. Data Envelopment Analysis. Economies of Scope S ysteemianalyysin. Laboratorio. Teknillinen korkeakoulu

Mat Seminar on Optimization. Data Envelopment Analysis. Economies of Scope S ysteemianalyysin. Laboratorio. Teknillinen korkeakoulu Mat-2.4142 Seminar on Optimization Data Envelopment Analysis Economies of Scope 21.11.2007 Economies of Scope Introduced 1982 by Panzar and Willing Support decisions like: Should a firm... Produce a variety


Kansainväliset matematiikkaolympialaiset 2008

Kansainväliset matematiikkaolympialaiset 2008 Kansainväliset matematiikkaolympialaiset 2008 Tehtävät ja ratkaisuhahmotelmat 1. Teräväkulmaisen kolmion ABC korkeusjanojen leikkauspiste on H. Pisteen H kautta kulkeva ympyrä, jonka keskipiste on sivun


Topologies on pseudoinnite paths

Topologies on pseudoinnite paths Topologies on pseudoinnite paths Andrey Kudinov Institute for Information Transmission Problems, Moscow National Research University Higher School of Economics, Moscow Moscow Institute of Physics and Technology


On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs


Network to Get Work. Tehtäviä opiskelijoille Assignments for students.

Network to Get Work. Tehtäviä opiskelijoille Assignments for students. Network to Get Work Tehtäviä opiskelijoille Assignments for students Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi


27. 10. joissa on 0 4 oikeata vastausta. Laskimet eivät ole sallittuja.

27. 10. joissa on 0 4 oikeata vastausta. Laskimet eivät ole sallittuja. ÄÙ ÓÒÑ Ø Ñ Ø ÐÔ ÐÙÒ Ð Ù ÐÔ ÐÙÒÔ ÖÙ Ö Tehtäviä on kahdella sivulla; kuusi ensimmäistä tehtävää on monivalintatehtäviä, joissa on 0 4 oikeata vastausta. Laskimet eivät ole sallittuja. 1. Hiiri juoksee tasaisella


C++11 seminaari, kevät Johannes Koskinen

C++11 seminaari, kevät Johannes Koskinen C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,


VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto

VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto Tämän viestinnän, nykysuomen ja englannin kandidaattiohjelman valintakokeen avulla Arvioidaan viestintävalmiuksia,


Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto

Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto If you are searched for a book by Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice over LTE (VoLTE) in pdf form, then you have come



MUSEOT KULTTUURIPALVELUINA Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina


Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä

Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä M a t t i K a t t a i n e n O T M 1 1. 0 9. 2 0 1 9 Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä Ympäristöoikeustieteen


Salasanan vaihto uuteen / How to change password

Salasanan vaihto uuteen / How to change password Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change



***** O CALCULATORS I THIS ROU D ***** CO TEST 3 DECEMBER 009 ROU D 1 TRIG: RIGHT A GLE PROBLEMS, LAWS OF SI ES A D COSI ES ***** O CALCULATORS I THIS ROU D ***** A SWERS A) B) C) A) From point A on a river bank, the distance to a tree on the



21~--~--~r--1~~--~--~~r--1~ - K.Loberg FYSE420 DIGITAL ELECTRONICS 13.05.2011 1. Toteuta alla esitetyn sekvenssin tuottava asynkroninen pun. Anna heratefunktiot, siirtotaulukko ja kokonaistilataulukko ( exitation functions, transition


Matematiikan olympiavalmennus

Matematiikan olympiavalmennus Matematiikan olympiavalmennus Syyskuun 2014 vaativammat valmennustehtävät, ratkaisuja 1. Onko olemassa ehdot a + b + c = d ja 1 ab + 1 ac + 1 bc = 1 ad + 1 bd + 1 cd toteuttavia reaalilukuja a, b, c, d?


52. Kansainväliset matematiikkaolympialaiset

52. Kansainväliset matematiikkaolympialaiset 52. Kansainväliset matematiikkaolympialaiset Tehtävien ratkaisuja Tehtävä 1.Olkoon A = {a 1,a 2,a 3,a 4 } joukko, jonka alkioina on neljä eri suurta positiivista kokonaislukua. Joukon alkioiden summaa


Rekisteröiminen - FAQ

Rekisteröiminen - FAQ Rekisteröiminen - FAQ Miten Akun/laturin rekisteröiminen tehdään Akun/laturin rekisteröiminen tapahtuu samalla tavalla kuin nykyinen takuurekisteröityminen koneille. Nykyistä tietokantaa on muokattu niin,


Lukion matematiikkakilpailun alkukilpailu 2015

Lukion matematiikkakilpailun alkukilpailu 2015 Lukion matematiikkakilpailun alkukilpailu 015 Avoimen sarjan tehtävät ja niiden ratkaisuja 1. Olkoot a ja b peräkkäisiä kokonaislukuja, c = ab ja d = a + b + c. a) Osoita, että d on kokonaisluku. b) Mitä


Information on preparing Presentation

Information on preparing Presentation Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals


KMTK lentoestetyöpaja - Osa 2

KMTK lentoestetyöpaja - Osa 2 KMTK lentoestetyöpaja - Osa 2 Veijo Pätynen 18.10.2016 Pasila YHTEISTYÖSSÄ: Ilmailun paikkatiedon hallintamalli Ilmailun paikkatiedon hallintamalli (v0.9 4.3.2016) 4.4 Maanmittauslaitoksen rooli ja vastuut...



KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely



EUROOPAN PARLAMENTTI EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston


Ratkaisut vuosien tehtäviin

Ratkaisut vuosien tehtäviin Ratkaisut vuosien 1978 1987 tehtäviin Kaikki tehtävät ovat pitkän matematiikan kokeista. Eräissä tehtävissä on kaksi alakohtaa; ne olivat kokelaalle vaihtoehtoisia. 1978 Osoita, ettei mikään käyrän y 2


Teknillinen tiedekunta, matematiikan jaos Numeeriset menetelmät

Teknillinen tiedekunta, matematiikan jaos Numeeriset menetelmät Numeeriset menetelmät 1. välikoe, 14.2.2009 1. Määrää matriisin 1 1 a 1 3 a a 4 a a 2 1 LU-hajotelma kaikille a R. Ratkaise LU-hajotelmaa käyttäen yhtälöryhmä Ax = b, missä b = [ 1 3 2a 2 a + 3] T. 2.


Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat

Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät


Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies

Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve



ETELÄESPLANADI 2 00130 HELSINKI 00130 HELSINKI MODERNIA TOIMISTOTILAA Noin VUOKRATAAN Ainutlaatuinen tilaisuus vuokrata huipputason Helsingin näköalapaikalta Toimi pian! Lisätietoja KALLE JASKARA Myyntijohtaja +358 50 324 0404



RINNAKKAINEN OHJELMOINTI A, RINNAKKAINEN OHJELMOINTI 815301A, 18.6.2005 1. Vastaa lyhyesti (2p kustakin): a) Mitkä ovat rinnakkaisen ohjelman oikeellisuuskriteerit? b) Mitä tarkoittaa laiska säikeen luominen? c) Mitä ovat kohtaaminen


Statistical design. Tuomas Selander

Statistical design. Tuomas Selander Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis



FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists


Houston Journal of Mathematics. University of Houston Volume, No.,

Houston Journal of Mathematics. University of Houston Volume, No., Houston Journal of Mathematics c University of Houston Volume, No., CONGRUENCE LATTICES OF UNIFORM LATTICES G. GRÄTZER, E. T. SCHMIDT, AND K. THOMSEN Abstract. A lattice L is uniform, if for any congruence


x = y x i = y i i = 1, 2; x + y = (x 1 + y 1, x 2 + y 2 ); x y = (x 1 y 1, x 2 + y 2 );

x = y x i = y i i = 1, 2; x + y = (x 1 + y 1, x 2 + y 2 ); x y = (x 1 y 1, x 2 + y 2 ); LINEAARIALGEBRA Harjoituksia/Exercises 2017 1. Olkoon n Z +. Osoita, että (R n, +, ) on lineaariavaruus, kun vektoreiden x = (x 1,..., x n ), y = (y 1,..., y n ) identtisyys, yhteenlasku ja reaaliluvulla


Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site

Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site Note! Before starting download and install a fresh version of OfficeProfessionalPlus_x64_en-us. The instructions are in the beginning of the exercise.


Capacity utilization

Capacity utilization Mat-2.4142 Seminar on optimization Capacity utilization 12.12.2007 Contents Summary of chapter 14 Related DEA-solver models Illustrative examples Measure of technical capacity utilization Price-based measure



TM ETRS-TM35FIN-ETRS89 WTG SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579



TM ETRS-TM35FIN-ETRS89 WTG SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579


Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies

Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!


Alueellinen yhteistoiminta

Alueellinen yhteistoiminta Alueellinen yhteistoiminta Kokemuksia alueellisesta toiminnasta Tavoitteet ja hyödyt Perusterveydenhuollon yksikön näkökulmasta Matti Rekiaro Ylilääkäri Perusterveydenhuollon ja terveyden edistämisen yksikkö


Algebra I, harjoitus 5,

Algebra I, harjoitus 5, Algebra I, harjoitus 5, 7.-8.10.2014. 1. 2 Osoita väitteet oikeiksi tai vääriksi. a) (R, ) on ryhmä, kun asetetaan a b = 2(a + b) aina, kun a, b R. (Tässä + on reaalilukujen tavallinen yhteenlasku.) b)


Operatioanalyysi 2011, Harjoitus 3, viikko 39

Operatioanalyysi 2011, Harjoitus 3, viikko 39 Operatioanalyysi 2011, Harjoitus 3, viikko 39 H3t1, Exercise 3.1. H3t2, Exercise 3.2. H3t3, Exercise 3.3. H3t4, Exercise 3.4. H3t5 (Exercise 3.1.) 1 3.1. Find the (a) standard form, (b) slack form of the


AS Paikannus- ja navigointimenetelmät

AS Paikannus- ja navigointimenetelmät AS-84.7 Paikannus- ja navigointimenetelmät Ratkaisut. ) Kun tiedetään pelkästään etäisyys tunnetusta kohteesta saadaan mahdollinen olinpaikka ajattua ympyälle, jonka keskipiste on kohteen paikka ja säde


Esimerkkitehtäviä, A-osa

Esimerkkitehtäviä, A-osa Esimerkkitehtäviä, A-osa MAB1, harjaantuu käyttämään matematiikkaa jokapäiväisen elämän ongelmien ratkaisemisessa Jussi myy torilla marjoja. Erään asiakkaan ostokset maksavat 8,65e. Asiakas antaa Jussille


FinFamily Installation and importing data (11.1.2016) FinFamily Asennus / Installation

FinFamily Installation and importing data (11.1.2016) FinFamily Asennus / Installation FinFamily Asennus / Installation 1 Sisällys / Contents FinFamily Asennus / Installation... 1 1. Asennus ja tietojen tuonti / Installation and importing data... 4 1.1. Asenna Java / Install Java... 4 1.2.



S-55.1100 SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA S-55.00 SÄHKÖKNKKA A KONKKA. välikoe 2..2008. Saat vastata vain neljään tehtävään!. aske jännite U. = 4 Ω, 2 = Ω, = Ω, = 2, 2 =, = A, 2 = U 2 2 2 2. ännitelähde tuottaa hetkestä t = t < 0 alkaen kaksiportaisen


Information on Finnish Language Courses Spring Semester 2017 Jenni Laine

Information on Finnish Language Courses Spring Semester 2017 Jenni Laine Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?


Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE

Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE November 7, 2014 Paula Kilpinen 1 7.11.2014 Aalto University



LYTH-CONS CONSISTENCY TRANSMITTER LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are


Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?

Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? 10.10.01 Tuomo Suortti Ohjelman päällikkö Riina Antikainen Ohjelman koordinaattori 10/11/01 Tilaisuuden teema Kansainvälistymiseen


OP1. PreDP StudyPlan

OP1. PreDP StudyPlan OP1 PreDP StudyPlan PreDP The preparatory year classes are in accordance with the Finnish national curriculum, with the distinction that most of the compulsory courses are taught in English to familiarize


Curriculum. Gym card

Curriculum. Gym card A new school year Curriculum Fast Track Final Grading Gym card TET A new school year Work Ethic Detention Own work Organisation and independence Wilma TMU Support Services Well-Being CURRICULUM FAST TRACK



S SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA S-55. SÄHKÖTKNIIKKA JA LKTONIIKKA 2. välikoe.2.22. Saat vastata vain neljään tehtävään! Sallitut: Kako, [r.] laskin, [MAOL], [sanakirjan käytöstä sovittava valvojan kanssa!]. Laske jännite. = V, = 2 Ω,


tgg agg Supplementary Figure S1.

tgg agg Supplementary Figure S1. ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt


Olet vastuussa osaamisestasi

Olet vastuussa osaamisestasi Olet vastuussa osaamisestasi Ohjelmistoammattilaisuuden uudet haasteet Timo Vehmaro 02-12-2015 1 Nokia 2015 Mitä osaamista tulevaisuudessa tarvitaan? Vahva perusosaaminen on kaiken perusta Implementaatio


A: What s wrong? A aloittaa. Kuuntele ja auta tarvittaessa. Parisi auttaa tarvittaessa. Sinä aloitat. Sano vuorosanasi englanniksi.

A: What s wrong? A aloittaa. Kuuntele ja auta tarvittaessa. Parisi auttaa tarvittaessa. Sinä aloitat. Sano vuorosanasi englanniksi. High five! 4 Chapter 4 Down by the river LIITE 6a Työpistetyöskentely Piste 1 1 Valitse parisi kanssa kappaleiden 1 3 teksteistä yksi ja lukekaa se ääneen englanniksi 2 Tee alla oleva tehtävä parisi kanssa


Expression of interest

Expression of interest Expression of interest Avoin hakemus tohtorikoulutettavaksi käytäntö Miksi? Dear Ms. Terhi virkki-hatakka I am writing to introduce myself as a volunteer who have the eagerness to study in your university.


Matematiikan olympiavalmennus 2015 helmikuun helpommat

Matematiikan olympiavalmennus 2015 helmikuun helpommat Matematiikan olympiavalmennus 05 helmikuun helpommat tehtävät Ratkaisuja. Määritä kolmiot, joiden kulmille α, β, γ pätee cos α cos β +sinαsin β sin γ =. Ratkaisu. Koska 0 < sin γ, täytyy olla cos(α β)


Small Number Counts to 100. Story transcript: English and Blackfoot

Small Number Counts to 100. Story transcript: English and Blackfoot Small Number Counts to 100. Story transcript: English and Blackfoot Small Number is a 5 year-old boy who gets into a lot of mischief. He lives with his Grandma and Grandpa, who patiently put up with his


Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition)

Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Uusi Ajatus Löytyy



AYYE 9/ HOUSING POLICY AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we


joissa on 0 4 oikeata vastausta. Laskimet eivät ole sallittuja.

joissa on 0 4 oikeata vastausta. Laskimet eivät ole sallittuja. ÄÙ ÓÒ Ñ Ø Ñ Ø ÐÔ ÐÙÒ Ð Ù ÐÔ ÐÙÒ Ô ÖÙ Ö Tehtäviä on kahdella sivulla; kuusi ensimmäistä tehtävää on monivalintatehtäviä, joissa on 0 4 oikeata vastausta. Laskimet eivät ole sallittuja. 1. Kauppias on ostanut
