Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks. David R. Kelley
|
|
- Hilja Pääkkönen
- 4 vuotta sitten
- Katselukertoja:
Transkriptio
1 Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks David R. Kelley
2 DNA codes for complex life. How? Kundaje et al. Integrative analysis of 111 reference human epigenomes. Nature, 2015.
3 Noncoding DNA determines gene expression Transcription Factors. Kelvin Song. CC BY 3.0
4 We can t read noncoding DNA TAGTAAAAAAACAACAAAAGACTTTTTCTGACAGTATGATTTACATAACTA CATTTTCATTACTTTTATTTTTCTACATAACTAGTGTCTTTTCAGTTGCAA ATGTTTGACATTCTGACAAGTAGTGTGGCAGAGTCTTAGATTATAGGTTGC ATTTAGCCAAAAGAAAGACTTCGAATGGAATTTTTTTCTATTGACACACTT TCTAACAACATACTTATTTTCTAAAAAGGTTTTTATAACTTAGTGTTGATA ATATCAAAATGCTAAGCAATTTTGCTTAAAAAGCGTAGAACACCAATATTT AATGAAGATTAATTAAATAGCACACATTGATTACTTGTTTAAAAATATTCG GAAAAGTTTTGACACATGCTAAAGTGCTGAAGTAGGATTTTGGCCTTCCAT AAAAATAATATATTGTGCATAAATGGATGCAGAATGAAGAAAGCAATGGGG
5 Reading noncoding DNA would transform variant interpretation
6 DNaseI hypersensitivity KLF4 20 kb Boyle et al. High-resolution mapping and characterization of open chromatin across the genome. Cell, 2008.
7 Is this sequence accessible? TAGTAAAAAAACAACAAAAGACTTTTTCTGACAGTATGATTTACATAACTA CATTTTCATTACTTTTATTTTTCTACATAACTAGTGTCTTTTCAGTTGCAA ATGTTTGACATTCTGACAAGTAGTGTGGCAGAGTCTTAGATTATAGGTTGC ATTTAGCCAAAAGAAAGACTTCGAATGGAATTTTTTTCTATTGACACACTT TCTAACAACATACTTATTTTCTAAAAAGGTTTTTATAACTTAGTGTTGATA ATATCAAAATGCTAAGCAATTTTGCTTAAAAAGCGTAGAACACCAATATTT AATGAAGATTAATTAAATAGCACACATTGATTACTTGTTTAAAAATATTCG GAAAAGTTTTGACACATGCTAAAGTGCTGAAGTAGGATTTTGGCCTTCCAT AAAAATAATATATTGTGCATAAATGGATGCAGAATGAAGAAAGCAATGGGG
8 Learning DNA sequence activity ACGTGATTACAACGT 1 ATTTAGCCAAAAGAA 1 AGACTTCGAATGGAA 0 TTTTTTTCTATTGAC 0 ACACTTTCTAACAAC 0 ATACTTATTTTCTAA 1 AAAGGTTTTTATAAC 0 TTAGTGTTGATAATA 0
9 Sequence representation ACGTGATTACAACGT
10 Sequence representation ACGTGATTACAACGT ACGT 1
11 Sequence representation ACGTGATTACAACGT ACGT 1 CGTG 1
12 Sequence representation With big data & big computers, Can we learn better representations? ACGTGATTACAACGT AACG 1 ACAA 1 ACGT 2 ATTA 1 CAAC 1 CGTG 1 GATT 1 GTGA 1 TACA 1 TGAT 1 TTAC 1 0 Learning Algorithm
13 Artificial neural networks
14 Convolutional neural network
15 Convolutional neural network Zeiler, Fergus. Visualizing and understanding convolutional networks. ECCV 2014.
16 Convolutional neural network Zeiler, Fergus. Visualizing and understanding convolutional networks. ECCV 2014.
17 Convolutional neural network Zeiler, Fergus. Visualizing and understanding convolutional networks. ECCV 2014.
18 Convolutional neural network Zeiler, Fergus. Visualizing and understanding convolutional networks. ECCV 2014.
19 DNA convolutional neural network A C G T
20 DNA convolutional neural network A C G T
21 DNA convolutional neural network A C G T
22 DNA convolutional neural network A C G T
23 DNA convolutional neural network A C G T
24 DNA convolutional neural network A C G T
25 DNA convolutional neural network
26 Basset
27 Learning the accessibility code DNaseI hypersensitivity sites DNaseI-seq from 164 cell types from ENCODE and Epigenomics Roadmap. Cells 2 million sites broken into training, validation, and test sets.
28 Convolutional nets accurately predict accessibility 1.0 True positive rate PanIslets AUC: HUVEC AUC: CLL AUC: HRE AUC: HPF AUC: False positive rate Basset AUC mean AUC mean AUC gkm-svm AUC Ghandi, Lee et al. Enhanced Regulatory Sequence Prediction Using Gapped k-mer Features. PLoS Comp Bio, 2014.
29 Filters recapitulate known protein binding motifs
30 Filters recapitulate known protein binding motifs
31 Multiple filters capture motif variants
32 Filter influence reflects cell specificity
33 Annotate nucleotide influence mb mb mb mb JUN ChIP-seq DNaseI-seq JUND ChIP-seq CAGCCTTTGTTAATGGGGACACAATCCTGGAAATTTTGCCTGTGTGTAAACCTCTAGGGGCTTTTTCTTTCATCGTTTTACATCAGCCAGACTCTGACTCACAGCTGGAGAATCAGCTTCCTTATTATGTAGCGAATTCCATGAACACAC PhyloP
34 Case study: vitiligo - rs
35 Case study: vitiligo - rs Jin et al. Genome-wide associate analyses identify 13 new susceptibility loci for generalized vitiligo. Nat Genetics, 2012.
36 Predictive of causal disease SNPs
37 CTCF ChIP-seq shows allele-specific rs binding
38 Can we easily add new datasets? SNP interpretation requires relevant cell types. 1. Seed a new model with pretrained parameters. 2. Chop off the final model layer. 3. Train one pass (to avoid overfitting).
39 Large-scale public data informs new dataset learning
40 Basset Published in Advance May 3, 2016, doi: /gr
41 Summary Deep convolutional neural networks predict DNaseI hypersensitivity far beyond previous algorithms. ChIP-seq peaks work great, too. Accurate models enable nucleotide-resolution genome annotation. Such models show great promise for interpreting noncoding variants.
42 Acknowledgments Jasper Snoek John Rinn Research was supported by NIEHS of the National Institutes of Health under K25 award ES
Computational personal genomics: selection, regulation, epigenomics, disease
Computational personal genomics: selection, regulation, epigenomics, disease Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory TATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA
LisätiedotGenomic and epigenomic signatures for interpreting complex disease
Genomic and epigenomic signatures for interpreting complex disease Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory TATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA
LisätiedotFunctional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
LisätiedotExperimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
LisätiedotGap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
LisätiedotEfficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
LisätiedotState of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
LisätiedotChapter 7. Motif finding (week 11) Chapter 8. Sequence binning (week 11)
Course organization Introduction ( Week 1) Part I: Algorithms for Sequence Analysis (Week 1-11) Chapter 1-3, Models and theories» Probability theory and Statistics (Week 2)» Algorithm complexity analysis
LisätiedotBioinformatics in Laboratory of Computer and Information Science
HELSINKI UNIVERSITY OF TECHNOLOGY LABORATORY OF COMPUTER AND INFORMATION SCIENCE Bioinformatics in Laboratory of Computer and Information Science Samuel Kaski Research Two centers of excellence of the
LisätiedotInferring Trichoderma reesei gene regulatory network
Inferring Trichoderma reesei gene regulatory network Oskari Vinko 29.04.2013 Ohjaaja: Merja Oja Valvoja: Harri Ehtamo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta osin
LisätiedotSupplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
LisätiedotReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel. Kalle Lehto, Aalto-yliopisto 5.5.
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel Kalle Lehto, Aalto-yliopisto 5.5.2011 Otaniemi ReFuel a three year research project (2009-2011) goal utilize the
LisätiedotPlasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
LisätiedotReturns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
LisätiedotThis notice in TED website:
1 / 6 This notice in TED website: http://ted.europa.eu/udl?uri=ted:notice:408042-2017:text:en:html -Vantaa: Health and social work services 2017/S 198-408042 Social and other specific services public contracts
LisätiedotCapacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
Lisätiedottgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
Lisätiedot7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
LisätiedotCapacity utilization
Mat-2.4142 Seminar on optimization Capacity utilization 12.12.2007 Contents Summary of chapter 14 Related DEA-solver models Illustrative examples Measure of technical capacity utilization Price-based measure
Lisätiedotlpar1 IPB004065, IPB002277, and IPB Restriction Enyzme Differences from REBASE Gained in Variant Lost from Reference
lpar1 IPB465, IPB2277, and IPB5385 Genomic Sequence Coding Sequence For help interpreting these results, view the PARSENP Introduction page. # View On Sequence Nucleotide Change Effect Restriction Enyzme
Lisätiedot16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
LisätiedotEukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
LisätiedotECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä
LisätiedotChapter 9 Motif finding. Chaochun Wei Spring 2019
1896 1920 1987 2006 Chapter 9 Motif finding Chaochun Wei Spring 2019 Contents 1. Reading materials 2. Sequence structure modeling Motif finding Regulatory module finding 2 Reading materials Tompa et al
LisätiedotHelsinki, Turku and WMT
Helsinki, Turku and Uppsala @ WMT Jörg Tiedemann & Robert Östling, University of Helsinki Fabienne Cap & Sara Stymne, Uppsala University Filip Ginter & Jenna Kanerva, University of Turku Factored Phrase-Based
LisätiedotInformation on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
LisätiedotProAgria. Opportunities For Success
ProAgria Opportunities For Success Association of ProAgria Centres and ProAgria Centres 11 regional Finnish ProAgria Centres offer their members Leadership-, planning-, monitoring-, development- and consulting
LisätiedotCS284A Representations & Algorithms for Molecular Biology. Xiaohui S. Xie University of California, Irvine
CS284A Representations & Algorithms for Molecular Biology Xiaohui S. Xie University of California, Irvine Today s Goals Course information Challenges in computational biology Introduction to molecular
LisätiedotSupporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
LisätiedotViral DNA as a model for coil to globule transition
Viral DNA as a model for coil to globule transition Marina Rossi Lab. of complex fluids and molecular biophysics LITA (Segrate) UNIVERSITA DEGLI STUDI DI MILANO - PhD Workshop October 14 th, 2013 Temperature
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LisätiedotLarge Scale Sequence Analysis with Applications to Genomics
Large Scale Sequence Analysis with Applications to Genomics Gunnar Rätsch, Max Planck Society Tübingen, Germany Talk at CWI, Amsterdam October 23, 2009 Gunnar Rätsch (FML, Tübingen) Large Scale Sequence
LisätiedotGenome 373: Genomic Informatics. Professors Elhanan Borenstein and Jay Shendure
Genome 373: Genomic Informatics Professors Elhanan Borenstein and Jay Shendure Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis
LisätiedotInfrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
LisätiedotEnterprise Architecture TJTSE Yrityksen kokonaisarkkitehtuuri
Enterprise Architecture TJTSE25 2009 Yrityksen kokonaisarkkitehtuuri Jukka (Jups) Heikkilä Professor, IS (ebusiness) Faculty of Information Technology University of Jyväskylä e-mail: jups@cc.jyu.fi tel:
LisätiedotFROM VISION TO CRITERIA: PLANNING SUSTAINABLE TOURISM DESTINATIONS Case Ylläs Lapland
FROM VISION TO CRITERIA: PLANNING SUSTAINABLE TOURISM DESTINATIONS Case Ylläs Lapland Tiina Merikoski, Landscape Architect (M.Sc) Aalto University School of Science and Technology Department of Architecture
LisätiedotUusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen
The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project
LisätiedotThe CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
LisätiedotTUTKIJOIDEN KÄYTTÄMÄT DATAREPOSITORIOT
TUTKIJOIDEN KÄYTTÄMÄT DATAREPOSITORIOT MILDRED projektin kyselytutkimus Helsingin yliopiston tutkijoille kesällä 2016 Alkuperäinen taustakuva: Roche DG, Lanfear R, Binning SA, Haff TM, Schwanz LE, et al.
Lisätiedot7. Product-line architectures
7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software
LisätiedotKysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)
Tilasto T1106120-s2012palaute Kyselyn T1106120+T1106120-s2012palaute yhteenveto: vastauksia (4) Kysymys 1 Degree programme: (4) TIK: TIK 1 25% ************** INF: INF 0 0% EST: EST 0 0% TLT: TLT 0 0% BIO:
LisätiedotWP3 Decision Support Technologies
WP3 Decision Support Technologies 1 WP3 Decision Support Technologies WP Leader: Jarmo Laitinen Proposed budget: 185 000, VTT 100 000, TUT 85 000. WP3 focuses in utilizing decision support technologies
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LisätiedotBLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
LisätiedotSFS/SR315 Tekoäly Tekoälyn standardisointi
SFS/SR315 Tekoäly Tekoälyn standardisointi Meri Seistola Toiminnanjohtaja, Mediakasvatuskeskus Metka ry SR 315 Tekoäly - Puheenjohtaja: Jarkko Vesa 1 SC42 Artificial Intelligence ISO/IEC JTC1 SC42 Artificial
LisätiedotOther approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
LisätiedotNational Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
LisätiedotTilausvahvistus. Anttolan Urheilijat HENNA-RIIKKA HAIKONEN KUMMANNIEMENTIE 5 B RAHULA. Anttolan Urheilijat
7.80.4 Asiakasnumero: 3000359 KALLE MANNINEN KOVASTENLUODONTIE 46 51600 HAUKIVUORI Toimitusosoite: KUMMANNIEMENTIE 5 B 51720 RAHULA Viitteenne: Henna-Riikka Haikonen Viitteemme: Pyry Niemi +358400874498
LisätiedotWAMS 2010,Ylivieska Monitoring service of energy efficiency in housing. 13.10.2010 Jan Nyman, jan.nyman@posintra.fi
WAMS 2010,Ylivieska Monitoring service of energy efficiency in housing 13.10.2010 Jan Nyman, jan.nyman@posintra.fi Background info STOK: development center for technology related to building automation
LisätiedotTESTBED FOR NEXT GENERATION REASEARCH & INNOVATION
PUBLIC-PRIVATE PARTNERSHIPS FOR NEW INNOVATIONS ACADEMIC RESEARCH INDUSTRY + PHARMA R&D SPEND Important decisions in drug discovery The Problem: It difficult to develop novel therapies that differentiate
LisätiedotMaster's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.2017 Life Science Technologies Where Life Sciences meet with Technology
LisätiedotArkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä
Arkkitehtuuritietoisku eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Esikysymys Kuinka moni aikoo suunnitella projektityönsä arkkitehtuurin? Onko tämä arkkitehtuuria?
LisätiedotTutkimus Auria Biopankissa ja tulevaisuuden visiot Samu Kurki, FT, data-analyytikko
AURIA BIOPANKKI Tutkimus Auria Biopankissa ja tulevaisuuden visiot 8.3.2019 Samu Kurki, FT, data-analyytikko www.auria.fi Biopankkiprojektit vuosina 2014-2018 Akateemiset projektit 54% Yritysprojektit
LisätiedotLYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
LisätiedotConstructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
LisätiedotEUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
Lisätiedot11/17/11. Gene Regulation. Gene Regulation. Gene Regulation. Finding Regulatory Motifs in DNA Sequences. Regulatory Proteins
Gene Regulation Finding Regulatory Motifs in DNA Sequences An experiment shows that when X is knocked out, 20 other s are not expressed How can one have such drastic effects? Regulatory Proteins Gene X
LisätiedotVIIKKI BIOCENTER University of Helsinki
VIIKKI BIOCENTER University of Helsinki Biologian DNA koodi ja sen selvittäminen Petri Auvinen DNA Sequencing and Genomics Laboratory Institute of Biotechnology Kuinka solut kehittyivät? Kolmenlaisia soluja
LisätiedotLarge Scale Sequence Analysis with Applications to Genomics
Large Scale Sequence Analysis with Applications to Genomics Gunnar Rätsch, Max Planck Society Tübingen, Germany Talk at CSML, University College London March 18, 2009 Gunnar Rätsch (FML, Tübingen) Large
LisätiedotPYÖRÄILY OSANA HELSINGIN SEUDUN KESTÄVÄÄ KAUPUNKILIIKENNETTÄ
PYÖRÄILY OSANA HELSINGIN SEUDUN KESTÄVÄÄ KAUPUNKILIIKENNETTÄ UUDET AINEISTOT SUUNNITTELUN TUKENA Henrikki Tenkanen Digital Geography Lab Helsingin yliopisto 29.1.2018 DIGITAL GEOGRAPHY LAB Tuuli Toivonen
Lisätiedot100 % Kaisu Keskinen Diat
100 % Kaisu Keskinen Diat 98-103 4-1 Chapter 4: outline 4.1 introduction 4.2 virtual circuit and datagram 4.3 what s inside a router 4.4 IP: Internet Protocol datagram format IPv4 addressing ICMP IPv6
LisätiedotOhjelmointikielet ja -paradigmat 5op. Markus Norrena
Ohjelmointikielet ja -paradigmat 5op Markus Norrena Kotitehtävä 6, toteuttakaa alla olevan luokka ja attribuutit (muuttujat) Kotitehtävä 6, toteuttakaa alla olevan luokka ja attribuutit (muuttujat) Huom!
LisätiedotAKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY VERKOTAN OY VERKOTAN LTD.
T287/M03/2017 Liite 1 / Appendix 1 Sivu / Page 1(5) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY VERKOTAN OY VERKOTAN LTD. Tunnus Code Laboratorio Laboratory Osoite Address www www T287
LisätiedotBig datan hyödyntäminen lääkkeisiin liittyvässä viranomaistyössä Suomessa ja EU:ssa. Vesa Kiviniemi Arviointipäällikkö Fimea
Big datan hyödyntäminen lääkkeisiin liittyvässä viranomaistyössä Suomessa ja EU:ssa Vesa Kiviniemi Arviointipäällikkö Fimea 22.11.2017 Mitä on Big data? Useita määritelmiä, esimerkiksi Big data is data
LisätiedotBiopankit ja Big Data terveydenhuollossa: onko open science magic bullet?
Biopankit ja Big Data terveydenhuollossa: onko open science magic bullet?, LT, tutkimusprofessori Terveyden ja hyvinvoinnin laitos Terveys - osasto Genomiikka ja biomarkkerit - yksikkö markus.perola@thl.fi
Lisätiedot1. Liikkuvat määreet
1. Liikkuvat määreet Väitelauseen perussanajärjestys: SPOTPA (subj. + pred. + obj. + tapa + paikka + aika) Suora sanajärjestys = subjekti on ennen predikaattia tekijä tekeminen Alasääntö 1: Liikkuvat määreet
LisätiedotStatistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
LisätiedotBioinformatics. Sequence Analysis: Part III. Pattern Searching and Gene Finding. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Sequence Analysis: Part III. Pattern Searching and Gene Finding Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18
LisätiedotAvoimen datan liiketoimintamallit. Matti Rossi, Aalto University School of Business
Avoimen datan liiketoimintamallit Matti Rossi, Aalto University School of Business Bio Tietojärjestelmätieteen professori Aalto-Yliopiston kauppakorkeakoulussa Vähemmistöomistaja MetaCase Consulting oy:ssä
LisätiedotKaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä
M a t t i K a t t a i n e n O T M 1 1. 0 9. 2 0 1 9 Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä Ympäristöoikeustieteen
LisätiedotMethods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
LisätiedotTech Conference 28.-29.5.2015. On-Premises Data Mining. Peruskäsitteet. Pekka.Korhonen@sovelto.fi. Sovelto Oyj 28.5.2015.
1 Tech Conference 28.-29.5.2015 On-Premises Data Mining Pekka.Korhonen@sovelto.fi #TechConfFI Peruskäsitteet 2 2 Microsoft BI komponentit Azure Machine Learning Stream Analytics HDInsight DocumentDB Blob/table
LisätiedotJulkaisun laji Opinnäytetyö. Sivumäärä 43
OPINNÄYTETYÖN KUVAILULEHTI Tekijä(t) SUKUNIMI, Etunimi ISOVIITA, Ilari LEHTONEN, Joni PELTOKANGAS, Johanna Työn nimi Julkaisun laji Opinnäytetyö Sivumäärä 43 Luottamuksellisuus ( ) saakka Päivämäärä 12.08.2010
LisätiedotRiitta Kilpeläinen Elia Liitiäinen Belle Selene Xia University of Eastern Finland Department of Forest Sciences Department of Economics and HECER
Riitta Kilpeläinen Elia Liitiäinen Belle Selene Xia University of Eastern Finland Department of Forest Sciences Department of Economics and HECER Suorat oppimistulosten mittaamistavat Suorat mittaamistavat
LisätiedotStormwater filtration unit
Stormwater filtration unit Background, concept and applied design work Olli Hakala 2018 WSP Finland Aalto university Kyttä ym. 2014. Veden äärellä kysely, ENTJUSTESS-hanke. Aalto yliopisto. STORMWATER
LisätiedotPysyvä työkyvyttömyys riskitekijöiden varhainen tunnistaminen: voiko kaksostutkimus antaa uutta tietoa?
Annina Ropponen TerveSuomi-seminaari 24.5.202 Pysyvä työkyvyttömyys riskitekijöiden varhainen tunnistaminen: voiko kaksostutkimus antaa uutta tietoa? Ergonomia ja kaksoset? Pysyvä työkyvyttömyys?? Tutkimusryhmä
LisätiedotStudents Experiences of Workplace Learning Marja Samppala, Med, doctoral student
Students Experiences of Workplace Learning Marja Samppala, Med, doctoral student Research is focused on Students Experiences of Workplace learning (WPL) 09/2014 2 Content Background of the research Theoretical
LisätiedotSupporting information
Supporting information Figure S1. Carotenoid biosynthesis pathway in papaya fruit which is adopted from Blas et al. (2010) (reference 4) and Nisar et al. (2015) (reference 5). Carotenoids are synthesized
LisätiedotKäytännön kokemuksia osallistumisesta EU projekteihin. 7. puiteohjelman uusien hakujen infopäivät 2011
Käytännön kokemuksia osallistumisesta EU projekteihin 7. puiteohjelman uusien hakujen infopäivät 2011 15.3.2010 07.09.2011 Markku Timo Ture Nikkilä T&K yritys, 8 henkilöä Elastopoli Oy PK-yritys, omistajina
LisätiedotKansalaisten näkemykset sekä julkisen liikenteen ja pyöräilyn innovaatiot
Kansalaisten näkemykset sekä julkisen liikenteen ja pyöräilyn innovaatiot Venla Virkamäki Tutkija Suomen ympäristökeskus 27.1.2014 Tulevaisuuden liikenne- ja innovaatiopolitiikka -seminaari FIPTrans kyselytutkimus
LisätiedotStrict singularity of a Volterra-type integral operator on H p
Strict singularity of a Volterra-type integral operator on H p Santeri Miihkinen, University of Helsinki IWOTA St. Louis, 18-22 July 2016 Santeri Miihkinen, University of Helsinki Volterra-type integral
LisätiedotBDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET.
BDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET. Pekka Ollikainen Open Source Microsoft CodePlex bio Verkkosivustovastaava Suomen Sarjakuvaseura
LisätiedotData quality points. ICAR, Berlin,
Data quality points an immediate and motivating supervision tool ICAR, Berlin, 22.5.2014 Association of ProAgria Centres Development project of Milk Recording Project manager, Heli Wahlroos heli.wahlroos@proagria.fi
LisätiedotTekes the Finnish Funding Agency for Technology and Innovation. Copyright Tekes
Tekes the Finnish Funding Agency for Technology and Innovation DM 607668 03-2011 Expertise and networks for innovations Tekes services Funding for innovative R&D and business Networking Finnish and global
Lisätiedot2017/S Contract notice. Supplies
Supplies 153936 2017 25/04/2017 S80 - - Supplies - Contract notice - Open procedure I. II. III. IV. VI. -: Medical equipments, pharmaceuticals and personal care products 2017/S 080-153936 Contract notice
LisätiedotPython Libraries 1 / 14
Python Libraries 1 / 14 Gzip, CSV https://docs.python.org/3/library/gzip.html https://docs.python.org/3/library/csv.html https://daler.github.io/pybedtools/ - PyBed tools http://biopython.org/wiki/gff_parsing
LisätiedotLataa Legislating the blind spot - Nikolas Sellheim. Lataa
Lataa Legislating the blind spot - Nikolas Sellheim Lataa Kirjailija: Nikolas Sellheim ISBN: 9789524849012 Sivumäärä: 292 Formaatti: PDF Tiedoston koko: 22.52 Mb For decades the Canadian seal hunt has
LisätiedotSalasanan vaihto uuteen / How to change password
Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change
LisätiedotLataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli. Lataa
Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli Lataa Kirjailija: Pekka Rapeli ISBN: 9789523022232 Sivumäärä: 173 Formaatti: PDF Tiedoston koko: 11.54 Mb Opioid substitution
LisätiedotVoice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto If you are searched for a book by Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice over LTE (VoLTE) in pdf form, then you have come
LisätiedotVaisala s New Global L ightning Lightning Dataset GLD360
Vaisala s New Global Lightning Dataset GLD360 Vaisala Global Lightning Dataset GLD360 Page 2 / Oct09 / Holle-SW Hydro / Vaisala Schedule GLD360 Validation Applications Demonstration Page 3 / Oct09 / Holle-SW
LisätiedotA new model of regional development work in habilitation of children - Good habilitation in functional networks
A new model of regional development work in habilitation of children - Good habilitation in functional networks Salla Sipari, PhD, Principal Lecturer Helena Launiainen, M.Ed, Manager Helsinki Metropolia
Lisätiedot2D filter. Convolution also extend to the 2D case: In this case, the result pixel is the weighted sum of pixels inside the window.
2D filter Convolution also extend to the 2D case: In this case, the result pixel is the weighted sum of pixels inside the window. Weights h(j, k) 2D filter Also 2D filter has a frequency interpretation.
LisätiedotEpigeneettinen säätely ja genomin leimautuminen. Tiina Immonen BLL Biokemia ja kehitysbiologia
Epigeneettinen säätely ja genomin leimautuminen Tiina Immonen BLL Biokemia ja kehitysbiologia 21.1.2014 Epigeneettinen säätely Epigenetic: may be used for anything to do with development, but nowadays
LisätiedotTietokonearkkitehtuuri 2 TKT-3201 (5 op)
Tietokonearkkitehtuuri 2 (5 op) syksyllä 2012 periodit I & II (viikot 35-41 & 43-49) luennot tiistaisin klo 14-16 (periodi I: sali S4, periodi II: sali TB109) Kurssin tavoite Käydään läpi tietokoneen toimintaa
LisätiedotSuopeuden ainekset. Dos. Ilpo Helén Biomedicine in Society (BitS) Department of Social Reseach
Biomedicine in Society (BitS) Department of Social Reseach Suopeuden ainekset 17.10.2013 1 Suomalaiset ovat suopeita biopankeille Pohjoismainen erityispiirre Mitä suopeus sisältää? Moninaiset yleisöt Laaja
LisätiedotAutomaatiojärjestelmän hankinnassa huomioitavat tietoturva-asiat
Automaatiojärjestelmän hankinnassa huomioitavat tietoturva-asiat Teollisuusautomaation tietoturvaseminaari Purchasing Manager, Hydro Lead Buyer, Industrial Control Systems 1 Agenda / esityksen tavoite
LisätiedotMiten oppimista voi tehostaa?
Miten oppimista voi tehostaa?, PsT, erikoistutkija TIEKE Vaikuta ja vaikutu juhlaseminaari 11.11.2014, Helsinki Virpi.Kalakoski@TTL.FI Oppiminen on vaativaa - tänään ja tulevaisuudessa Ihmisen kyky käsitellä
LisätiedotUUSIA TAPOJA SELVITTÄÄ ONLINE-SUOSION SYITÄ
UUSIA TAPOJA SELVITTÄÄ ONLINE-SUOSION SYITÄ Kompleksisuustieteen mahdollisuudet Presentation Name / Marjoriikka Ylisiurua, Kuluttajatutkimuskeskus 15/11/2018 1 KUKA MARJORIIKKA? Tohtorikoulutettava Helsingin
LisätiedotRANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla
TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua
Lisätiedot