Evolution of Flowering Time in the Tetraploid Capsella bursa-pastoris (Brassicaceae)
|
|
- Kirsi Kahma
- 5 vuotta sitten
- Katselukertoja:
Transkriptio
1 Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 367 Evolution of Flowering Time in the Tetraploid Capsella bursa-pastoris (Brassicaceae) TANJA SLOTTE ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2007 ISSN ISBN urn:nbn:se:uu:diva-8311
2
3 looking carefully, a shepherd s purse is blooming under the fence Bash
4
5 List of papers This thesis is based on the following papers, which are referred to by their Roman numerals: I II III IV V Slotte, T., Ceplitis, A., Neuffer, B., Hurka, H., and M. Lascoux Intrageneric phylogeny of Capsella (Brassicaceae) and the origin of the tetraploid C. bursa-pastoris based on chloroplast and nuclear DNA sequences. American Journal of Botany 93: Slotte, T., Huang, H., Lascoux, M. and A. Ceplitis. Polyploid speciation did not confer instant reproductive isolation in Capsella (Brassicaceae). (Manuscript) Slotte, T., Holm, K., McIntyre, L. M., Lagercrantz, U. and M. Lascoux Differential expression of genes important for adaptation in Capsella bursa-pastoris (Brassicaceae). Plant Physiology 145: Ceplitis, A., Slotte, T., Neuffer, B., Linde, M., Kraft, T, and M. Lascoux. QTL mapping of flowering time using AFLP and candidate gene markers in the tetraploid Capsella bursa-pastoris (Brassicaceae). (Manuscript) Slotte, T., Huang, H., Ceplitis, A., Chen, J., and M. Lascoux. The role of introgressed alleles for flowering time variation in the tetraploid Capsella bursa-pastoris (Brassicaceae). (Manuscript) Papers I and III are reprinted with kind permission from the Botanical Society of America and the American Society for Plant Biology, respectively.
6
7 Contents Introduction...9 Polyploid speciation...9 The model system Capsella...11 Genetic basis of flowering time variation...12 Finding the genes that matter for quantitative variation...13 Aims...16 Specific aims...16 Results and Discussion...17 Polyploid speciation in Capsella...17 Intrageneric phylogeny of Capsella (Paper I)...17 Multiple origins or introgression (Paper II)...20 Genetic basis of flowering time variation in C. bursa-pastoris...23 Differential gene expression and flowering time variation (Paper III) 23 QTL mapping (Paper IV)...25 Association mapping (Paper V)...26 Conclusions...30 Svensk sammanfattning...31 Acknowledgements...33 References...34
8 Abbreviations AFLP cpdna FDR GA ka QTL SNP Amplified fragment length polymorphism Chloroplast DNA False discovery rate Gibberellic acid Years before present, thousands Quantitative trait locus Single nucleotide polymorphism
9 Introduction Natural selection merely modified, while redundancy created The above quote summarizes Ohno s (1970) view of gene duplication as a major source of evolutionary novelty. It has since become clear that gene duplication can play a role in the evolution of new gene function and in speciation. What is less well known is what role gene and genome duplication plays for the evolution of quantitative traits, and whether this could provide an adaptive benefit in polyploids. Up to now, studies of the genetics of quantitative traits in polyploids have mostly been confined to crops. Here, we study the genetic basis of flowering time variation and the evolutionary history of the wild tetraploid crucifer Capsella bursa-pastoris. Almost a century ago, the prominent American geneticist Shull (1929) conducted extensive studies on speciation and genetic variation in C. bursa-pastoris and its relatives. The conceptual and experimental toolbox available today is very different from that available to Shull. However, our aims are similar: to carry genetic analysis beyond the field of domesticated plants and animals into the realm of wild nature. Polyploid speciation Polyploidization, the duplication of entire genomes, is common in flowering plants, where an estimated 47 to 70% of all species have gone through polyploidization at some point in their history (Masterson 1994). Polyploid species include major crops such as wheat, sugarcane, cotton and coffee, to name a few. Even species possessing streamlined genomes such as Arabidopsis thaliana exhibit signs of polyploidy in their genomes (Arabidopsis Genome Initiative 2000; Simillon et al. 2002; Bowers et al. 2003), and the number of such cryptic paleopolyploids can be expected to increase with the rapid increase in whole genome sequences. According to their mode of origin, polyploids can be classified as autopolyploids, which form by genome doubling within a single species, and allopolyploids, which form by interspecific hybridization and genome doubling (Ramsey and Schemske 1998). When orthologous chromosomes from different species come together in one nucleus, as in allopolyploid species, 9
10 these chromosomes are termed homoeologous (or homeologous), and this term can be used for genes or regions on such chromosomes as well (Fig. 1). Figure 1. Modes of polyploid formation (modified from Chen 2007). A. Autopolyploid formation occurs through genome doubling within a species. B. Allopolyploids form by interspecific hybridization and genome doubling. There are several ways for this to occur, e.g. by genome doubling in a first generation hybrid, by the union of unreduced (2n) gametes or by hybridization between two autopolyploids (not shown). Polyploid speciation is likely to be a predominant mode of sympatric speciation in plants (Otto and Whitton 2000) and can also contribute to allopatric speciation (Lynch and Conery 2000). Of all speciation processes in flowering plants, polyploidy has been estimated to account for 2-4% (Otto and Whitton 2000). It is less common among animals, but polyploids can still be found in many animal lineages (Otto and Whitton 2000). Unlike other speciation processes, polyploidization is often assumed to constitute a special form of instant speciation whereby the newly formed polyploid is immediately and completely reproductively isolated from its progenitor species (Coyne and Orr 2004; Linder and Rieseberg 2004; Mallet 2007). This is expected to occur because hybrids between a polyploid and its ancestors have an uneven number of chromosome sets, potentially leading to meiotic non-disjunction and infertility in hybrids. However, not all hybrids are completely sterile, and it has been shown that hybridization between polyploids and their ancestors can constitute a bridge that allows gene flow across ploidy levels (Ramsey and Schemske 1998; Petit et al. 1999; Husband 2004; Henry et al. 2005; Henry et al. 2007). Although this process can lead to shared polymorphism across ploidy levels, such observations have more often been interpreted as signs of multiple origins of the polyploid, and the consensus in the field is that most polyploids originated more than once (Soltis and Soltis 1993; 1999; 2000). Exceptions include the peanut Arachis hypogaea (Kochert et al. 1996), the salt marsh grass Spartina anglica (Ainouche et al. 2004), and Arabidopsis suecica (Jakobsson et al. 2006), all of which appear to have had a single origin. The fact that so many extant plant species are polyploids implies that genome duplication may have been an important source of evolutionary nov- 10
11 elty, as hypothesized by Ohno (1970). Although our knowledge on the genetic and epigenetic changes accompanying polyploid formation is rapidly increasing (Chen 2007), the genetic basis of quantitative traits in established polyploids has attracted less attention. Such studies have mostly been confined to traits of agricultural importance in polyploid crops (e.g. Jiang et al. 1998; Ming et al. 2001; Schranz et al. 2002; Delourme et al. 2006). The very duplicated nature of polyploid genomes renders studies of the genetics of quantitative traits more difficult, as distinguishing homoeologous loci from loci duplicated by other means than whole genome duplication, or even from alleles is not always straightforward. Although challenging, increasing our knowledge on the role of genome duplication for quantitative trait variation in non-domesticated species is necessary in order to understand the role of polyploidy in adaptation. The model system Capsella The family Brassicaceae comprises some 340 genera and 3,350 species of which 50 % or more are believed to be polyploids (Koch et al. 2003). With the ready availability of genomic data from Arabidopsis thaliana and Brassica crop species, the Brassicaceae provide several attractive opportunities to study polyploid evolution (e.g. Jakobsson et al. 2006). The genus Capsella is one of the most closely related to A. thaliana, with an estimated divergence time of Arabidopsis and Capsella of about 10 million years (Koch et al. 2000; 2001). According to current classification the genus includes three species: the tetraploid (2n=4x=32) Capsella bursa-pastoris (L.) Medik., and two diploids (2n=2x=16), Capsella rubella Reut. and Capsella grandiflora (Fauché & Chaub.) Boiss. (Hurka and Neuffer 1997). The self-fertile C. rubella is mainly found in central-southern Europe, whereas the self-incompatible C. grandiflora has a distribution limited to the western Balkans (Chater 1993; Hurka and Neuffer 1997). Due to its phylogenetic proximity to A. thaliana, the diploid C. rubella has attracted attention as a model system for comparative studies of the evolution of genome organization in crucifers (Boivin et al. 2004; Yogeeswaran et al. 2005) and genome sequencing of C. rubella is currently underway (Schranz et al. 2006). C. bursa-pastoris, or Shepherd s Purse, is a predominantly selfing tetraploid species with disomic inheritance and a nearly worldwide distribution (Hurka and Neuffer 1997). It grows as a weed on disturbed ground, and is characterized by an extensive variability for many morphological traits such as leaf shape and fruit shape, as well as life-history traits such as flowering time (Shull 1929; Neuffer and Hurka 1986a, b; Neuffer and Bartelheim 1989; Neuffer and Eschner 1995; Ceplitis et al. 2005). C. bursa-pastoris is generally thought to have originated in the Middle East, and due to its great 11
12 colonizing ability rapidly spread across the world, reaching the Americas with European colonizers and Australia in the 18 th century (Neuffer and Hurka 1999; Ceplitis et al. 2005). The close relationship to A. thaliana means that genomic tools and data from A. thaliana can be utilized in Capsella. The genus therefore offers an excellent opportunity to study both polyploid speciation and the genetic basis of quantitative traits in a wild, non-model polyploid. We chose to concentrate on elucidating the genetic basis of flowering time, a quantitative trait of potential adaptive importance that is well studied in A. thaliana. Genetic basis of flowering time variation Flowering time is a major life-history trait contributing to reproduction and adaptation, especially in annual plants (Roux et al. 2006). The time to flowering is a quantitative trait of crucial importance for seed production, and different flowering strategies may have evolved in response to local climatic conditions (Engelmann and Purugganan 2006; Mitchell-Olds and Schmitt 2006). The genetic basis of flowering time variation is well understood in Arabidopsis thaliana, where over 60 genes with effects on flowering have been identified, mainly through mutant analysis (Ehrenreich and Purugganan 2006). Four main pathways, the photoperiod, vernalization, gibberellin and autonomous pathways, allow the plant to perceive and respond changes in daylength, temperature and hormonal status, respectively (Mouradov et al. 2002; Simpson and Dean 2002; Koornneef et al. 2004). Floral pathway integrator genes combine the signals from these pathways to fine-tune the transition from vegetative to reproductive development, although recent studies also indicate that there is direct cross-talk between pathways (Edwards et al. 2006; Gould et al. 2006; Salathia et al. 2007). Understanding the genetic basis of natural variation is of primary interest for evolutionary studies of adaptation (Mitchell-Olds and Schmitt, 2006). The precise role of flowering genes among and within species can vary significantly and the effect of allelic variation for these genes in natural populations is a focus of current research (Werner et al. 2005; Engelmann and Purugganan 2006; Roux et al. 2006; Salathia et al. 2007). Recent studies demonstrate that the main genes responsible for natural variation in flowering time can differ between populations or species, reflecting differences in genetic architecture, ecological niche and history. In A. thaliana, variation at the genes FRIGIDA (FRI) and FLOWERING LOCUS C (FLC) which are involved in the vernalization response can explain a great deal of genetic variation in flowering time (Johanson et al. 2000; Caicedo et al. 2004), and selection for earlier flowering appears to have acted on FRI (Hagenblad and Nordborg 2002; Le Corre et al. 2002; Toomajian et al. 2006). However, photoreceptor genes such as CRYPTOCHROME2 (CRY2) and PHYTOCHROME 12
13 C (PHYC) have also been implicated in natural variation flowering time in A. thaliana (El-Assal et al. 2001; Balasubramanian et al. 2006). Findings from A. thaliana have successfully been used to start to elucidate the genetic basis of natural flowering time variation in other crucifer species (B. rapa: Schranz et al. 2002, B. nigra: Kruskopf-Österberg et al. 2002, and B. oleracea: Okazaki et al. 2007). However, despite the availability of genomic tools, there is a dearth of studies on the genetic control of natural variation in flowering time in the closest relatives of A. thaliana such as Capsella spp.. Finding the genes that matter for quantitative variation Quantitative traits are traits that are affected by segregation of alleles at many loci, as well as by the environment. Identifying the genetic basis of quantitative trait variation is meaningful, not only because it allows us to answer long-standing questions on the types of polymorphisms affecting quantitative traits (e.g. cis-regulatory or coding sequence; Hoekstra and Coyne 2007; Wray 2007) and their effect sizes, but also because such studies can ultimately contribute to our understanding of the evolutionary forces that maintain such variation (Barton and Keightley 2002; Mitchell-Olds et al. 2007). However, the path to identifying the genes underlying phenotypic variation is often long and difficult, and in most cases a combination of approaches is required for successful identification of causative polymorphisms. Three of the currently most common approaches will be outlined below, namely QTL (Quantitative Trait Locus) and association mapping, and gene expression microarray analysis. A main aim in genetics is to find out how the genes map onto the phenotype, in the words of Sydney Brenner s 2002 Nobel Prize lecture. QTL mapping and association mapping both aim to achieve this goal, identifying parts of the genome that affect phenotypic variation for quantitative traits. Both methods rely on linkage disequlibrium (the non-random association of alleles at separate loci) between linked loci, but the source of the linkage disequilibrium differs between the two methods. Whereas QTL mapping studies are usually undertaken in an experimental context, where the mapping population is created by some crossing scheme (see e.g. Lynch and Walsh 1998), association mapping relies on samples from natural populations. For QTL mapping, a common strategy is to cross two parental lines that differ in the phenotypic trait of interest to create an F1, which is then intercrossed or selfed to create an F2 mapping population, or back-crossed to one of the parental lines. The phenotypic trait is then scored in the mapping population alongside with a number of molecular markers spread across the genome, and statistical methods are applied to identify markers that are significantly associated with trait variation. Although QTL mapping studies are 13
14 useful as a first step towards identifying the genes underlying quantitative variation they also have several limitations. First, the exact QTLs identified can be dependent on the environment, making results from lab-based studies difficult to generalize to conditions in the field (Mauricio 2001). Second, when QTL studies are based on simple line crosses such as those described above, they often do not capture the genetic variation of importance in a wider population sample. Finally, as mentioned above, the limited resolution of QTL mapping is also an issue: QTLs can encompass chromosomal regions containing hundreds of genes, and without prior information on gene function and location, laborious fine-scale mapping is necessary to identify causative polymorphisms (Glazier et al. 2002). Association mapping offers (at least partial) solutions to the problems of generality and low resolution of QTL mapping. In association mapping studies, instead of generating experimental mapping populations, samples are collected from natural populations, and associations between phenotypic variation and genetic markers are then sought in these samples. Association mapping has greater resolution than QTL mapping, because of the greater number of historical recombination events in the genomes of related individuals from a natural population than between e.g. F2 individuals (Nordborg and Tavare 2002). Provided that sampling is done in a representative way, results are also more general than those for QTL based on line crosses. However, association studies suffer from elevated rates of false positives unless population structure is properly accounted for (Lander and Schork 1994; Pritchard and Rosenberg 1999). In general, the prospects for successful association mapping depend on the rate of decay of linkage disequilibrium, which is currently not known beyond a few model species (Flint- Garcia et al. 2003). The number of reports of successful genome-wide association studies (so far, mainly in humans) is currently rapidly increasing (e.g. Fellay et al. 2007; Scott et al. 2007). However, in most non-model organisms, association studies are focused on a chromosomal region identified by QTL mapping or other means, or use a candidate gene approach (i.e. focuses on genes with known functions relevant to the trait) (e.g. Thornsberry et al. 2001; Kruskopf-Österberg et al. 2002). When there are no known candidate genes for a trait, or when they are too many for them to be exhaustively evaluated, gene expression microarray studies can provide a means to select genes for further study (Wayne and McIntyre 2002). This method entails hybridizing fluorescently labeled cdna to glass slides with probes for thousands of genes, and subsequently measuring the intensity of fluorescence for each probe. Whole-genome transcription profiles obtained using microarrays can be used to identify genes that are expressed at different levels in ecotypes, tissues, developmental stages or time points relevant to the trait under study (Remington and Purugganan 2003). Such studies can provide additional information on the rela- 14
15 tive importance of different pathways for the trait, and recently have been extended to reconstruct regulatory networks and map expression QTL (Keurentjes et al. 2007). Co-localization between expression QTL and QTL for a quantitative trait of interest constitutes strong evidence that differential gene expression is important for quantitative variation (Kirst et al. 2004). When the aim is to find the genes that matter for quantitative trait variation, microarray gene expression studies are probably most powerful when used in combination with classical quantitative genetics techniques (Doerge 2002). 15
16 Aims The main aims of this study were twofold: first, to elucidate the origin of the tetraploid C. bursa-pastoris, and second, to investigate the genetic basis of variation in flowering time in this species. Specific aims I II III IV V Study phylogenetic relationships between diploid and tetraploid Capsella species using nuclear and cpdna sequences (Paper I). Evaluate the possibility of post-polyploidization gene flow between C. bursa-pastoris and C. rubella (Paper II). Characterize genome-wide differential gene expression between early- and late-flowering C. bursa-pastoris accessions (Paper III). Map QTL for flowering time in an F2 mapping population (Paper IV). Assess whether polymorphism at candidate flowering time genes are associated with flowering time in natural populations (Paper V). 16
17 Results and Discussion Polyploid speciation in Capsella Intrageneric phylogeny of Capsella (Paper I) In paper I, we investigated the phylogenetic relationships between the diploids C. rubella and C. grandiflora and the tetraploid C. bursa-pastoris. Based on isozyme and chloroplast restriction patterns, C. bursa-pastoris was previously hypothesized to be an allopolyploid of C. rubella and C. grandiflora (Hurka et al. 1989; Mummenhoff and Hurka 1990), or an autopolyploid of C. grandiflora (Hurka and Neuffer 1997). The main aim of this study was to test these hypotheses by reconstructing phylogenetic trees based on DNA sequence data. To elucidate both maternal and paternal contributions in the origin of the tetraploid C. bursa-pastoris, we obtained DNA sequences for two maternally inherited cpdna loci and parts of three biparentally inherited independent nuclear genes that are single-copy in A. thaliana: Alcohol dehydrogenase (Adh), PISTILLATA (PI) and LUMINIDEPENDENS (LD). cpdna loci were sequenced in 20 accessions of C. bursa-pastoris sampled mainly in Europe but including accessions from China, North America and Africa, 9 accessions of C. rubella from throughout the species range, two accessions of C. grandiflora and in outgroup taxa (Neslia paniculata and Halimolobos spp.). Nuclear loci were sequenced in four accessions of the tetraploid C. bursa-pastoris, and in all accessions of the diploid Capsella species. The 1.5 kb cpdna sequenced was nearly devoid of intraspecific variation in C. bursa-pastoris, where the only intraspecific polymorphism was a single 11-bp indel found in one accession. In agreement with this, a low level of intraspecific polymorphism was previously observed at seven chloroplast microsatellites (Ceplitis et al. 2005). Together, these observations indicate that the maternal effective population size of C. bursa-pastoris is small, perhaps because the species had a single maternal origin. 17
18 Figure 2. Phylogenetic trees, with bootstrap values, for the cpdna data set (A), Adh (B), LD (C) and PI (D). For the cpdna data set and for Adh, a single most parsimonious tree was found. For LD and PI, one of the two most parsimonious trees is shown. C. bursa-pastoris is abbreviated by Cbp, C. rubella by Cr and C. grandiflora by Cg. 18
19 If C. rubella or C. grandiflora was the maternal ancestor of C. bursapastoris, one would expect cpdna sequences from C. bursa-pastoris to cluster with sequences from either of these diploids. However, neither C. rubella nor C. grandiflora were sister to C. bursa-pastoris in the single, well-supported phylogeny retrieved for the cpdna data set (Fig. 2). In order to maintain that either of these extant diploid Capsella species constitutes the maternal parent of C. bursa-pastoris, one would therefore have to invoke additional processes of chloroplast divergence and/or sorting to explain the observed pattern. For all three nuclear loci sequenced, the diploid Capsella accessions exhibited no signs of gene duplication, whereas two sequence types were retrieved in all C. bursa-pastoris accessions. These sequence types probably correspond to duplicated loci because they did not segregate as alleles in offspring of each of the four C. bursa-pastoris accessions ( fixed heterozygosity ). In combination with the lack of evidence for duplication in the diploids, this indicates that these sequences are likely to correspond to homoeologous loci. In the ideal case, sequences for homoeologous loci should cluster with the same or with different diploid species if the tetraploid were an auto- or allopolyploid, respectively. However, in the present study, neither of these two possible topologies appeared for any of the three nuclear genes (Fig. 2). Even though the topologies for the three different nuclear loci were similar, none of them can be easily reconciled with either of the previous hypotheses on the origin of the tetraploid C. bursa-pastoris. In each phylogenetic tree, sequences from each diploid species formed a clade, as did the sequences for one of the C. bursa-pastoris homoeologs (the homoeolog designated with a B in Fig. 2). At the other homoeolog (designated with an A in Fig. 2) however, some C. bursa-pastoris accessions harbored an allele shared with C. rubella. At Adh, C. bursa-pastoris accession SE14 from Sweden harbored such a shared allele, at LD, accession 721 from California had an allele shared with C. rubella, and at PI, accession 740 from Nevada had such an allele. The presence of alleles shared with C. rubella in C. bursa-pastoris was an unexpected finding. There are at least two possible explanations for this. First, the C. rubella alleles could be present in C. bursa-pastoris as remnants of a polyploidization event including C. rubella or a species harboring C. rubella-like alleles. This retention of ancestral polymorphism scenario would be more likely if the tetraploid had multiple origins, as a single polyploid speciation event is an extreme bottleneck that would be unlikely to leave several alleles segregating in the newly formed tetraploid population. Alternatively, the C. rubella alleles could have been introduced into C. bursa-pastoris after the establishment of the tetraploid, i.e. as a result of recent introgressive hybridization. Due to the limited number of C. bursa- 19
20 pastoris accessions sequenced for nuclear genes, distinguishing between these hypotheses was not possible in this study. Multiple origins or introgression (Paper II) In paper II, we sequence six nuclear loci duplicated by polyploidy in 92 accessions of the tetraploid C. bursa-pastoris, and in 21 accessions of its close diploid relative C. rubella. We compare patterns of allele sharing and nucleotide diversity in western Eurasia, where C. bursa-pastoris and C. rubella occur in partial sympatry, with those in eastern Eurasia, where C. rubella does not grow. In order to distinguish between ancestral polymorphism, rendered more likely if the tetraploid originated more than once, and introgression as the cause of allele sharing, we employ coalescent-based divergence population genetic analyses to quantify gene flow across ploidy levels. Mean nucleotide diversity ( ) of C. bursa-pastoris was an order of magnitude higher in western than in eastern Eurasia ( vs ). There was allele sharing between C. bursa-pastoris and C. rubella in western but not in eastern Eurasia. In samples from western Eurasia, C. bursapastoris accessions shared alleles with C. rubella at one of the homoeologs of four nuclear genes: Alcohol dehydrogenase (Adh), CRYPTOCHROME 1 (CRY1), LUMINIDEPENDENS (LD) and PISTILLATA (PI). For each of these genes, the C. bursa-pastoris homoeolog that harbored C. rubella alleles in western Eurasia was also the least divergent from C. rubella in C. bursa-pastoris from eastern Eurasia. Shared polymorphism in sympatry but not in allopatry is usually considered a hallmark of introgressive hybridization, but because C. bursa-pastoris is believed to have originated in the near Middle East or the Balkans (Hurka and Neuffer 1997) this pattern could also be due to retention of ancestral polymorphism, especially if the tetraploid arose more than once. We therefore proceeded to test whether our data was better explained by a model of speciation with or without gene flow between C. bursa-pastoris and C. rubella. For this purpose, we used an isolationwith-migration model that allows for population size change (Hey 2005). Our prediction was that, if allele-sharing between C. rubella and C. bursapastoris is only due to retention of ancestral polymorphism, then estimates of gene flow between these species should be zero. If, on the other hand, hybridization and introgression have occurred, then some estimates of gene flow between species should be non-zero. Indeed, we found the latter to be true. Using the isolation-with-migration model, there was evidence for uni-directional gene flow from C. rubella to C. bursa-pastoris in western Eurasia, where C. bursa-pastoris and C. rubella are partially sympatric and share alleles (Fig. 3). In eastern Eurasia, where C. rubella is absent, there was no evidence for gene flow in either direction (Fig. 3). Analyses of both geographical samples supported a scenario where 20
21 the origin of the tetraploid C. bursa-pastoris constituted a severe bottleneck, after which the species underwent a strong population expansion to a current effective population size of about Figure 3. Probability density estimates for gene flow (A) and timing of migration (B). A. The left plot shows the probability density for gene flow in western Eurasia, from C. rubella to C. bursa-pastoris in black and from C. bursa-pastoris to C. rubella in grey. The right plot shows the probability density for gene flow in eastern Eurasia. B. Posterior probability distributions for the time of introgression from C. rubella to C. bursa-pastoris (black) and the time of gene flow from western to eastern Eurasian C. bursa-pastoris populations (grey), for LD. For each locus analyzed, only a few, quite recent introgression events are sufficient to explain the observed pattern of polymorphism. The timing of these events is necessarily coarse and dependent on model specifics and mutation rate assumptions. However, the general timeframe suggests that hybridization and introgression could have taken place during or after the last glacial maximum (ca 18 ka). The lack of shared alleles in eastern Eurasia despite their presence at moderately high frequencies in western Eurasia suggests that C. bursa-pastoris may have spread to eastern Eurasia before hybridization and introgression took place in western Eurasia. Indeed, the timing of migration events supported such a scenario for all genes where C. bursa-pastoris shared alleles with C. rubella (Fig. 3). Because all loci had 21
22 negative values for Tajima s D in the sample from eastern Eurasia, it appears that a demographic process such as a founder event followed by population expansion may have affected genetic variation in this region. A scenario where C. bursa-pastoris originated in the Middle East and subsequently spread both eastwards to Asia and westwards to Europe, where introgressive hybridization with C. rubella took place, is in agreement with this analysis. Divergence population genetic analyses are increasingly being used to assess gene flow between and within diploid species. In this study, we used an extension of the isolation-with-migration model (Hey 2005) which allows the specification of a set of parameters to create a realistic framework for polyploid speciation. Our results show that polyploid speciation need not result in immediate and complete reproductive isolation, that postpolyploidization hybridization and introgression can contribute significantly to genetic variation in a newly formed polyploid, and that divergence population genetic analysis constitutes a powerful way of testing hypotheses on polyploid speciation. 22
23 Genetic basis of flowering time variation in C. bursapastoris Differential gene expression and flowering time variation (Paper III) The aim of paper III was to characterize gene expression differences between early- and late-flowering C. bursa-pastoris accessions, in order to identify flowering pathways that might be involved in generating natural flowering time variation in this species. Based on a data from a survey of natural flowering time variation (Ceplitis et al. 2005), we chose two ecotypes that were extreme in their flowering responses, the early-flowering accession PL from Puli, Taiwan, and the late-flowering accession SE14 from Härnösand, Sweden. We assessed the flowering time of these accessions with and without vernalization treatment, and survival analysis showed that all four groups (non-vernalized and vernalized plants of each accession) differed in flowering time (Fig. 4). Both accessions responded to vernalization, although the effect was greater for accession SE14 than for PL. Figure 4. Predicted probability of survival (not flowering) for each of the four strata, using a nonparametric Cox proportional hazards model. The horizontal axis displays the flowering time and the vertical axis displays the predicted probability of not flowering (a value of 1.0 indicates none of the plants are flowering). Accession SE14 is shown in grey and PL in black. Dashed lines are for vernalized plants and entire lines for non-vernalized plants of each accession. Using Arabidopsis (Arabidopsis thaliana) microarrays, we found a large number of significant differences in gene expression between 1-week-old seedlings of these ecotypes. A total of 21 known flowering time genes were differentially expressed between extreme flowering ecotypes (at false discovery rate, FDR 0.1), and most of these were genes that were involved 23
24 either in regulating circadian rhythm or gibberellic acid (GA) biosynthesis and signaling (Fig. 5). In accordance with this, there was a significant overrepresentation of differentially expressed genes in the Gene Ontology category circadian rhythm (P = 0.023, Fisher s exact test) as well as of genes involved in GA biosynthesis and signaling (P = 0.042, Fisher s exact test). FLOWERING LOCUS C (FLC), a key flowering time regulator in A. thaliana, was not differentially expressed between ecotypes prior to vernalization. Figure 5. Overview of flowering time pathways in A. thaliana. Figures are adapted from (Mouradov et al. 2002), (He and Amasino 2005) and (Roux et al. 2006). Genes that were significantly differentially expressed between accessions are in boldface. Genes that were up-regulated in SE14 compared to PL are marked in green and those that are down-regulated in SE14 compared to PL are marked in magenta. A detailed time-series study of the expression of two core circadian genes clearly demonstrated that the two extreme flowering ecotypes differed in circadian rhythm. Good agreement in differential expression of flowering time genes was found in a biological validation using an independent pair of North American ecotypes with less extreme differences in flowering time, suggesting a shared genetic basis of these expression differences, or parallel evolution of similar regulatory differences. In A. thaliana, the circadian clock is an integral component in the external coincidence model for photoperiodic flowering, and altered clock function can also cause differences in 24
25 the expression of GA biosynthesis genes (Blazquez et al. 2002). Therefore, we conclude that genes involved in regulation of the circadian clock are strong candidates for the evolution of flowering time variation in C. bursapastoris. QTL mapping (Paper IV) The aim of paper IV was to map QTL responsible for flowering time variation using AFLP and gene-specific markers. For this purpose, we obtained F2 seeds from a cross of two North American flowering time ecotypes described in Linde et al. (2001). Seeds were germinated and the flowering time of 157 F2 individuals was assessed under long-day conditions. Using six selective primer combinations, a total of 102 AFLP loci were obtained. Gene-specific primers were developed to facilitate comparisons to other Brassicaceae genomes. The candidate flowering time genes CONSTANS (CO), DE-ETIOLATED 1 (DET1), FCA, FLOWERING LOCUS C (FLC), FRIGIDA (FRI), GA REQUIRING 1 (GA1) and LUMINIDEPENDENS (LD) were chosen for development of gene-specific markers. For each gene, we aimed at mapping both homoeologs, but this was only possible for FCA, GA1 and LD. Only one homoeolog of FRI and neither of the homoeologs of CO, DET1 and FLC could be mapped because there were no sequence differences between the mapping parents for any of these loci in the regions examined. In total, seven loci corresponding to four different flowering time genes (GA1, FCA, FRI and LD) were therefore successfully mapped in this cross. The final linkage map consisted of 89 loci (82 AFLP loci and seven gene-based loci). These loci were distributed on 15 linkage groups (one fewer than the haploid chromosome number in C. bursa-pastoris). Putative homoeologous loci for each flowering-time gene mapped to different linkage groups, as expected for true homoeologs. Overall, the genome structure of C. bursa-pastoris appears very similar to that in A. lyrata and C. rubella. For instance, the LD and FCA genes which are situated on one chromosome in A. thaliana but on two separate chromosomes in A. lyrata, also mapped to independent linkage groups in this study. Of the 157 F2 individuals, 133 had flowered before 200 days. The flowering time of the early-flowering parental line was 45 days and that of the lateflowering parent was 91 days. The 133 F2 individuals had an average flowering time of 64 days and a right-skewed distribution of flowering times. A single-qtl genome scan revealed two QTL with LOD scores exceeding the genome-wide 1% significance level. These QTL explained 19.5% and 16.5% of the genetic variation in flowering time, and were found on linkage groups CBP06 and CBP14, located at 30.1 cm and 65.9 cm, respectively (Fig. 6). The most closely situated gene-based markers were LD A and GA1 A on CBP06 at 0.0 cm and 2.7 cm, respectively, and LD B and GA1 B on CBP14 at 15.8 cm and 14.5 cm, respectively. 25
26 Figure 6. The two QTL for flowering time map to linkage groups CBP06 (A) and CBP14 (B). The horizontal axis shows the map position in cm and the vertical axis the lod score.the positions of gene-based markers for LD and GA1 are shown on the horizontal axis. Thus, the QTL for flowering time map to homoeologous linkage groups, which could mean that polymorphisms in homoeologous genes underlie these QTL. However, fine-scale mapping is necessary to determine whether this is the case. In summary, this study outlined two chromosomal regions of particular interest for studies of flowering time variation in C. bursapastoris, namely the parts of linkage groups CBP06 and CBP14 corresponding to the upper part of A. lyrata chromosome AL6. Genes involved in regulating the circadian rhythm and the GA pathway differed in expression between the mapping parents (these accessions were used for biological validation in Paper III). Therefore, candidate flowering time genes in this chromosomal region with such effects on gene expression are of special interest for studies of the genetic basis of flowering time variation in C. bursa-pastoris. Association mapping (Paper V) In paper V, we test whether introgressive hybridization has played a role in the evolution of flowering time variation in Capsella. The tetraploid C. bursa-pastoris has experienced introgressive hybridization with its close relative C. rubella in western Eurasia, but not in China (Paper II). Here, we measured flowering time and obtained DNA sequences for eight candidate genes for flowering time and ten background loci not involved in flowering time regulation, in two large samples from western Eurasia and China. Population stratification was assessed using the background loci, and we tested whether candidate gene polymorphisms were associated with flowering time 26
27 variation using a mixed-model approach which takes population structure into account (Yu et al. 2006; Zhao et al. 2007). Candidate genes were selected partly based on a previous study that mapped two major QTL for flowering time to homoeologous linkage groups (Paper IV). These linkage groups correspond to the upper part of A. lyrata chromosome AL6. Here, we sequenced parts of both homoeologs of two candidate genes located in this chromosomal region, LUMINIDEPENDENS (LD) and CRYPTOCHROME1 (CRY1). In addition, we included two candidate flowering time genes in the vernalization pathway, FRIGIDA (FRI) and FLOWERING LOCUS C (FLC), which are responsible for a large part of the natural variation in flowering time in A. thaliana. We found no evidence for population structure in China, whereas analysis using STRUCTURE (Pritchard et al. 2000) indicated the presence of a southern and a northern cluster in western Eurasia. In western Eurasia, four SNPs in two candidate genes, CRY1 A and FLC A, were significantly associated with flowering time variation. In China, a SNP in FLC A was also significantly associated with flowering time variation. Both FLC A SNPs that were associated with flowering time are potentially functional polymorphisms, because they disrupt consensus splice sites. Chinese accessions with a non-consensus splice donor site 3 of exon five had an FLC A transcript which lacked exon five, and flowered earlier than accessions with a consensus splice donor site (Figs. 7, 8). Even though the FLC A splice site mutation that segregated in European accessions was located in a different position than that found in China, their predicted coding sequences were identical (Fig. 7). This suggests that parallel loss of FLC A exon five has evolved in different parts of the species distribution, perhaps as a result of selection for early flowering. If the absence of FLC exon five affects the function of this protein, early flowering would be the expected outcome given that FLC is a potent repressor of the transition to flowering. 27
28 Figure 7. Effect of different FLC A SNP495 alleles on splicing. A. The predicted cds in the sequenced fragment of FLC A lacks exon 5 in Chinese accessions (GY31 and GY36) with a non-consensus splice donor site at SNP position 495. Accessions with the consensus splice donor site (XY106, SE14) have a predicted cds containing exon 5. B. GY31 and GY 36 produce a shorter transcript than accessions with the consensus splice donor sequence AG (XA106, SE14). (The first eight wells after the ladder contain PCR products for samples not included in this study). C. Accessions with the non-consensus splice site have a 43-bp deletion in the FLC A transcript, corresponding to exon five. Accessions with the consensus splice donor sequence AG have a normal FLC A transcript. In XA106 and SE14, both homoeologs of FLC were detected, as indicated by the ambiguous positions marked by + signs. Only FLC A was detected in accessions GY36 and GY31. The CRY1 A SNPs that were significantly associated with flowering time in western Eurasia define a haplotype that is shared with C. rubella, probably as a result of introgression (Paper II). Accessions harboring the C. rubella haplotype flowered later than those with C. bursa-pastoris haplotypes (Fig. 8). This suggests that introgressive hybridization has contributed to quantitative variation in flowering time. CRY1 is an attractive candidate locus for flowering time in C. bursa-pastoris, because differences in circadian rhythm and gibberellin biosynthesis gene expression previously observed between early- and late-flowering C. bursa-pastoris accessions (Slotte et al. 2007) 28
29 could be caused by functional polymorphism at CRY1. However, the CRY1 A SNPs that were associated with flowering time are not themselves expected to affect the function of the protein (they are all synonymous) but instead might be in linkage disequilibrium with a causative polymorphism in CRY1 A or a linked gene. Figure 8. Estimated effects of significant candidate gene SNPs on flowering time (mean number of days to flowering, DTF ± standard error). A. In western Eurasia, the C at SNP 8 in CRY1 A is only found in the northern cluster (Q1), where it is associated with later flowering. The haplotype containing the C allele at SNP 8 is shared with C. rubella. B. In China, the A at SNP 495 in FLC A which yields a nonconsensus splice site is associated with earlier flowering. In conclusion, the results suggest that different polymorphisms are associated with flowering time variation in two parts of the species range. In western Eurasia we find that alleles shared with C. rubella, probably as a result of introgressive hybridization, are associated with flowering time variation. In addition, splice site polymorphisms in FLC are associated with flowering time in both regions. Although further work is needed to fully characterize the genetic polymorphisms involved, this study suggests that introgression and differential splicing could be important for the evolution of flowering time in C. bursa-pastoris. 29
30 Conclusions In summary, our investigations into polyploid speciation in Capsella yielded several unexpected results. First, C. bursa-pastoris does not appear to be an allopolyploid of C. rubella and C. grandiflora as was previously hypothesized, nor does it seem to be an autopolyploid of C. grandiflora (paper I). The true ancestor(s) of C. bursa-pastoris remain unknown, but must have been closely related to both C. rubella and C. grandiflora. Second, unlike commonly assumed, polyploid speciation did not confer immediate and complete reproductive isolation in Capsella (paper II). Instead, our studies indicate that unidirectional gene flow from C. rubella to C. bursa-pastoris has taken place in western Eurasia, where these species occur in mixed populations. Such post-polyploidization gene flow could constitute an important but often overlooked source of genetic variation in polyploids. In the following papers (III-V), we used three different approaches to characterize the genetic basis of flowering time in C. bursa-pastoris. In summary, we found that genes involved in GA biosynthesis and response and regulation of the circadian clock differ in expression between early- and late-flowering C. bursa-pastoris (Paper III), that two main QTL for flowering time map to homoeologous regions of the C. bursa-pastoris genome, corresponding to the upper part of A. lyrata chromosome AL6 (Paper IV) and that introgressed alleles at one homoeolog of a gene situated in this region, CRYPTOCHROME 1 (CRY1), as well as splice site polymorphisms in a FLOWERING LOCUS C (FLC) homoeolog are associated with natural flowering time variation in C. bursa-pastoris (Paper V). Future studies of the genetic basis of flowering time variation in C. bursapastoris should aim to identify causal polymorphisms in CRY1 and nearby genes, to functionally characterize the effects of FLC splicing variation on flowering time and to conduct fine-mapping of the identified QTL regions to determine whether homoeologous genes are responsible for flowering time variation in this tetraploid. In general, C. bursa-pastoris constitutes a good model system to investigate variation in introgression across the genome and its effect on quantitative trait variation in a polyploid species. 30
31 Svensk sammanfattning Hos lomme, en senapsväxt som finns över hela världen, blommar populationer från nordliga breddgrader senare än sådana från sydliga breddgrader. Blomningstiden, tiden från sådd till blomning, tros därför utgöra en anpassning till miljön hos denna art. I min avhandling har jag undersökt vilka gener detta beror på, samt hur arten lomme bildats. I den första artikeln använde vi oss av DNA-sekvenser för att undersöka hur den vanliga lommen är släkt med storlomme och skärlomme. Vi fann att en del av den genetiska variationen i kärn-dnat delades mellan vanlig lomme och skärlomme, en art som enbart finns i Syd- och Centraleuropa. För att förstå hur detta kunde komma sig samlade vi in DNA-sekvenser för fler gener och prover. En populationsgenetisk analys visade att dessa arter troligen delar genetisk variation eftersom de hybridiserat med varandra (artikel II). Detta var ett oväntat resultat, eftersom lomme är tetraploid, dvs har har fyra kromosomer av varje sort medan de andra arterna har två. Sådana korsningar brukar leda till sterilitet hos avkomman, men detta gäller inte alltid hos växter och tydligen inte hos lomme. För att förstå hur blomningstiden styrs i lomme använde vi tre olika metoder. I artikel III undersökte vi geners aktivitet. Två klasser av gener som har effekt på blomningstid hos andra arter skilde sig i aktivitet mellan tidigoch senblommande lomme. Dessa gener påverkar växtens dygnsrytm, samt signaleringen och produktionen av växthormonet gibberellin. Gener som är inblandade i dessa processer kan alltså ha betydelse för blomningstid hos lomme. Vi identifierade därefter områden i lommes arvsmassa som har stor betydelse för variationen i blomningstid, på basen av en korsning mellan tidigoch senblommande lomme (artikel IV). Det fanns två sådana områden, och de satt på duplicerade kromosomer. Detta kan betyda att duplicerade gener är viktiga för blomningstid, men det behövs mer detaljerade studier för att avgöra om så är fallet. Slutligen studerade vi genetisk variation och blomningstid i en större uppsättning prover av lomme från västra Eurasien och Kina (artikel V). Det fanns ett samband mellan genetisk variation och blomningstid för två gener, CRYPTOCHROME1 (CRY1) och FLOWERING LOCUS C (FLC). Eftersom CRY1 sitter i den del av arvsmassan som vi identifierade i artikel IV är det troligt att denna gen eller någon som sitter nära den på samma kromosom är viktig för blomningstid. Intressant nog delade lomme genetisk variation med 31
32 skärlomme för just denna gen, så hybridiseringen mellan dessa arter kan ha påverkat blomningstiden hos lomme. Det verkar alltså som om både duplicerade kromosomer och hybridisering bidragit till variationen i blomningstid hos lomme. Resultaten av den här studien är viktiga för vår förståelse av huruvida duplicering av arvsmassan kan utgöra en fördel och bidra till växters anpassning till miljön. 32
33 Acknowledgements Several people have helped me in the work on this thesis, and I am deeply grateful to all of them. First and foremost I would like to thank my main supervisor Martin Lascoux for all his support and encouragement. Second, I would like to thank my assistant supervisor Ulf Lagercrantz, for numerous discussions on questions related to flowering time, for sharing his extensive technical expertise, and for being very friendly and helpful. Many thanks to fellow Capsella bursa-pastoris workers Alf Ceplitis, Huirun Huang and Karl Holm. I am deeply indebted to all of you for your input and the discussions that went into this thesis. I have greatly appreciated collaborating with Anna Palmé, Kate St. Onge and Jesper Bechsgaard on C. rubella and C. grandiflora. Several people helped me in the lab: Mattias Myrenås, Jun Chen and Robert Malmgren. Special thanks to everyone who read and commented on draft manuscripts, especially Sunniva Aagaard, Koen Verhoeven and Anna Palmé. Barbara Neuffer at Osnabrück University kindly contributed valuable plant material. My sincerest thanks to all of you! I learned a great deal during my stay in the Computational Genomics lab at Purdue University in I am very grateful to Lauren M. McIntyre for all her statistical advice and for generously hosting me. Many thanks also to Koen, Lisa and Jason, who made my stay in West Lafayette, Indiana very enjoyable. Thanks to everyone in the departments of Evolutionary Functional Genomics and Population Biology for creating a nice working environment and for many laughs during the coffee breaks. Special thanks to Kerstin Santesson and Susanne Gustafsson who kept the lab up and running during my time here! I would also like to thank the friends who took my mind off work every once in a while and my family for their constant support. Finally, my deepest thanks to Tobias, for always being there. 33
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
T Statistical Natural Language Processing Answers 6 Collocations Version 1.0
T-61.5020 Statistical Natural Language Processing Answers 6 Collocations Version 1.0 1. Let s start by calculating the results for pair valkoinen, talo manually: Frequency: Bigrams valkoinen, talo occurred
MEETING PEOPLE COMMUNICATIVE QUESTIONS
Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
7. Product-line architectures
7. Product-line architectures 7.1 Introduction 7.2 Product-line basics 7.3 Layered style for product-lines 7.4 Variability management 7.5 Benefits and problems with product-lines 1 Short history of software
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
AYYE 9/ HOUSING POLICY
AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we
The role of 3dr sector in rural -community based- tourism - potentials, challenges
The role of 3dr sector in rural -community based- tourism - potentials, challenges Lappeenranta, 5th September 2014 Contents of the presentation 1. SEPRA what is it and why does it exist? 2. Experiences
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)
Tilasto T1106120-s2012palaute Kyselyn T1106120+T1106120-s2012palaute yhteenveto: vastauksia (4) Kysymys 1 Degree programme: (4) TIK: TIK 1 25% ************** INF: INF 0 0% EST: EST 0 0% TLT: TLT 0 0% BIO:
Skene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene
Skene Muokkaa perustyyl. Games Refueled napsautt. @Games for Health, Kuopio Muokkaa alaotsikon perustyyliä napsautt. 2013 kari.korhonen@tekes.fi www.tekes.fi/skene 10.9.201 3 Muokkaa Skene boosts perustyyl.
Increase of opioid use in Finland when is there enough key indicator data to state a trend?
Increase of opioid use in Finland when is there enough key indicator data to state a trend? Martta Forsell, Finnish Focal Point 28.9.2015 Esityksen nimi / Tekijä 1 Martta Forsell Master of Social Sciences
1. Liikkuvat määreet
1. Liikkuvat määreet Väitelauseen perussanajärjestys: SPOTPA (subj. + pred. + obj. + tapa + paikka + aika) Suora sanajärjestys = subjekti on ennen predikaattia tekijä tekeminen Alasääntö 1: Liikkuvat määreet
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
MUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
State of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Statistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.2017 Life Science Technologies Where Life Sciences meet with Technology
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL Ville Liljeström, Micha Matusewicz, Kari Pirkkalainen, Jussi-Petteri Suuronen and Ritva Serimaa 13.3.2012
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds
PhD Anne Hemmi 14.2.2013 RRR 2013 Conference in Greifswald, Germany Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds Eutrophication in surface waters High nutrient
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
GOOD WORK LONGER CAREER:
Juhani Ilmarinen, Ville Ilmarinen, Pekka Huuhtanen, Veikko Louhevaara, Ove Näsman GOOD WORK LONGER CAREER: WORK WELL-BEING IN FINNISH TECHNOLOGY INDUSTRIES 2010-2015 Background Collective agreement between
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
Smart specialisation for regions and international collaboration Smart Pilots Seminar
Smart specialisation for regions and international collaboration Smart Pilots Seminar 23.5.2017 Krista Taipale Head of Internaltional Affairs Helsinki-Uusimaa Regional Council Internationalisation
Group 2 - Dentego PTH Korvake. Peer Testing Report
Group 2 - Dentego PTH Korvake Peer Testing Report Revisions Version Date Author Description 1.0 Henrik Klinkmann First version Table of Contents Contents Revisions... 2 Table of Contents... 2 Testing...
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
Curriculum. Gym card
A new school year Curriculum Fast Track Final Grading Gym card TET A new school year Work Ethic Detention Own work Organisation and independence Wilma TMU Support Services Well-Being CURRICULUM FAST TRACK
Academic Opening. Opening - Introduction. In this essay/paper/thesis I shall examine/investigate/evaluate/analyze General opening for an essay/thesis
- Introduction In this essay/paper/thesis I shall examine/investigate/evaluate/analyze General opening for an essay/thesis Tässä esseessä / tutkielmassa / opinnäytetyössä tutkin / tarkastelen / arvioin/
Research plan for masters thesis in forest sciences. The PELLETime 2009 Symposium Mervi Juntunen
Modelling tree and stand characteristics and estimating biomass removals and harvesting costs of lodgepole pine (Pinus contorta) plantations in Iceland Research plan for masters thesis in forest sciences
Land-Use Model for the Helsinki Metropolitan Area
Land-Use Model for the Helsinki Metropolitan Area Paavo Moilanen Introduction & Background Metropolitan Area Council asked 2005: What is good land use for the transport systems plan? At first a literature
DIGITAL MARKETING LANDSCAPE. Maatalous-metsätieteellinen tiedekunta
DIGITAL MARKETING LANDSCAPE Mobile marketing, services and games MOBILE TECHNOLOGIES Handset technologies Network technologies Application technologies INTRODUCTION TO MOBILE TECHNOLOGIES COMPANY PERSPECTIVE
Guidebook for Multicultural TUT Users
1 Guidebook for Multicultural TUT Users WORKPLACE PIRKANMAA-hankkeen KESKUSTELUTILAISUUS 16.12.2010 Hyvää käytäntöä kehittämässä - vuorovaikutusopas kansainvälisille opiskelijoille TTY Teknis-taloudellinen
Supply Chain Management and Material Handling in Paper Industry Case Tervakoski Oy
Tampere University of Applied Sciences Paper technology International Pulp and Paper Technology Supply Chain Management and Material Handling in Paper Industry Case Tervakoski Oy Supervisor Commissioned
RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla
TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua
Genome 373: Genomic Informatics. Professors Elhanan Borenstein and Jay Shendure
Genome 373: Genomic Informatics Professors Elhanan Borenstein and Jay Shendure Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
The Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
Olet vastuussa osaamisestasi
Olet vastuussa osaamisestasi Ohjelmistoammattilaisuuden uudet haasteet Timo Vehmaro 02-12-2015 1 Nokia 2015 Mitä osaamista tulevaisuudessa tarvitaan? Vahva perusosaaminen on kaiken perusta Implementaatio
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks. David R. Kelley
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks David R. Kelley DNA codes for complex life. How? Kundaje et al. Integrative analysis of 111 reference
Functional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet
LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50
HARJOITUS- PAKETTI A
Logistiikka A35A00310 Tuotantotalouden perusteet HARJOITUS- PAKETTI A (6 pistettä) TUTA 19 Luento 3.Ennustaminen County General 1 piste The number of heart surgeries performed at County General Hospital
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät
4x4cup Rastikuvien tulkinta
4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
Metsälamminkankaan tuulivoimapuiston osayleiskaava
VAALAN KUNTA TUULISAIMAA OY Metsälamminkankaan tuulivoimapuiston osayleiskaava Liite 3. Varjostusmallinnus FCG SUUNNITTELU JA TEKNIIKKA OY 12.5.2015 P25370 SHADOW - Main Result Assumptions for shadow calculations
Valuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
EUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä
M a t t i K a t t a i n e n O T M 1 1. 0 9. 2 0 1 9 Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä Ympäristöoikeustieteen
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145
OX2 9 x N131 x HH145 Rakennuskanta Asuinrakennus Lomarakennus Liike- tai julkinen rakennus Teollinen rakennus Kirkko tai kirkollinen rak. Muu rakennus Allas Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 2 km
Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a
, Tuulivoimahanke Layout 9 x N131 x HH145 Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 km 2 SHADOW - Main Result Assumptions for shadow calculations
WindPRO version joulu 2012 Printed/Page :42 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 13.6.2013 19:42 / 1 Minimum
Data Quality Master Data Management
Data Quality Master Data Management TDWI Finland, 28.1.2011 Johdanto: Petri Hakanen Agenda 08.30-09.00 Coffee 09.00-09.30 Welcome by IBM! Introduction by TDWI 09.30-10.30 Dario Bezzina: The Data Quality
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto If you are searched for a book by Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice over LTE (VoLTE) in pdf form, then you have come
EVALUATION FOR THE ERASMUS+-PROJECT, STUDENTSE
#1 Aloitettu: 6. marraskuuta 2015 9:03:38 Muokattu viimeksi: 6. marraskuuta 2015 9:05:26 Käytetty aika: 00:01:47 IP-osoite: 83.245.241.86 K1: Nationality Finnish K2: The program of the week has been very
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel. Kalle Lehto, Aalto-yliopisto 5.5.
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel Kalle Lehto, Aalto-yliopisto 5.5.2011 Otaniemi ReFuel a three year research project (2009-2011) goal utilize the
ProAgria. Opportunities For Success
ProAgria Opportunities For Success Association of ProAgria Centres and ProAgria Centres 11 regional Finnish ProAgria Centres offer their members Leadership-, planning-, monitoring-, development- and consulting
Palveluiden asiakastyytyväisyyskysely
Palveluiden asiakastyytyväisyyskysely Yhteenvetoa (Summary in English, see below) Sakari Heikkilä Kehityspalvelut Kyselystä Henkilöstölle suunnattu kysely oli avoinna 2.3.-26.3. Uutista ja siihen liittyviä
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
Oma sininen meresi (Finnish Edition)
Oma sininen meresi (Finnish Edition) Hannu Pirilä Click here if your download doesn"t start automatically Oma sininen meresi (Finnish Edition) Hannu Pirilä Oma sininen meresi (Finnish Edition) Hannu Pirilä
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Calculation: N117 x 9 x HH141 Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG
Tampere-Pirkkala airport Survey on noise
Tampere-Pirkkala airport Survey on noise Satu Routama Presentation in N-ALM/Copenhagen May 206, Mikko Viinikainen Tampere-Pirkkala airport In 204 400 000 pax (4th biggest in Finland) 5 000 ops (3rd biggest
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.9.269
Mat Seminar on Optimization. Data Envelopment Analysis. Economies of Scope S ysteemianalyysin. Laboratorio. Teknillinen korkeakoulu
Mat-2.4142 Seminar on Optimization Data Envelopment Analysis Economies of Scope 21.11.2007 Economies of Scope Introduced 1982 by Panzar and Willing Support decisions like: Should a firm... Produce a variety
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
( ,5 1 1,5 2 km
Tuulivoimala Rakennukset Asuinrakennus Liikerak. tai Julkinen rak. Lomarakennus Teollinen rakennus Kirkollinen rakennus Varjostus "real case" h/a 1 h/a 8 h/a 20 h/a 4 5 3 1 2 6 7 8 9 10 0 0,5 1 1,5 2 km
WindPRO version joulu 2012 Printed/Page :47 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä. public-procurement
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä https://ec.europa.eu/futurium/en/ public-procurement Julkiset hankinnat liittyvät moneen Konsortio Lähtökohdat ja tavoitteet Every
FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting
FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists
Supporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
ELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period
1 ELEMET- MOCASTRO Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions Period 20.02-25.05.2012 Diaarinumero Rahoituspäätöksen numero 1114/31/2010 502/10
Miksi Suomi on Suomi (Finnish Edition)
Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Click here if your download doesn"t start automatically Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Miksi Suomi on Suomi (Finnish Edition)