Information Retrieval
|
|
- Johannes Heikkinen
- 6 vuotta sitten
- Katselukertoja:
Transkriptio
1 Information Retrieval Searching erms atrick Schäfer Ulf Leser
2 Content of this Lecture Searching strings Naïve exact string matching Boyer-Moore BM-Variants and comparisons Schäfer, Leser: Searching Strings, Winter Semester 2016/2017 2
3 Searching Strings in ext All IR models require finding occurrences of terms in documents Fundamental operation: find(k,d) -> (DD) Indexing: reprocess docs and use index for searching Apply tokenization; can only find entire words Classical IR technique (inverted files) Online searching: Consider docs and query as new No preprocessing - slower Usually without tokenization more searchable substrings Classical algorithmic problem: Substring search Schäfer, Leser: Searching Strings, Winter Semester 2016/2017 3
4 roperties Advantages of substring search Does not require (erroneous, ad-hoc) tokenization U.S., 35,00=.000, alpha-type1 AML-3 protein, Search across tokens / sentences / paragraphs, that, happen., Searching prefixes, infixes, suffixes, stems compar, ver (German), Searching substrings is harder than searching terms Number of unique terms doesn t increase much with corpus size (from a certain point on) English: ~ 1 Million terms, but 200 Million potential substrings of size 6 Need to index all possible substrings Schäfer, Leser: Searching Strings, Winter Semester 2016/2017 4
5 ypes of Substring Searching Exact search: Find all exact occurrences of a pattern (substring) p in D RegExp matching: Find all matches of a regular exp. p in D Approximate search: Find all substrings in D that are similar to a pattern p honetically similar (Soundex) Only one typo away (keyboard errors) Strings that can be produced from p by at most n operations of type insert a letter, delete a letter, change a letter Multiple strings: Searching >1 strings at once in D Schäfer, Leser: Searching Strings, Winter Semester 2016/2017 5
6 Definition: Strings A String S is a sequential, ordered list of characters from a finite alphabet Σ S is the number of characters in S ositions in S are counted from 1,..., S S[i] denotes the character at position i in S S dadfabzzb S[i..j] denotes the substring of S starting at position i and ending at position j (including both) S[1..i] or S[..i] is the prefix of S until position i S[i.. S ] or S[i..] is the suffix of S starting from position i S[..i] (S[i..]) is called a proper prefix (suffix) of S iff i 0 (not empty) and i S (not entire String). Schäfer, Leser: Searching Strings, Winter Semester 2016/2017 6
7 Exact Substring Matching Given: attern to search for, text to search in We require ( is longer than ) We assume << ( is much longer than ) ask: Find all occurrences of in Where is GAAC tcagcttactaattaaaaattctttctagtaagtgctaagatcaagaaaataaattaaaaataatggaacatggcacattttcctaaactcttcacagattgctaatga ttattaattaaagaataaatgttataattttttatggtaacggaatttcctaaaatattaattcaagcaccatggaatgcaaataagaaggactctgttaattggtact attcaactcaatgcaagtggaactaagttggtattaatactcttttttacatatatatgtagttattttaggaagcgaaggacaatttcatctgctaataaagggattac atatttatttttgtgaatataaaaaatagaaagtatgttatcagattaaacttttgagaaaggtaagtatgaagtaaagctgtatactccagcaataagttcaaataggc gaaaaactttttaataacaaagttaaataatcattttgggaattgaaatgtcaaagataattacttcacgataagtagttgaagatagtttaaatttttctttttgtatt acttcaatgaaggtaacgcaacaagattagagtatatatggccaataaggtttgctgtaggaaaattattctaaggagatacgcgagagggcttctcaaatttattcaga gatggatgtttttagatggtggtttaagaaaagcagtattaaatccagcaaaactagaccttaggtttattaaagcgaggcaataagttaattggaattgtaaaagatat ctaattcttcttcatttgttggaggaaaactagttaacttcttaccccatgcagggccatagggtcgaatacgatctgtcactaagcaaaggaaaatgtgagtgtagact ttaaaccatttttattaatgactttagagaatcatgcatttgatgttactttcttaacaatgtgaacatatttatgcgattaagatgagttatgaaaaaggcgaatatat tattcagttacatagagattatagctggtctattcttagttataggacttttgacaagatagcttagaaaataagattatagagcttaataaaagagaacttcttggaat tagctgcctttggtgcagctgtaatggctattggtatggctccagcttactggttaggttttaatagaaaaattccccatgattgctaattatatctatcctattgagaa caacgtgcgaagatgagtggcaaattggttcattattaactgctggtgctatagtagttatccttagaaagatatataaatctgataaagcaaaatcctggggaaaatat tgctaactggtgctggtagggtttggggattggattatttcctctacaagaaatttggtgtttactgatatccttataaataatagagaaaaaattaataaagatgatat Schäfer, Leser: Searching Strings, Winter Semester 2016/2017 7
8 How to do it? he straight-forward way (naïve algorithm) We use two counters: t, p One (outer, t) runs through One (inner, p) runs through Compare characters at position [t+p-1] and [p] for t = 1 to p := 1; while (p <= and [t+p 1] == [p]) p := p + 1; end while; if (p == ) then REOR t end for; ctgagatcgcgta gagatc gagatc gagatc gagatc gagatc gatatc gatatc gatatc Schäfer, Leser: Searching Strings, Winter Semester 2016/2017 8
9 Examples ypical case Worst case ctgagatcgcgta gagatc gagatc gagatc gagatc gagatc gatatc gatatc gatatc aaaaaaaaaaaaaa aaaaat aaaaat aaaaat aaaaat... How many comparisons do we need in the worst case? t runs through p runs through the entire for every value of t hus: * comparisons Indeed: he algorithm has worst-case complexity O( * ) Schäfer, Leser: Searching Strings, Winter Semester 2016/2017 9
10 Other Algorithms Exact substring search has been researched for decades Boyer-Moore, Z-Box, Knuth-Morris-ratt, Karp-Rabin, Shift-AND, All have WC complexity O( + ) For many, WC=AC, but empirical performance differs much Real performance depends much on the size of alphabet and the composition of strings (algs have their strength in certain settings) Better performance possible if is preprocessed (up to O( )) In practice, our naïve algorithm is quite competitive for non-trivial alphabets and biased letter frequencies E.g., English text But we can do better: Boyer-Moore We present a simplified form BM is among the fastest algorithms in practice Schäfer, Leser: Searching Strings, Winter Semester 2016/
11 Content of this Lecture Searching strings Naïve exact string matching Boyer-Moore BM-Variants and comparisons Schäfer, Leser: Searching Strings, Winter Semester 2016/
12 Boyer-Moore Algorithm R.S. Boyer /J.S. Moore. A Fast String Searching Algorithm, Communications of the ACM, 1977 Main idea As for the naïve alg, we use two counters (inner loop, outer loop) Inner loop runs from right-to-left If we reach a mismatch, we know he character in we just haven t seen his is captured by the bad character rule he suffix in we just have seen his is captured by the good suffix rule Use this knowledge to make longer shifts in Schäfer, Leser: Searching Strings, Winter Semester 2016/
13 Boyer-Moore Main Idea Inner loop runs from right-to-left If we reach a mismatch, and this bad character does not appear in at all, we can shift the pattern my positions: dadfabzzbwzzbzzb aaba aaba Schäfer, Leser: Searching Strings, Winter Semester 2016/
14 Bad Character Rule Setting 1 We are at position t in and compare right-to-left Let i by the position of the first mismatch in, n= We saw n-i matches before Let x be the character at the corresponding pos (t-n+i) in Candidates for matching xx in Case 1: xx does not appear in at all we can move t such that t-n+i is not covered by anymore dadfabzzbwzzbzzb abwzabzz dadfabzzbwzzbzzb abwzabzz abwzabzz t-n+i t What next? Schäfer, Leser: Searching Strings, Winter Semester 2016/
15 Bad Character Rule 2 j a 5 b 6 Setting 2 We are at position t in and compare right-to-left Let i by the position of the first mismatch in, n= Let x be the character at the corresponding pos (t-n+i) in Candidates for matching xx in Case 1: xx does not appear in at all w 3 z 8 Case 2: Let j be the right-most appearance of xx in and let j<i we can move t such that j and t align dadfabzzbwzzbzzb abwzabzz dadfabzzbwzzbzzb abwzabzz abwzabzz j i What next? Schäfer, Leser: Searching Strings, Winter Semester 2016/
16 Bad Character Rule 3 Setting 3 We are at position t in and compare right-to-left Let i by the position of the first mismatch in, n= Let x be the character at the corresponding pos (t-n+i) in Candidates for matching xx in Case 1: x does not appear in at all Case 2: Let j be the right-most appearance of xx in and let j<i Case 3: As case 2, but j>i we need some more knowledge dadfabzzbwzzbzzb abwzabzz i j Schäfer, Leser: Searching Strings, Winter Semester 2016/
17 reprocessing 1 In case 3, there are some xx right from position i For small alphabets (DNA), this will almost always be the case In human languages, this is often the case (e.g. for vowels) hus, case 3 is a usual one hese xx are irrelevant we need the right-most xx left of i his can (and should!) be pre-computed Build a two-dimensional array A[, ] Run through from left-to-right (pointer i) If character c appears at position i, set all A[c,j]:=i for all j>=i Requested time (complexity?) negligible Because << and complexity independent from Array: Constant lookup, needs some space (lists ) Schäfer, Leser: Searching Strings, Winter Semester 2016/
18 (Extended) Bad Character Rule abwzabzz A a b w z dadfabzzbwzzbzzb abwzabzz dadfabzzbwzzbzzb abwzabzz abwzabzz i A[ z,5] Schäfer, Leser: Searching Strings, Winter Semester 2016/
19 (Extended) Bad Character Rule EBCR: Shift t by i-a[x,i] positions Simple and effective for larger alphabets For random strings over, average shift-length is /2 hus, n# of comparisons down to *2/ Worst-Case complexity does not change Why? Schäfer, Leser: Searching Strings, Winter Semester 2016/
20 (Extended) Bad Character Rule EBCR: Shift t by i-a[x,i] positions Simple and effective for larger alphabets For random strings over, average shift-length is /2 hus, n# of comparisons down to *2/ Worst-Case complexity does not change Why? Shift-length can be always 1: =g m ggggggggggggggggggggggggggggggggggggggggg =ag n O( * ) aggggggggggg aggggggggggg aggggggggggg aggggggggggg Schäfer, Leser: Searching Strings, Winter Semester 2016/
21 Good-Suffix Rule Recall: If we reach a mismatch, we know he character in we just haven t seen he suffix in we just have seen Good suffix rule We have just seen some matches (let these be S) in Where else does S appear in? If we know the right-most appearance S of S in, we can immediately align S with the current match in If S does not appear anymore in, we can shift t by x S x S S y S S y S Schäfer, Leser: Searching Strings, Winter Semester 2016/
22 Good-Suffix Rule One Improvement Actually, we can do a little better Not all S are of interest to us Schäfer, Leser: Searching Strings, Winter Semester 2016/
23 Good-Suffix Rule One Improvement Actually, we can do a little better Not all S are of interest to us x S x S S y S y S y S We only need S whose next character to the left is not y Why don t we directly require that this character is x? Of course, this could be used for further optimization Schäfer, Leser: Searching Strings, Winter Semester 2016/
24 Good-Suffix Rule Special case: Let S be a suffix of S and S be a prefix of : x S x S S y S S y S We have to align S with S. Schäfer, Leser: Searching Strings, Winter Semester 2016/
25 Good-Suffix-Rule reprocessing 2 Use two arrays: osition of the longest suffix f: f[i] stores the starting position of prefix [i..] in the suffix of. Maximum shift s: s[i] stores for position i the maximum shift to the left f c a b a a b g b a a s Schäfer, Leser: Searching Strings, Winter Semester 2016/
26 Concluding Remarks reprocessing 2 For the GSR, we need to find all occurrences of all suffixes of in his can be solved using our naïve algorithm for each suffix Or, more complicated, in linear time (not this lecture) WC complexity of Boyer-Moore is still O( * ) But average case is sub-linear: O( / ); especially when >, which causes many shifts by. WC complexity can be reduced to linear (not this lecture), but this usually doesn t pay-off on real data Schäfer, Leser: Searching Strings, Winter Semester 2016/
27 Boyer-Moore - Algorithm Compare characters at position [t+ -p-1] and [p] t runs from left-to-right through ; p runs from right-to-left through ; Mismatch: shift by maximum of GSR and EBCR. Match found: shift using GSR. for t := 1 to - +1 do p := ; while (p > 0 and [t+ -p-1] == [p]) do p := p-1; end while if (p==0) then // match REOR t; shift t to largest prefix of, which is also a suffix of else // no match shift t by GSR, EBCR; end for Schäfer, Leser: Searching Strings, Winter Semester 2016/
28 Example b b c g g b c b a a g g b b a a c a b a a b g b a a c g c a b a a b c a b c a b a a b g b a a b b c g g b c b a a g g b b a a c a b a a b g b a a c g c a b a a b c a b EBCR wins c a b a a b g b a a b b c g g b c b a a g g b b a a c a b a a b g b a a c g c a b a a b c a b GSR wins c a b a a b g b a a b b c g g b c b a a g g b b a a c a b a a b g b a a c g c a b a a b c a b GSR wins c a b a a b g b a a b b c g g b c b a a g g b b a a c a b a a b g b a a c g c a b a a b c a b Match Mismatch Good suffix Ext. Bad character c a b a a b g b a a Schäfer, Leser: Searching Strings, Winter Semester 2016/
29 Content of this Lecture Searching strings Naïve exact string matching Boyer-Moore BM-Variants and comparisons Schäfer, Leser: Searching Strings, Winter Semester 2016/
30 wo Faster Variants BM-Horspool Drop the good suffix rule GSR makes algorithm slower in practice Rarely shifts longer than EBCR Needs time to compute the shift Instead of looking at the mismatch character x, always look at the symbol in aligned to the last position of Generates longer shifts on average (i is maximal) BM-Sunday Instead of looking at the mismatch character x, always look at the symbol in after the symbol aligned to the last position of Generates even longer shifts on average Alternative: Always look at the least frequent (in the language of ) symbol of first Schäfer, Leser: Searching Strings, Winter Semester 2016/
31 BM Variants abcabdaacba bcaab bcaab abcabdaacba bcaab bcaab abcabdaacba bcaab bcaab (a) Boyer-Moore (b) BM-Horspool (c) BM-Sunday abcabdaacba bcaab bcaab (d) BM-Sunday + Least Frequent Char Schäfer, Leser: Searching Strings, Winter Semester 2016/
32 Empirical Comparison n Machine word Shift-OR: Using parallelization in CU (only small alphabets) BNDM: Backward nondeterministic Dawg Matching (automata-based) BOM: Backward Oracle Matching (automata-based) Schäfer, Leser: Searching Strings, Winter Semester 2016/
33 Self Assessment Explain the Boyer-Moore algorithm Which rule is better GSR or EBCR? How can we efficiently implement EBCR? How does the Sunday algorithm deviate from BM? How can we use character frequencies to speed up BM? If we do so - which part of the algorithm is sped up? Schäfer, Leser: Searching Strings, Winter Semester 2016/
Searching (Sub-)Strings. Ulf Leser
Searching (Sub-)Strings Ulf Leser This Lecture Exact substring search Naïve Boyer-Moore Searching with profiles Sequence profiles Ungapped approximate search Statistical evaluation of search results Ulf
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
Tietorakenteet ja algoritmit
Tietorakenteet ja algoritmit Taulukon edut Taulukon haitat Taulukon haittojen välttäminen Dynaamisesti linkattu lista Linkatun listan solmun määrittelytavat Lineaarisen listan toteutus dynaamisesti linkattuna
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition)
Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition) Click here if your download doesn"t start automatically
1. Liikkuvat määreet
1. Liikkuvat määreet Väitelauseen perussanajärjestys: SPOTPA (subj. + pred. + obj. + tapa + paikka + aika) Suora sanajärjestys = subjekti on ennen predikaattia tekijä tekeminen Alasääntö 1: Liikkuvat määreet
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
T Statistical Natural Language Processing Answers 6 Collocations Version 1.0
T-61.5020 Statistical Natural Language Processing Answers 6 Collocations Version 1.0 1. Let s start by calculating the results for pair valkoinen, talo manually: Frequency: Bigrams valkoinen, talo occurred
The Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
1.3Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 81122P (4 ov.) 30.5.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
Oma sininen meresi (Finnish Edition)
Oma sininen meresi (Finnish Edition) Hannu Pirilä Click here if your download doesn"t start automatically Oma sininen meresi (Finnish Edition) Hannu Pirilä Oma sininen meresi (Finnish Edition) Hannu Pirilä
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
Skene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene
Skene Muokkaa perustyyl. Games Refueled napsautt. @Games for Health, Kuopio Muokkaa alaotsikon perustyyliä napsautt. 2013 kari.korhonen@tekes.fi www.tekes.fi/skene 10.9.201 3 Muokkaa Skene boosts perustyyl.
Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen
Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen Who we are FIN-CLARIN University of Helsinki The Language Bank of Finland CSC - The Center for
Salasanan vaihto uuteen / How to change password
Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change
Small Number Counts to 100. Story transcript: English and Blackfoot
Small Number Counts to 100. Story transcript: English and Blackfoot Small Number is a 5 year-old boy who gets into a lot of mischief. He lives with his Grandma and Grandpa, who patiently put up with his
S-55.1100 SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA
S-55.00 SÄHKÖKNKKA A KONKKA. välikoe 2..2008. Saat vastata vain neljään tehtävään!. aske jännite U. = 4 Ω, 2 = Ω, = Ω, = 2, 2 =, = A, 2 = U 2 2 2 2. ännitelähde tuottaa hetkestä t = t < 0 alkaen kaksiportaisen
Exercise 1. (session: )
EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
Statistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
Miksi Suomi on Suomi (Finnish Edition)
Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Click here if your download doesn"t start automatically Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Miksi Suomi on Suomi (Finnish Edition)
BDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET.
BDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET. Pekka Ollikainen Open Source Microsoft CodePlex bio Verkkosivustovastaava Suomen Sarjakuvaseura
AYYE 9/ HOUSING POLICY
AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we
FinFamily Installation and importing data (11.1.2016) FinFamily Asennus / Installation
FinFamily Asennus / Installation 1 Sisällys / Contents FinFamily Asennus / Installation... 1 1. Asennus ja tietojen tuonti / Installation and importing data... 4 1.1. Asenna Java / Install Java... 4 1.2.
Käyttöliittymät II. Käyttöliittymät I Kertaus peruskurssilta. Keskeisin kälikurssilla opittu asia?
Käyttöliittymät II Sari A. Laakso Käyttöliittymät I Kertaus peruskurssilta Keskeisin kälikurssilla opittu asia? 1 Käyttöliittymät II Kurssin sisältö Käli I Käyttötilanteita Käli II Käyttötilanteet selvitetään
MEETING PEOPLE COMMUNICATIVE QUESTIONS
Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
Operatioanalyysi 2011, Harjoitus 4, viikko 40
Operatioanalyysi 2011, Harjoitus 4, viikko 40 H4t1, Exercise 4.2. H4t2, Exercise 4.3. H4t3, Exercise 4.4. H4t4, Exercise 4.5. H4t5, Exercise 4.6. (Exercise 4.2.) 1 4.2. Solve the LP max z = x 1 + 2x 2
Sisällysluettelo Table of contents
Sisällysluettelo Table of contents OTC:n Moodlen käyttöohje suomeksi... 1 Kirjautuminen Moodleen... 2 Ensimmäinen kirjautuminen Moodleen... 2 Salasanan vaihto... 2 Oma käyttäjäprofiili... 3 Työskentely
Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Uusi Ajatus Löytyy
Travel Getting Around
- Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting
FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?
Huom. tämä kulma on yhtä suuri kuin ohjauskulman muutos. lasketaan ajoneuvon keskipisteen ympyräkaaren jänteen pituus
AS-84.327 Paikannus- ja navigointimenetelmät Ratkaisut 2.. a) Kun kuvan ajoneuvon kumpaakin pyörää pyöritetään tasaisella nopeudella, ajoneuvon rata on ympyränkaaren segmentin muotoinen. Hitaammin kulkeva
Alueellinen yhteistoiminta
Alueellinen yhteistoiminta Kokemuksia alueellisesta toiminnasta Tavoitteet ja hyödyt Perusterveydenhuollon yksikön näkökulmasta Matti Rekiaro Ylilääkäri Perusterveydenhuollon ja terveyden edistämisen yksikkö
1.3 Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 811122P (5 op.) 12.12.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä
Metsälamminkankaan tuulivoimapuiston osayleiskaava
VAALAN KUNTA TUULISAIMAA OY Metsälamminkankaan tuulivoimapuiston osayleiskaava Liite 3. Varjostusmallinnus FCG SUUNNITTELU JA TEKNIIKKA OY 12.5.2015 P25370 SHADOW - Main Result Assumptions for shadow calculations
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
Valuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
Capacity utilization
Mat-2.4142 Seminar on optimization Capacity utilization 12.12.2007 Contents Summary of chapter 14 Related DEA-solver models Illustrative examples Measure of technical capacity utilization Price-based measure
( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145
OX2 9 x N131 x HH145 Rakennuskanta Asuinrakennus Lomarakennus Liike- tai julkinen rakennus Teollinen rakennus Kirkko tai kirkollinen rak. Muu rakennus Allas Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 2 km
ALOITUSKESKUSTELU / FIRST CONVERSATION
ALOITUSKESKUSTELU / FIRST CONVERSATION Lapsen nimi / Name of the child Lapsen ikä / Age of the child yrs months HYVINKÄÄN KAUPUNKI Varhaiskasvatuspalvelut Lapsen päivähoito daycare center / esiopetusyksikkö
Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a
, Tuulivoimahanke Layout 9 x N131 x HH145 Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 km 2 SHADOW - Main Result Assumptions for shadow calculations
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.9.269
MRI-sovellukset. Ryhmän 6 LH:t (8.22 & 9.25)
MRI-sovellukset Ryhmän 6 LH:t (8.22 & 9.25) Ex. 8.22 Ex. 8.22 a) What kind of image artifact is present in image (b) Answer: The artifact in the image is aliasing artifact (phase aliasing) b) How did Joe
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
WindPRO version joulu 2012 Printed/Page :47 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
4x4cup Rastikuvien tulkinta
4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,
MUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
TM ETRS-TM35FIN-ETRS89 WTG
VE1 SHADOW - Main Result Calculation: 8 x Nordex N131 x HH145m Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please
WindPRO version joulu 2012 Printed/Page :42 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 13.6.2013 19:42 / 1 Minimum
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
ProAgria. Opportunities For Success
ProAgria Opportunities For Success Association of ProAgria Centres and ProAgria Centres 11 regional Finnish ProAgria Centres offer their members Leadership-, planning-, monitoring-, development- and consulting
Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site
Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site Note! Before starting download and install a fresh version of OfficeProfessionalPlus_x64_en-us. The instructions are in the beginning of the exercise.
EUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
Basic Flute Technique
Herbert Lindholm Basic Flute Technique Peruskuviot huilulle op. 26 Helin & Sons, Helsinki Basic Flute Technique Foreword This book has the same goal as a teacher should have; to make himself unnecessary.
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
RINNAKKAINEN OHJELMOINTI A,
RINNAKKAINEN OHJELMOINTI 815301A, 18.6.2005 1. Vastaa lyhyesti (2p kustakin): a) Mitkä ovat rinnakkaisen ohjelman oikeellisuuskriteerit? b) Mitä tarkoittaa laiska säikeen luominen? c) Mitä ovat kohtaaminen
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Calculation: N117 x 9 x HH141 Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG
Data Quality Master Data Management
Data Quality Master Data Management TDWI Finland, 28.1.2011 Johdanto: Petri Hakanen Agenda 08.30-09.00 Coffee 09.00-09.30 Welcome by IBM! Introduction by TDWI 09.30-10.30 Dario Bezzina: The Data Quality
Data protection template
Data protection template Aihe: rekisteriseloste ja informointipohja Topic: information about the register and information to users (related to General Data Protection Regulation (GDPR) (EU) 2016/679) Mallina
TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015
1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti
The role of 3dr sector in rural -community based- tourism - potentials, challenges
The role of 3dr sector in rural -community based- tourism - potentials, challenges Lappeenranta, 5th September 2014 Contents of the presentation 1. SEPRA what is it and why does it exist? 2. Experiences
Metal 3D. manufacturing. Kimmo K. Mäkelä Post doctoral researcher
Metal 3D manufacturing Kimmo K. Mäkelä Post doctoral researcher 02.11.2016 Collaboration! 2 Oulun yliopisto Definition - What does Additive Manufacturing mean? Additive manufacturing is a manufacturing
Ajettavat luokat: SM: S1 (25 aika-ajon nopeinta)
SUPERMOTO SM 2013 OULU Lisämääräys ja ohje Oulun Moottorikerho ry ja Oulun Formula K-125ry toivottaa SuperMoto kuljettajat osallistumaan SuperMoto SM 2013 Oulu osakilpailuun. Kilpailu ajetaan karting radalla
Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen
The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? 10.10.01 Tuomo Suortti Ohjelman päällikkö Riina Antikainen Ohjelman koordinaattori 10/11/01 Tilaisuuden teema Kansainvälistymiseen
Suunnittelumallit (design patterns)
Suunnittelumallit (design patterns) Ohjelmoinnissa Rakennusarkkitehtuurissa Käyttöliittymäsuunnittelussa Sear ch Ohjelmointi Suunnittelumallit Usein toistuvia ohjelmointiongelmia ja niiden ratkaisuja:
Returns to Scale Chapters
Return to Scale Chapter 5.1-5.4 Saara Tuurala 26.9.2007 Index Introduction Baic Formulation of Retur to Scale Geometric Portrayal in DEA BCC Return to Scale CCR Return to Scale Summary Home Aignment Introduction
SELL Student Games kansainvälinen opiskelijaurheilutapahtuma
SELL Student Games kansainvälinen opiskelijaurheilutapahtuma Painonnosto 13.5.2016 (kansallinen, CUP) Below in English Paikka: Nääshalli Näsijärvenkatu 8 33210 Tampere Alustava aikataulu: Punnitus 12:00-13:00
,0 Yes ,0 120, ,8
SHADOW - Main Result Calculation: Alue 2 ( x 9 x HH120) TuuliSaimaa kaavaluonnos Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered
( ,5 1 1,5 2 km
Tuulivoimala Rakennukset Asuinrakennus Liikerak. tai Julkinen rak. Lomarakennus Teollinen rakennus Kirkollinen rakennus Varjostus "real case" h/a 1 h/a 8 h/a 20 h/a 4 5 3 1 2 6 7 8 9 10 0 0,5 1 1,5 2 km